ID: 1101639254

View in Genome Browser
Species Human (GRCh38)
Location 12:106575078-106575100
Sequence GGGCACTAAATAATAATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1378
Summary {0: 1, 1: 1, 2: 15, 3: 168, 4: 1193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101639254 Original CRISPR GGGCACTAAATAATAATGAA AGG Intronic
903688600 1:25152366-25152388 GGTCACTAACTAATAATAAAAGG + Intergenic
903988053 1:27243511-27243533 GGCCACTAAATAATAATTACTGG - Intronic
905759500 1:40542720-40542742 TCACAATAAATAATAATGAATGG + Intronic
905848482 1:41255348-41255370 GGGCTCAAAATATTAATAAAGGG - Intergenic
906020597 1:42626088-42626110 GGTCATTATATAATAATAAAGGG - Intronic
906839327 1:49119916-49119938 GGCCATTACATAATAATAAAGGG - Intronic
906997169 1:50808893-50808915 GGGCATTACATAATGCTGAAGGG + Intronic
907015436 1:51007635-51007657 GGGCATTACATAATGGTGAAGGG + Intergenic
907295871 1:53453830-53453852 AGGCACAAAATAGTAATGGATGG - Intergenic
907605143 1:55808651-55808673 GGTCACTATATAATGATAAAGGG + Intergenic
907633638 1:56109656-56109678 GGACACTATATAATTATAAAAGG + Intergenic
907910950 1:58825384-58825406 GGGTCCTAAAGAATAATAAAGGG - Intergenic
908604392 1:65779028-65779050 GGGAACTATATAATGATAAAGGG + Intergenic
908712812 1:67036511-67036533 GGTCACTATATAATGATAAAGGG - Intronic
908733053 1:67247049-67247071 GGGCATTACATAATGATAAAAGG - Intronic
908908247 1:69041035-69041057 GGTCACTATATAATGATAAAGGG + Intergenic
908944207 1:69474780-69474802 GGGTACTAAATAAATTTGAAAGG + Intergenic
909322511 1:74307542-74307564 GGGCATTATATAATGATGAAGGG + Intronic
909430550 1:75582867-75582889 ATGCAATAATTAATAATGAAGGG - Intronic
909616049 1:77609294-77609316 GGTCACTATGTAATGATGAAGGG + Intronic
909764640 1:79340283-79340305 GGGCACTACAGTATAATGAGAGG - Intergenic
910290128 1:85592155-85592177 GGTCATTCAATAATAATAAAGGG + Intergenic
910324242 1:85986305-85986327 AGGCAATAAATAATAAAGATTGG - Intronic
910518177 1:88087465-88087487 GGGCACTACATAATGATAAAGGG - Intergenic
911374993 1:97041702-97041724 GGGCATTACATAATGATAAAGGG - Intergenic
911510990 1:98807348-98807370 GGGCATTACATAATGATAAAGGG + Intergenic
911794285 1:102056885-102056907 GGTCACTATATAATGATAAAAGG + Intergenic
911794746 1:102061041-102061063 GGGCACTACATAATAGTAAAGGG + Intergenic
911801125 1:102139816-102139838 GGGCATTAAATAATGGTAAAGGG + Intergenic
911854196 1:102856181-102856203 GGGCATTAAATAATGGTAAAGGG - Intergenic
911908780 1:103604312-103604334 GGTCACTATATAATGATAAAGGG + Intergenic
911914137 1:103675149-103675171 GGTCACTATATAATGATAAAGGG - Intronic
911940908 1:104046404-104046426 GGGCATTACATAATGATAAAGGG - Intergenic
911982244 1:104582020-104582042 GGGCATTGATTAAAAATGAATGG - Intergenic
912041286 1:105394427-105394449 GGTCATTACATAATAATAAAGGG - Intergenic
912059220 1:105644069-105644091 GGTCACTATATAATGATAAAGGG + Intergenic
912100297 1:106195213-106195235 GGGCATTCCATAATAATAAAGGG + Intergenic
912141166 1:106729774-106729796 GGTCACTACATAATAATAAGAGG + Intergenic
912588730 1:110791948-110791970 GGGCATTAAATAATGATAAAGGG + Intergenic
912639180 1:111328585-111328607 GGGCATTACATAATGATAAAGGG - Intergenic
912856628 1:113174360-113174382 GATCACTATATAATAATAAAGGG + Intergenic
912882736 1:113433587-113433609 GGTCACTAAATATCAATGAATGG - Intronic
912887543 1:113490789-113490811 GGGCATTACATAATGATAAAGGG + Intronic
912899003 1:113627753-113627775 GGTCATTATATAATAATAAAGGG - Intronic
913031383 1:114907060-114907082 GGGCATTTAATTATAATCAAAGG - Intronic
913720142 1:121584895-121584917 GGGCACTACATAATGGTAAAGGG - Intergenic
914401114 1:147320771-147320793 GGGCACTACATAATGGTAAAGGG + Intergenic
914895982 1:151673770-151673792 GGTCACTATATAATGATAAAGGG - Intronic
914953030 1:152134673-152134695 GGTCATTATATAATAATAAATGG + Intergenic
915077057 1:153317106-153317128 GTGCACTAAAAAATAATAAAGGG - Intergenic
915771538 1:158430745-158430767 GGGCATTACATAATGATAAAGGG - Intergenic
915880195 1:159662225-159662247 GGTCACTATATAATGATAAAGGG - Intergenic
915967093 1:160319292-160319314 GGTCACTATATAATGATAAAGGG + Intronic
916301421 1:163278946-163278968 GGTCACTATATAATGATAAAGGG + Intronic
916593979 1:166224776-166224798 GGGCATTACATAATAGTAAAGGG - Intergenic
916795108 1:168159691-168159713 GGACATTATATAATAATAAAGGG - Intergenic
917009496 1:170455456-170455478 GGGCACTACATAATGGTAAAGGG - Intergenic
917061458 1:171046027-171046049 GGTCACTATATAATGATAAAAGG - Intronic
917305510 1:173619859-173619881 GGGCATTACATAACAATAAAGGG + Intronic
917386919 1:174487360-174487382 GGTCACTATATAATGATAAAAGG - Intronic
917397013 1:174604152-174604174 GGGTCCTAAATAAACATGAAAGG - Intronic
917425431 1:174908065-174908087 GGTCACTATATAATGATAAAAGG + Intronic
917583581 1:176401622-176401644 GGTCACTATATAATGATAAAAGG - Intergenic
917584734 1:176414928-176414950 GGGCATTACATAATAGTAAAGGG - Intergenic
917585482 1:176422914-176422936 GGGCATTACATAATGATAAAGGG - Intergenic
917627506 1:176861259-176861281 GTTAACTAAAAAATAATGAACGG + Exonic
917673394 1:177296091-177296113 GGGCATTAAATAATGATAAAGGG - Intergenic
917832820 1:178911942-178911964 GGGCATTACATAATGATAAAGGG - Intronic
918353519 1:183682905-183682927 GGGCATTACATTATAATAAAGGG - Intronic
918727625 1:187946434-187946456 GAGCACTACATAATGATAAAAGG + Intergenic
918789682 1:188810831-188810853 GGGCACTATATAATGTTAAAGGG - Intergenic
918852571 1:189710762-189710784 GGGCATTAAATACTAATAAAGGG + Intergenic
918931622 1:190862324-190862346 GGGCACCGCATAATAATAAAGGG - Intergenic
919008821 1:191932935-191932957 GGTCACTATATAATGATAAAGGG + Intergenic
919095940 1:193036413-193036435 GGTCACTACATAATGATAAAGGG + Intronic
919146526 1:193643128-193643150 GGGCATTACATAATGGTGAAGGG - Intergenic
919287067 1:195577616-195577638 GTACACAAAACAATAATGAATGG - Intergenic
920745186 1:208620004-208620026 GGTCACTATATAATGATAAAGGG + Intergenic
920976737 1:210792786-210792808 GGACACTAAATCACAGTGAAAGG + Intronic
920990028 1:210927967-210927989 GGGCACCACATAATGATAAAAGG + Intronic
921237582 1:213149879-213149901 GGTCACTATATAATGATAAAGGG - Intronic
921391938 1:214625011-214625033 GGACACTAAATAGTGATAAAAGG - Intronic
921929475 1:220743358-220743380 GGGTACTAAATAAACTTGAAAGG - Intergenic
921969462 1:221131497-221131519 GGGCATTACATAATGATAAAGGG - Intergenic
921994274 1:221399973-221399995 GGTCACTATATAATGATAAAGGG + Intergenic
922971551 1:229745670-229745692 GGGCATTACATAATAGTAAAGGG - Intergenic
923122461 1:231004887-231004909 GGGCATTGTATAATAATAAAAGG + Intergenic
923458947 1:234190476-234190498 GGACATTATATAATGATGAAAGG + Intronic
923709461 1:236374638-236374660 GGGTATTACATAATAATAAAGGG - Intronic
924203803 1:241689497-241689519 GGGCATTACATAATGATAAAGGG + Intronic
924273185 1:242356298-242356320 GGGCATTATATAATGATAAAGGG - Intronic
924793382 1:247273243-247273265 GGGCCCTAAATAAACTTGAAAGG - Intergenic
924823494 1:247517036-247517058 GGGCACTGAATAATATTGACTGG + Intronic
924860367 1:247914405-247914427 GGGCAGTTCATAATAATAAATGG + Intergenic
924886768 1:248227129-248227151 GTGCATTACATAATGATGAAGGG - Intergenic
924949487 1:248869029-248869051 GGTCACTACATAAAAATAAAGGG + Intergenic
1062883985 10:1002321-1002343 GGTCATTATATAATAATAAAAGG - Intronic
1063056814 10:2513890-2513912 CAGCACTACATAATAATAAAGGG + Intergenic
1063960241 10:11300574-11300596 AGGGACTAAATTAAAATGAAAGG + Intronic
1064371505 10:14755758-14755780 GGACACTGAATTATCATGAAAGG + Intronic
1064509382 10:16073105-16073127 GGGCACAAAAAAGTCATGAATGG - Intergenic
1064700968 10:18021348-18021370 GGGCATTACATAATGATAAAAGG - Intronic
1064987603 10:21226482-21226504 GGGCTCTAAATAAACTTGAAAGG - Intergenic
1065087748 10:22196908-22196930 GGGCATTACATAATGATAAAAGG - Intergenic
1065196524 10:23271177-23271199 GGGCACTACATAATGGTAAAAGG + Intronic
1065381243 10:25093087-25093109 GGTCACTATATAATGATAAAGGG - Intergenic
1066042934 10:31569432-31569454 GGGCATTACAAAATAATAAAGGG + Intergenic
1066140240 10:32498130-32498152 GGGCATTACATAATCATAAAGGG - Intronic
1066377801 10:34873547-34873569 GGGCACTACCTAATGATAAAGGG + Intergenic
1066514924 10:36147911-36147933 GGGCATTATATAATGATAAAGGG + Intergenic
1066527008 10:36292176-36292198 GGTCACTACATAATGATAAAGGG - Intergenic
1066622531 10:37373584-37373606 GGTTACTATATAATAATAAAGGG - Intronic
1066711536 10:38240351-38240373 GGGCATTATATAATGATAAAGGG + Intergenic
1066752955 10:38677979-38678001 GGGCACTACGTAATGATAAAGGG + Intergenic
1066964063 10:42245021-42245043 GGGCACTAAGTAATGATAAAGGG - Intergenic
1067132982 10:43582755-43582777 GGTCACTATATAATGATAAAGGG - Intergenic
1067161957 10:43834314-43834336 GGGCATTACATAATAGTAAAGGG - Intergenic
1067197994 10:44139081-44139103 GGCCATTACATAATGATGAAGGG + Intergenic
1067422633 10:46168855-46168877 GGGCATTAAACACTAATAAAAGG - Intergenic
1067957293 10:50806358-50806380 GGGCAGTCAGTAATAATCAAGGG - Exonic
1068258042 10:54539385-54539407 GGGCATTACATAATGATAAAGGG + Intronic
1068296884 10:55081836-55081858 GGTCACTATATAATAATAAAGGG + Intronic
1068353734 10:55883236-55883258 GGGCATTACATAATGATAAAGGG + Intergenic
1068494544 10:57770283-57770305 GGACACTACATAATTATAAAGGG + Intergenic
1068557122 10:58471211-58471233 GGACACTATATAATGATAAAAGG - Intergenic
1068941372 10:62684419-62684441 GGGCACTAAATAGTTATGTTTGG - Intergenic
1069333860 10:67325959-67325981 GGGCATTACATAATAGTAAAGGG - Intronic
1069360387 10:67634732-67634754 GGGCATTACATAATGATAAAGGG + Intronic
1069368591 10:67720037-67720059 GGGCATTACATAATGGTGAAGGG - Intergenic
1069438095 10:68404551-68404573 GTGCACTAAAAAATATTGAGTGG - Intronic
1069647427 10:70012391-70012413 GGGCATTACATAATGATAAAGGG + Intergenic
1070080533 10:73181977-73181999 GGTCACTATATAATGATAAAGGG - Intronic
1070463657 10:76695660-76695682 AGGCACTACATAATGATAAAAGG - Intergenic
1070584998 10:77757732-77757754 GGTTACTATATAATAATAAAGGG + Intergenic
1070860099 10:79648641-79648663 GGGCATTAAACACTAATAAAAGG - Intergenic
1071001778 10:80839481-80839503 GGGCATTACATAATAGTAAAGGG - Intergenic
1071023988 10:81090933-81090955 GGACATTATATAATGATGAAAGG - Intergenic
1071050866 10:81447754-81447776 GGTCACTATATAACAATAAAGGG - Intergenic
1071395127 10:85215660-85215682 GGGCATTATATAATGATAAAGGG + Intergenic
1072003977 10:91224417-91224439 GGGCATGAGATAATAAAGAAGGG + Intronic
1072083775 10:92058198-92058220 GGTCACTATATAATGATAAAGGG + Intronic
1072266658 10:93735587-93735609 GGTCACTATATAATTATAAAGGG + Intergenic
1073091962 10:100949227-100949249 AGGCAGTAAATATCAATGAAAGG - Intronic
1073618999 10:105027465-105027487 TGACACTATATAATAATGAGTGG + Intronic
1073701561 10:105933551-105933573 GGTCATTAGATAATAATAAAGGG + Intergenic
1073782473 10:106854183-106854205 GGGCATTACATAATGATAAAGGG - Intronic
1074003595 10:109395872-109395894 GGGCATTAAATAATGGTAAAAGG + Intergenic
1074210121 10:111323910-111323932 GGGCATTATATAATGATTAAAGG + Intergenic
1074488474 10:113914465-113914487 GCGCACTAAATACTATTAAAAGG + Exonic
1074759103 10:116652636-116652658 GGGCATTACATAATGATAAATGG - Intergenic
1074804280 10:117032158-117032180 GGTCACTATATAATGATAAAGGG + Intronic
1076841252 10:133046902-133046924 GGGCACTGAACAATAATGCATGG - Intergenic
1076925864 10:133486363-133486385 GGACATTATATAATAATAAAGGG - Intergenic
1077684057 11:4274244-4274266 GGGCATTACATAATAGTAAAGGG + Intergenic
1077685984 11:4292520-4292542 GGGCATTACATAATAGTAAAGGG - Intergenic
1077762208 11:5114485-5114507 GGGCATTAAATAATAGTAAAAGG - Intergenic
1077766808 11:5166587-5166609 GGTCACTGTATAATAATAAAGGG - Intronic
1078311048 11:10242750-10242772 GGTCATTACATAATAATAAAAGG + Intronic
1078411740 11:11127504-11127526 GGTCACTATATAATGATAAAGGG - Intergenic
1078501895 11:11887479-11887501 GGGCATTACATAATAGTAAAGGG + Intronic
1079258656 11:18855346-18855368 GGGCATTACAAAATAACGAAGGG + Intergenic
1079272026 11:18997173-18997195 GGTCACTATATAATGATAAAGGG - Intergenic
1079555811 11:21757588-21757610 GGGCATTATATAATGATAAAGGG - Intergenic
1079706394 11:23625876-23625898 GGACACTATATAATGATAAAGGG - Intergenic
1079738121 11:24023420-24023442 GGGCATTACATAATAGTAAATGG + Intergenic
1079823157 11:25157446-25157468 GGTCACTATATAATGATAAAGGG - Intergenic
1079865360 11:25727253-25727275 GGGCATTACATAATGATAAATGG - Intergenic
1080066323 11:28019341-28019363 GGGTAATAAACCATAATGAATGG - Intergenic
1080152219 11:29066067-29066089 GGGTATTACATAATAATAAAGGG + Intergenic
1080717187 11:34814872-34814894 GGTCACTACACAATAATAAAGGG + Intergenic
1080782821 11:35447068-35447090 GGGCATTATATAATCATAAAGGG - Intronic
1080933166 11:36835080-36835102 GGGCATTACATAATGATAAAGGG - Intergenic
1080970846 11:37275043-37275065 GGGCATTACATAATGATAAAGGG - Intergenic
1080996118 11:37603954-37603976 GGGCATTACATAATGATAAAGGG + Intergenic
1081090879 11:38865153-38865175 GGACATTATATAATGATGAAAGG - Intergenic
1081285844 11:41269272-41269294 AGGAAATAAATAATAATAAAAGG - Intronic
1082199307 11:49344326-49344348 GGTAACTCAATAATAATGCATGG - Intergenic
1083131260 11:60624813-60624835 GGGCATTACATAATGATAAAGGG + Intergenic
1084910580 11:72384802-72384824 GGTCATTATATAATAATAAAGGG + Intronic
1085177309 11:74501232-74501254 GGACACTATATAATAATAAAAGG - Intronic
1086069005 11:82778672-82778694 GGTCACTATATAATGATAAAGGG + Intergenic
1086261593 11:84946820-84946842 GGGCTCTAAATAAATTTGAAAGG - Intronic
1086560087 11:88157249-88157271 GGCCATTACATAATAATAAACGG + Intronic
1086581391 11:88403567-88403589 GGGCAGAAAATAATAGTAAATGG + Intergenic
1086906898 11:92429115-92429137 GGGCACTACATAATGGTAAAGGG - Intronic
1086982261 11:93211177-93211199 GGTCACTACATAATGATAAAGGG + Intergenic
1087193132 11:95277170-95277192 GTACATAAAATAATAATGAATGG + Intergenic
1087313401 11:96577321-96577343 GGGCCCTAAATAATAAGCAGTGG - Intergenic
1087313474 11:96577758-96577780 GGGTCCTAAATAATCTTGAAAGG - Intergenic
1087356469 11:97100155-97100177 GGGCATTACATAATGATAAAGGG + Intergenic
1087380250 11:97396664-97396686 GGTCACTATATAATGATAAAGGG - Intergenic
1087482184 11:98716188-98716210 GGCCACTAAATAATGGTAAAGGG - Intergenic
1087598455 11:100283537-100283559 GGGCCCTAAATAAACTTGAAAGG - Intronic
1087616125 11:100488680-100488702 GGACACTATGTAATAATAAAAGG + Intergenic
1087681432 11:101222539-101222561 GGACACTATATAATAATAAAGGG - Intergenic
1088201702 11:107343345-107343367 GGGCATTACATAATGATGAAAGG - Intronic
1088237294 11:107739525-107739547 GGGCATTACATAATAATAAAGGG - Intergenic
1088240274 11:107767073-107767095 GAGCATTATATAATAATAAAGGG + Intergenic
1088247260 11:107830903-107830925 TGGCAAAAAATAATAATAAAAGG + Intronic
1088406189 11:109481454-109481476 GGTCACTATATAATGATAAAGGG + Intergenic
1088570239 11:111216144-111216166 GGTCACTATATAATAATAAAAGG + Intergenic
1088570286 11:111216730-111216752 GGTCACTATATAATAATGAAGGG - Intergenic
1088691126 11:112329344-112329366 GGCCACTACATAATAGTAAAGGG - Intergenic
1088985472 11:114902525-114902547 GGTCACTATATAATGATAAAGGG + Intergenic
1089193436 11:116673223-116673245 GGTCATTATATAATAATAAAGGG + Intergenic
1089819807 11:121214114-121214136 GGGCATTAAATAATGATAAAAGG + Intergenic
1089824415 11:121262028-121262050 GGTCACTATATAATGATAAAGGG - Intergenic
1090142559 11:124279905-124279927 GGGCATTACATAATGATAAAGGG + Intergenic
1090720657 11:129469444-129469466 GGGCATTACATAATAGTAAAGGG + Intergenic
1091200193 11:133772873-133772895 GGGCATGACATAATGATGAAGGG + Intergenic
1091380990 12:59326-59348 GGGCATTATATAATGATAAAAGG + Intergenic
1091966929 12:4751985-4752007 GGTCACTATATAATAAAAAAGGG - Intronic
1092398343 12:8148416-8148438 GGGCATTACATAATAGTAAAGGG + Intronic
1093001825 12:14005829-14005851 GGGCATTATATAATGATGAAAGG - Intergenic
1093105150 12:15077283-15077305 GGACATTATATAATGATGAAAGG + Intergenic
1093241258 12:16678735-16678757 GTGAAATAAATTATAATGAAAGG + Intergenic
1093413419 12:18893960-18893982 GGGCATTACATAATAATAAAGGG - Intergenic
1093495531 12:19752764-19752786 GGGCACTAGATAACCACGAAAGG - Intergenic
1093496676 12:19765459-19765481 GGGCATTATGTAATGATGAAGGG + Intergenic
1093538120 12:20247468-20247490 GGGCACTAAATAAACTTGTAAGG + Intergenic
1093659748 12:21741845-21741867 GGACATTATATATTAATGAAAGG - Intronic
1093948574 12:25137798-25137820 GGACACTACATAATGATAAAAGG + Intronic
1093963366 12:25300432-25300454 GAGTACTAAATAATAATCTATGG - Intergenic
1093986910 12:25544300-25544322 GGTCACTATATAATGATAAAGGG - Intronic
1093988594 12:25564960-25564982 GGTCACTATATAATGATAAAGGG - Intronic
1094165764 12:27441490-27441512 GGTCACTATATAATGATAAAGGG + Intergenic
1094241174 12:28226718-28226740 GGGCAGTAGATAAAAATAAAGGG - Intronic
1094559490 12:31537892-31537914 GGTCACTATATAATGATAAAGGG + Intronic
1095087054 12:38068170-38068192 GGACATTAAATAATAATAAAAGG + Intergenic
1095121951 12:38430043-38430065 AGAAACAAAATAATAATGAAGGG + Intergenic
1095133906 12:38574713-38574735 GGACACTATATAATGATAAAGGG + Intergenic
1095163575 12:38944538-38944560 GGTCACTATATAATGATAAAGGG + Intergenic
1095573713 12:43710588-43710610 GGGACCTAAATAATCATGAAAGG - Intergenic
1095625963 12:44315790-44315812 GGACATTATATAATGATGAAAGG - Intronic
1095634135 12:44411838-44411860 GGACATTACATAATAATAAAAGG + Intergenic
1095822224 12:46490656-46490678 GGGCACTTAATAAAGATAAAAGG - Intergenic
1095830738 12:46584033-46584055 GGCCACTACATAATGATAAAGGG - Intergenic
1095899195 12:47310110-47310132 GGTCACTAAATAATAATAAAGGG + Intergenic
1096306233 12:50480058-50480080 GGGCAACATATAATACTGAAAGG - Intergenic
1096956650 12:55533045-55533067 GGACATTATATAATAATAAAAGG + Intergenic
1097466196 12:59928109-59928131 GGGTTCTAAATAATCTTGAAAGG + Intergenic
1097486224 12:60205181-60205203 GGGAAGTCAATAATAATGAAAGG - Intergenic
1097508875 12:60510346-60510368 GGTCACTATATTATGATGAAGGG + Intergenic
1097662220 12:62443526-62443548 GGGCATTATATAATGATAAAGGG - Intergenic
1097741104 12:63243664-63243686 GTGCAATAAAAAATAATAAAGGG + Intergenic
1097998613 12:65917167-65917189 GGGCACTAAGTGGTAATGCATGG + Intronic
1098142627 12:67466408-67466430 GGTCACTATATAATGATAAAGGG - Intergenic
1098202024 12:68066327-68066349 GGGCATTACATAATGATAAAGGG - Intergenic
1098208011 12:68133206-68133228 GGGCTCTAAATAAGCTTGAAAGG - Intergenic
1098491778 12:71090357-71090379 GGTCACTATATAATGATAAACGG - Intronic
1098504165 12:71229690-71229712 GGTCATTATATAATAATAAAGGG + Intronic
1098506256 12:71254508-71254530 GGCCATTATATAATAATAAAAGG + Intronic
1098583491 12:72129954-72129976 GGACATGAAATAATAATAAATGG + Intronic
1098648470 12:72935998-72936020 GGTCATTATATAATAATAAAGGG - Intergenic
1098737482 12:74125302-74125324 GGCCATTACATAATAATAAAGGG + Intergenic
1098832822 12:75383442-75383464 AGGCATTACATAATAATAAAGGG + Intronic
1099022875 12:77428069-77428091 GGGCACTATATAATGGTAAAGGG - Intergenic
1099088359 12:78275707-78275729 GGGCATTACATAATGATAAAGGG - Intergenic
1099453709 12:82838983-82839005 GGGCATTAAAAATTAAAGAAAGG + Intronic
1099550802 12:84041492-84041514 GGGCATTACATAATAATAAAGGG - Intergenic
1099611702 12:84880593-84880615 TTGCTCAAAATAATAATGAATGG + Intronic
1099615344 12:84927265-84927287 GGGCACTAAATACTTGTGACTGG + Intergenic
1099732503 12:86523822-86523844 GGGCATTAAATAATGATAAAGGG - Intronic
1099759562 12:86899994-86900016 GGCCATTACATAATAATAAAAGG - Intergenic
1099767448 12:87006162-87006184 GGGCACTACATTATAATAAAGGG - Intergenic
1100054654 12:90494306-90494328 GAGCACTAAATAAGACTGAATGG + Intergenic
1100804658 12:98269301-98269323 AGTCACTATATAATAATGAAGGG + Intergenic
1100855598 12:98754793-98754815 AGGAACTAATTAAAAATGAAAGG - Intronic
1100920825 12:99484721-99484743 GGTCACTATATAATGATAAAAGG - Intronic
1100943677 12:99754265-99754287 GGGCATTACATAATCATAAAGGG + Intronic
1101162323 12:101991571-101991593 GGTCACTGTATAATAATAAAGGG - Intronic
1101470983 12:104996829-104996851 GGGCATTACATAATGATAAAGGG - Intronic
1101639254 12:106575078-106575100 GGGCACTAAATAATAATGAAAGG + Intronic
1101792746 12:107943638-107943660 GTTCACTATATAACAATGAAGGG + Intergenic
1102345319 12:112156928-112156950 GGGCATTACATAATAGTAAAGGG - Intergenic
1102802325 12:115747095-115747117 TGGCACTAAATGATAATTACTGG - Intergenic
1103121976 12:118388197-118388219 GGGGGCTAAAAAATAATGAGTGG + Intronic
1104794182 12:131505700-131505722 GGGCACTGAGTAATGAGGAAAGG + Intergenic
1105316756 13:19272545-19272567 AGGCATTAAATAATGGTGAAGGG + Intergenic
1106648399 13:31662329-31662351 AGGCACTACATAATAATAAAGGG - Intergenic
1107090621 13:36475461-36475483 GGTCACTATATAATGATAAAGGG - Intergenic
1107228426 13:38079047-38079069 GGTCACAATATAATAATAAAGGG + Intergenic
1107265754 13:38552036-38552058 GGTCACTATATAATGATAAATGG - Intergenic
1107297047 13:38920773-38920795 GGGCATTACATAATGATAAAGGG - Intergenic
1107309332 13:39060327-39060349 GGGCATTATATAATGATAAAAGG - Intergenic
1107673828 13:42774667-42774689 GGGCACTACATAATGGTAAAGGG - Intergenic
1108135802 13:47357446-47357468 GGCCATTATATAATAATAAAAGG - Intergenic
1108137858 13:47385224-47385246 GGGCCCTAAATAAACTTGAAAGG + Intergenic
1108293540 13:48988056-48988078 GGGCATTACATAATAGTAAAGGG + Intronic
1108889928 13:55244780-55244802 GGGCCCTAAATAAATGTGAACGG + Intergenic
1109057721 13:57573569-57573591 GGGCATTACATAATGATAAAAGG - Intergenic
1109513665 13:63412876-63412898 CAGAACTAAATATTAATGAATGG + Intergenic
1109618073 13:64863023-64863045 GGGCATTATATAATGATAAAAGG - Intergenic
1109625989 13:64975476-64975498 GGTTATTACATAATAATGAAGGG - Intergenic
1109974246 13:69809949-69809971 GGGCATTAGATAATGATAAAGGG + Intronic
1110199475 13:72831982-72832004 GGGCATTACATAATAGTAAAGGG - Intronic
1110376649 13:74802189-74802211 GGGCCCTAAATAAACTTGAAAGG + Intergenic
1110488473 13:76073764-76073786 GGTCATTAAATAATGATGAAGGG + Intergenic
1110501507 13:76233485-76233507 GGTCACTACATAATGATAAAAGG + Intergenic
1110916165 13:81023476-81023498 GGGCATTATATAATGATAAAGGG + Intergenic
1110916503 13:81027854-81027876 GGTCACTATAAAATGATGAAGGG - Intergenic
1110916831 13:81031132-81031154 GGGCTCTAAATAAACTTGAAAGG - Intergenic
1110999319 13:82158198-82158220 GGGCACACACTAATAATAAAAGG + Intergenic
1111114435 13:83756783-83756805 GGGCATTACATAATAGTAAAGGG + Intergenic
1111145058 13:84168534-84168556 AGGCATTACATAATAATAAAGGG - Intergenic
1111591739 13:90356056-90356078 GGGCATTACATAATGGTGAAGGG + Intergenic
1112051959 13:95651665-95651687 GGGTACCACATAATAATAAAGGG + Intergenic
1112165550 13:96915971-96915993 GGTCACTATATAATGATAAAGGG - Intergenic
1112618577 13:101031687-101031709 GGTCACTATATAATGATTAAAGG - Intergenic
1113225553 13:108155495-108155517 GGGCACTAAGTCATAACGATAGG - Intergenic
1113383551 13:109826782-109826804 GGCCACTACATAATAGTAAAGGG - Intergenic
1114326310 14:21592376-21592398 GGTCACTATATAATGATTAAGGG + Intergenic
1114511698 14:23267397-23267419 AGGCATTAAATAATGATAAAGGG - Intronic
1115048452 14:29027112-29027134 GGGCATTACATAATGGTGAAGGG - Intergenic
1115065081 14:29249936-29249958 GGGCATTAAATAATGATAAAGGG - Intergenic
1115265638 14:31496929-31496951 GGGCATTACATAATGATAAAAGG + Intronic
1115276012 14:31609331-31609353 GGTCACTATATAATGATAAAGGG + Intronic
1115279418 14:31644880-31644902 GGTCATTCAATAATAATAAAGGG - Intronic
1115381296 14:32743101-32743123 GGTCACTATATAATGATAAAGGG - Intronic
1115660910 14:35493800-35493822 GGGCTCTAAATAAATTTGAAAGG + Intergenic
1115915435 14:38307510-38307532 GGGCATTACATAATAATAAGTGG + Intergenic
1115974152 14:38978910-38978932 GGGCATTATATAATGATAAAGGG - Intergenic
1116058124 14:39888623-39888645 GGTCACTATATAATGATAAAGGG + Intergenic
1116149181 14:41116684-41116706 GGGCTCTAAATAAACCTGAAAGG + Intergenic
1116202423 14:41815273-41815295 GGGCATTACACAATAATAAAGGG - Intronic
1116212512 14:41966551-41966573 GGCCACTACATAATGATAAAGGG - Intergenic
1116301625 14:43190450-43190472 GGGTATTACATAATAATAAAGGG + Intergenic
1116332039 14:43609541-43609563 GGGCATTACATAATGATAAAGGG - Intergenic
1116480975 14:45391535-45391557 GGGCCCTAAATAAACTTGAAAGG + Intergenic
1116486061 14:45450535-45450557 GGTCACTATATAATGATAAAGGG - Intergenic
1116504579 14:45663213-45663235 GGGCATTAAATAATGGTAAAGGG - Intergenic
1116572245 14:46533142-46533164 GGGCATTAGATAATAGTAAAGGG - Intergenic
1116591606 14:46782930-46782952 GGGCATTACATAATGATAAAGGG + Intergenic
1117264348 14:54071314-54071336 GGTCACTATATAATGATAAAGGG - Intergenic
1117607928 14:57450283-57450305 GGGCATTACATAATGATAAAGGG - Intergenic
1117651581 14:57912998-57913020 GGGCATTACATAATGATAAATGG - Intronic
1117762705 14:59048252-59048274 GGACAGTATATAATAATAAAAGG - Intergenic
1117921449 14:60728947-60728969 CATCACTAAATAATAATGGATGG - Intergenic
1117930273 14:60834903-60834925 GGGCACTACATAATGGTAAAGGG - Intronic
1117940255 14:60956732-60956754 GGTCACTAGATAATGATAAAAGG - Intronic
1118091063 14:62479246-62479268 GGACATTACATAATAATGAAGGG - Intergenic
1118430601 14:65716350-65716372 GGTCACTATATAATGATAAAGGG - Intronic
1118662164 14:68026582-68026604 GGGCATTACATAATGATAAAGGG - Intronic
1118939828 14:70323235-70323257 GGGCATTACATAATAATAAAGGG - Intergenic
1120450730 14:84663959-84663981 GGACATTATATAATGATGAAAGG - Intergenic
1120553870 14:85905650-85905672 GGGCATTATATAATAGTAAAGGG - Intergenic
1120563651 14:86028254-86028276 GAGCTATAAATATTAATGAAGGG + Intergenic
1120638110 14:86976235-86976257 GGGCATTACATAATAATAAAGGG + Intergenic
1120697689 14:87662376-87662398 GGTCATTATATAATAATAAAGGG + Intergenic
1120770825 14:88378300-88378322 GGCCATTATATAATAATAAAGGG - Intergenic
1121476677 14:94214320-94214342 GGGAAATATATAATAAAGAAAGG + Intronic
1122185050 14:99985804-99985826 GGCCACTAATTAGTAATGAATGG - Intronic
1202842625 14_GL000009v2_random:136808-136830 GGGCACTACATAATGGTAAAGGG - Intergenic
1202912013 14_GL000194v1_random:127049-127071 GGGCACTACATAATGGTAAAGGG - Intergenic
1123455908 15:20425504-20425526 GGGCATTACATAATGATAAAGGG - Intergenic
1123506593 15:20947149-20947171 GGGCATTACATAATGGTGAAGGG - Intergenic
1123563819 15:21520894-21520916 GGGCATTACATAATGGTGAAGGG - Intergenic
1123575450 15:21662227-21662249 GGGCATTACATAATGATAAAGGG + Intergenic
1123600073 15:21958178-21958200 GGGCATTACATAATGGTGAAGGG - Intergenic
1123612070 15:22104698-22104720 GGGCATTACATAATGATAAAGGG + Intergenic
1123635662 15:22305333-22305355 GGGCATTACATAATGATAAAGGG + Intergenic
1123790680 15:23716340-23716362 GGCCACTACATAATGGTGAAGGG + Intergenic
1123878007 15:24643647-24643669 GGACATTACATAATAATAAAGGG + Intergenic
1124091139 15:26602166-26602188 GGTCACTATATAATAATAAAGGG + Intronic
1124224262 15:27877542-27877564 GGACATTTAATAATAATAAATGG - Intronic
1125213836 15:37246356-37246378 GAGCACTAAATGATAGTAAATGG + Intergenic
1125247298 15:37655105-37655127 GGGCATTATATAATCATAAAAGG + Intergenic
1125784550 15:42303759-42303781 GGGCATTACATAATAGTAAAGGG + Intronic
1126216485 15:46160609-46160631 GGTCACTATATAATGATAAAGGG + Intergenic
1126294754 15:47127111-47127133 GGTCACTATATAATGATAAAGGG - Intergenic
1126496762 15:49300173-49300195 GGGCATTACATAATGATAAAGGG - Intronic
1126521249 15:49596877-49596899 GGACATTATATAATGATGAAAGG + Intronic
1126534065 15:49741810-49741832 GGGCACTAAATACACTTGAAAGG + Intergenic
1126717010 15:51528531-51528553 GGTCACTATATAATGCTGAAGGG + Intronic
1126815999 15:52454271-52454293 GGTCACTATATAATGATAAAGGG + Intronic
1127022541 15:54764805-54764827 GGGCACTATATAACAATAAAGGG + Intergenic
1128035529 15:64521856-64521878 GGCCAGTAAAGAATAATGAAGGG - Intronic
1128102965 15:65020084-65020106 GGGCACTCAATCAAAATTAAGGG + Intronic
1128850678 15:70952869-70952891 GGGCATTACATAATGATAAAGGG - Intronic
1128852272 15:70971706-70971728 GGGCATTGCATAATAATAAAGGG - Intronic
1128856919 15:71025787-71025809 GGGCATTACATAATAGTAAATGG + Intronic
1129149359 15:73678006-73678028 TGACCCTAAAGAATAATGAAGGG + Intergenic
1129477558 15:75796331-75796353 GGGCCCTAAATAAACTTGAAAGG - Intergenic
1129501422 15:76041589-76041611 GGTCATTATATAATAATGAAGGG + Intronic
1129642681 15:77396680-77396702 GGTGATTAAATAATGATGAAGGG + Intronic
1130731938 15:86504149-86504171 GGACATTAAATAATGATAAAGGG - Intronic
1131602005 15:93859235-93859257 GTGCAGTACATAATAATAAATGG - Intergenic
1131627011 15:94131912-94131934 GGGCATTATATAATGATAAAGGG - Intergenic
1131660350 15:94507720-94507742 GGACATTACATAATAATAAAGGG + Intergenic
1132324522 15:100957527-100957549 GGTCACTATATAATGATAAAGGG - Intronic
1202972179 15_KI270727v1_random:247989-248011 GGGCATTACATAATGGTGAAGGG - Intergenic
1202984318 15_KI270727v1_random:396472-396494 GGGCATTACATAATGATAAAGGG + Intergenic
1134406769 16:13967155-13967177 GGTCACTATATAATGATAAAAGG - Intergenic
1134449627 16:14355184-14355206 GGGCACTAGTTAAAAATAAATGG - Intergenic
1135226598 16:20664412-20664434 GGGCATTATATAATGATAAATGG + Intronic
1135781883 16:25310650-25310672 GGTCATTATATAATGATGAAGGG - Intergenic
1135800150 16:25486866-25486888 GGACATTACATAATAATAAAGGG - Intergenic
1136646160 16:31618235-31618257 GAGCACTATATAATTATAAAAGG + Intergenic
1136729739 16:32399023-32399045 GGGCACTATGTAATGATAAAGGG - Intergenic
1137938835 16:52661303-52661325 GGACATTATATAATAATAAAGGG + Intergenic
1137969749 16:52973300-52973322 GGGCATTACATAATAGTAAAGGG - Intergenic
1138640035 16:58378265-58378287 GGCCACCAAATAATAAAGATAGG + Intronic
1138924472 16:61574431-61574453 GGGCATTACATAATGATAAAGGG - Intergenic
1138972809 16:62167288-62167310 GGGCATTATATAATGATAAAGGG - Intergenic
1139289158 16:65841434-65841456 TGCCACTAAATACTAATTAAGGG - Intergenic
1140018086 16:71207827-71207849 GGGCATTACATAATGATGAAAGG + Intronic
1140157832 16:72452319-72452341 GGTCACTATATAATGATAAAGGG - Intergenic
1141225115 16:82107683-82107705 GGTCACTAAATGATTTTGAAAGG + Intergenic
1143736835 17:8916843-8916865 GGTTTCTAAATAGTAATGAAAGG + Intronic
1143815545 17:9510038-9510060 GGACATTACATAATAATAAAGGG + Intronic
1144278015 17:13695269-13695291 AGGCATTACATAATAATAAAGGG - Intergenic
1144614333 17:16754960-16754982 GGGCATTATATAATAATAACAGG - Intronic
1144898374 17:18560717-18560739 GGGCATTATATAATAATAACAGG + Intergenic
1145134001 17:20385004-20385026 GGGCATTATATAATAATAACAGG - Intergenic
1146216705 17:30982221-30982243 GGGCTCTAAATAAACTTGAAAGG - Intronic
1146303676 17:31712152-31712174 AGTCACTATATAATAATTAAAGG + Intergenic
1147517189 17:41131171-41131193 GGTCATTATATAATAATAAAGGG + Intergenic
1148403394 17:47387540-47387562 GGTCACCAAGTAATAATAAAGGG - Intronic
1148967643 17:51449431-51449453 GGGCATTACATAATGATAAAGGG + Intergenic
1149127836 17:53256670-53256692 GGGCACTATATAATAGTAAAGGG + Intergenic
1149131117 17:53303366-53303388 GGGCATTATATAATGATAAAGGG + Intergenic
1149159870 17:53679360-53679382 GGGCATTAGATAATAATTACAGG - Intergenic
1149365698 17:55941375-55941397 GGGCATTACATAATGATAAATGG + Intergenic
1149377706 17:56062468-56062490 GGGCACTACATAATGGTAAAGGG - Intergenic
1149395564 17:56238517-56238539 GGGCATTACATAATAGTAAAGGG - Intronic
1149810080 17:59660243-59660265 TGCCATTAAAAAATAATGAAAGG - Intronic
1150093187 17:62348653-62348675 GGGCATTATATAATGATAAAAGG - Intergenic
1150185331 17:63174797-63174819 GGTCACTATATAAAAATGAATGG + Intronic
1150190233 17:63231001-63231023 GGGCATTACATAATAGTAAAGGG - Intronic
1150240084 17:63623773-63623795 TTGCCCTAAATAATAATAAAAGG + Intronic
1150546031 17:66157792-66157814 GGGCATTACATAATAGTAAAGGG + Intronic
1150614601 17:66759835-66759857 GGGCATTACATAATGATAAAGGG + Intronic
1150896078 17:69212695-69212717 GGACATTATATAATAATAAAAGG - Intronic
1150948107 17:69769563-69769585 GGGCATTACATAGTAATAAAAGG - Intergenic
1150970023 17:70017084-70017106 TAGCCCTAAATAATAATGAGTGG - Intergenic
1150970950 17:70027681-70027703 GGGCATTATATAATGATAAAGGG - Intergenic
1153183396 18:2460536-2460558 GGCCCCTAAATAAAATTGAAGGG - Intergenic
1153399651 18:4669050-4669072 GGGCATTACATAATGGTGAAAGG + Intergenic
1153474510 18:5483727-5483749 GGTCACTACATAATGATAAAGGG + Intronic
1153556383 18:6318535-6318557 GGTCATTATATAATAATAAAAGG + Intronic
1153714691 18:7835802-7835824 GGTCACTATATAATGATAAACGG - Intronic
1153717609 18:7866924-7866946 GGGCATTACATAATGATAAAGGG - Intronic
1154320388 18:13345927-13345949 TGGCAATAAAAAATGATGAAGGG - Intronic
1155470572 18:26187689-26187711 GGTCACTATATAATGATAAAGGG + Intronic
1155562636 18:27095694-27095716 GGGCACTACATAATGTTAAATGG + Intronic
1155614775 18:27709076-27709098 GGGCATTACATAATGATAAAGGG - Intergenic
1155676695 18:28438565-28438587 GGGCATTACGTAATAATAAAGGG - Intergenic
1155779586 18:29813847-29813869 GGGCATTACATAATAATGAAGGG + Intergenic
1156025752 18:32652738-32652760 GGTCACTATATAATGATAAATGG - Intergenic
1156078601 18:33309331-33309353 GGCCAATAAAAAATAATGACTGG + Intronic
1156151168 18:34245026-34245048 GGGCATTACATAATGATAAAGGG - Intergenic
1156885089 18:42126004-42126026 GGGCATTAAATAATAATTTTGGG - Intergenic
1157022616 18:43805109-43805131 GGGCTTTAAATAAAAATCAATGG - Intergenic
1157539507 18:48489888-48489910 GGGCACTCAATAATAAAAGAAGG + Intergenic
1157703036 18:49776966-49776988 GGACACTATATAATGATAAAAGG - Intergenic
1157904113 18:51552106-51552128 GGTCACTATATAATGATAAAGGG - Intergenic
1158097285 18:53788104-53788126 GGGCATTACATAGTAATAAAGGG + Intergenic
1158468414 18:57712545-57712567 GGGCTCTAAATAAAATTGAAAGG + Intronic
1158577806 18:58654575-58654597 GGCCATTATATAATAATCAAGGG - Intergenic
1158616193 18:58989731-58989753 GGACATTATATAACAATGAAAGG + Intergenic
1159087959 18:63816040-63816062 GGGCATTACATAATGATAAAGGG - Intergenic
1159143687 18:64426667-64426689 GGCCACTACATAATGATAAAGGG + Intergenic
1159241085 18:65744855-65744877 GAGCACTAAATAAAATTGAGTGG + Intergenic
1159562502 18:70009991-70010013 GGGCATTACATAATGATAAAGGG + Intronic
1159571111 18:70112571-70112593 GGGCACTACATAATGATAAAGGG + Intronic
1159581583 18:70239123-70239145 GGGCATTACATAATGATAAAAGG + Intergenic
1159660693 18:71092673-71092695 GGGCATTACATAATGGTGAAGGG - Intergenic
1159721437 18:71897032-71897054 GGGCATTACATAATGATGGAGGG - Intergenic
1159812208 18:73029740-73029762 GGGCATTGCATAATGATGAAGGG + Intergenic
1159905825 18:74091128-74091150 GGGCATTACATAATGATAAAGGG - Intronic
1159907162 18:74104690-74104712 GGTCACTAAATAATGATAAAGGG + Intronic
1160219596 18:76964796-76964818 GGGCATTATATAATGATAAAAGG - Intronic
1160440491 18:78886353-78886375 GGGCATTACATAATGATAAAGGG + Intergenic
1162251606 19:9448936-9448958 GAGCACTATATAATGATAAAGGG + Intergenic
1162266091 19:9575762-9575784 GGTCACTATATAATGATAAAGGG + Intronic
1162610976 19:11752275-11752297 GGTCACTATATAATGATAAAGGG - Intergenic
1162666463 19:12217315-12217337 GGTCACTATATAATAATAAAGGG - Intergenic
1163940284 19:20485723-20485745 GTGCAATAAAAAATGATGAAGGG + Intergenic
1165566441 19:36732972-36732994 GGTCACTATATAATGATTAAGGG + Intronic
1165970155 19:39622129-39622151 GGGCATTACATAATGATAAAGGG - Intergenic
1166017048 19:39989676-39989698 GGTCATTATATAATAATAAAAGG + Intronic
1166479455 19:43157690-43157712 GGACATTATATAATAATAAAAGG - Intronic
1167773158 19:51535033-51535055 GGTCATTATATAATGATGAAGGG - Intergenic
1167778778 19:51581659-51581681 GGGCACAAAATAATACTAGAAGG - Intronic
925079003 2:1046105-1046127 GATCATTACATAATAATGAAGGG - Intronic
925392791 2:3509089-3509111 GGACATTATATAATAATAAATGG + Intronic
926074865 2:9934290-9934312 GGGGCATAAAGAATAATGAAGGG - Exonic
926215737 2:10903926-10903948 GGGAACTGAATCTTAATGAAAGG + Intergenic
926479958 2:13379686-13379708 GGGCATTACATAATGATAAAGGG + Intergenic
926533776 2:14084492-14084514 GGGCATTACATAATGGTGAAGGG + Intergenic
926601191 2:14847543-14847565 GGTCACTATATAATGATAAAGGG + Intergenic
926610984 2:14946446-14946468 GGTCACTATATAATGATAAAAGG + Intergenic
927347918 2:22069427-22069449 GGGCCCTAAATAAATTTGAAAGG + Intergenic
927348158 2:22071641-22071663 GGTCACTATATAATGATAAAGGG + Intergenic
927472890 2:23388575-23388597 GTTGACTAAATAAAAATGAATGG - Intronic
927565353 2:24107183-24107205 GGGCATTATATAATAGTAAAGGG + Intronic
928354652 2:30599682-30599704 GGGCATTATATAATGATAAAGGG - Intronic
928576679 2:32662617-32662639 GTGCACTAAAAAATGATAAAGGG - Intronic
928847574 2:35696311-35696333 GGTCATGAAATAATGATGAAGGG - Intergenic
929280227 2:40070375-40070397 GGGCAGTACATAATGGTGAAGGG - Intergenic
929353122 2:40984758-40984780 GGGCATTATATAATGATAAAGGG - Intergenic
929422066 2:41801997-41802019 GGGCATTACATAATGATAAAAGG - Intergenic
930141818 2:47958734-47958756 GGTCACCATATAATAATAAAGGG + Intergenic
930526963 2:52542525-52542547 AGGCTCTAAATAAACATGAAAGG + Intergenic
930586200 2:53269717-53269739 GGGCACTGCATAATAATAAAGGG + Intergenic
930598865 2:53421472-53421494 GGGCATTACATAATGATAAAGGG - Intergenic
930684418 2:54292251-54292273 GGGCAATAAAAAATAATGTTTGG - Intronic
930727255 2:54694432-54694454 GGGCCCTAAATAAACTTGAAAGG + Intergenic
930933147 2:56914221-56914243 GGGCATTACATAATTATAAAGGG - Intergenic
930988372 2:57618135-57618157 GGACACTATATAATTATCAAAGG + Intergenic
931023091 2:58073538-58073560 GGATATTAAATAATAATAAAGGG - Intronic
931459733 2:62440222-62440244 GAGCTATAAATATTAATGAAGGG + Intergenic
931537328 2:63293168-63293190 GGGCAAGAAAGAAAAATGAAGGG - Intronic
931572178 2:63680591-63680613 GGGTCCTAAATAAACATGAAAGG + Intronic
931907355 2:66856998-66857020 GGGCATTACATAATCATAAATGG - Intergenic
932112602 2:69014167-69014189 GGGCACTGAGTGAGAATGAAAGG + Intronic
932303144 2:70682414-70682436 GGCCGCTTTATAATAATGAAAGG - Intronic
932889791 2:75582812-75582834 GGTCATTATATAATAATAAAGGG + Intergenic
932905169 2:75741038-75741060 GGACACTATATAATAATAAAGGG + Intergenic
933237469 2:79881549-79881571 GGGCATTACATAATGGTGAAGGG - Intronic
933433273 2:82212783-82212805 GGGCATTATATAATGATAAAAGG - Intergenic
933450895 2:82449804-82449826 GGTCGCTAAATAATGATAAAGGG + Intergenic
933574172 2:84048071-84048093 GGGCATTACATAATGATAAAGGG + Intergenic
933619702 2:84524179-84524201 GGGCATTACATAATGGTGAAGGG - Intronic
933638890 2:84738578-84738600 GGGCATTAAATAATGATAAGGGG - Intronic
934315957 2:91920157-91920179 GGGCACTAAGTAATGATAAAGGG + Intergenic
934511965 2:94952253-94952275 GTGCAGTAAATAATAATAAAGGG - Intergenic
934870533 2:97861167-97861189 GGGCCCTAAATAAATTTGAAAGG + Intronic
935440194 2:103084517-103084539 GGGGACTACATAATGATAAATGG + Intergenic
935799336 2:106677797-106677819 GGGCATTACATAATAGTAAAGGG - Intergenic
935886962 2:107631798-107631820 AGGCACTACATAATGATAAAAGG - Intergenic
936070091 2:109362802-109362824 GGGCATTACATAATGACGAAGGG - Intronic
936100107 2:109569962-109569984 GGGCACTACATAAAGATGAGAGG - Intronic
936777522 2:115992475-115992497 GGTCATTATATAATAATAAAGGG - Intergenic
936810887 2:116400365-116400387 GGGCATTACATAATGATAAAGGG + Intergenic
936824917 2:116570494-116570516 GGTCACTATATAATGATAAAGGG - Intergenic
936925262 2:117730500-117730522 GGGCTCTAAATAAACCTGAAAGG + Intergenic
937410775 2:121673155-121673177 GGACATTATATAATAATAAAAGG + Intergenic
937572650 2:123382934-123382956 GGACATTACATAATAATAAAAGG + Intergenic
937617857 2:123947222-123947244 GGTCACTATATAATGATAAAAGG + Intergenic
937716131 2:125035545-125035567 GGACATTATATAATGATGAAAGG - Intergenic
937931749 2:127210770-127210792 GGGCATTACATAATAGTAAAAGG + Intronic
938216910 2:129525909-129525931 GGGCTCTAAATAAATTTGAAAGG + Intergenic
938853898 2:135290328-135290350 GGACATTATATAATGATGAAAGG - Intronic
939344296 2:140943189-140943211 GGGCATTACATAATGATAAAGGG + Intronic
939461870 2:142506739-142506761 GGACATTATATAATAATAAAAGG + Intergenic
939705653 2:145449221-145449243 AGGGGCTCAATAATAATGAATGG + Intergenic
939943426 2:148380135-148380157 GGTCACTGCATAATAATGAAAGG + Intronic
939947218 2:148424288-148424310 GGGCATTACATAATGATAAAGGG + Intronic
940402644 2:153265279-153265301 GGGTCCTAAATAAACATGAAAGG - Intergenic
940425261 2:153524786-153524808 GGGCTCTAAATAAATCTGAAAGG + Intergenic
940425649 2:153528335-153528357 GGTCACTATATAATGATAAAGGG + Intergenic
940494416 2:154407149-154407171 AGGCACTAATTAATAATTACAGG - Intronic
940503491 2:154524503-154524525 GGTCACTATATAATAATAAAGGG - Intergenic
940503890 2:154528018-154528040 GGGCTCTAAATAAACTTGAAAGG - Intergenic
940581636 2:155587101-155587123 GGGCACTACGTAATTATAAAGGG + Intergenic
940708132 2:157129055-157129077 GGGCATTACATAATGATAAAGGG + Intergenic
940757669 2:157701807-157701829 GGTCATTATATAATAATTAATGG + Intergenic
941266033 2:163364099-163364121 TGGCACTACATAACAATAAAGGG - Intergenic
941398326 2:164999143-164999165 AGGCACAAAATGATACTGAATGG - Intergenic
941560898 2:167042613-167042635 GGGCATTATATAATAATGAAGGG + Intronic
942011712 2:171769672-171769694 GGGCATTATATAATGATAAAGGG + Intergenic
942294796 2:174507153-174507175 GGGTCCTAAATAAACATGAAAGG + Intergenic
942741696 2:179187836-179187858 GAGCATTACATAATAATAAAGGG + Intronic
942882994 2:180885180-180885202 GGTCACTAAATAATGATAAAGGG + Intergenic
942915248 2:181297296-181297318 GGTCACTATATAATGATAAAGGG + Intergenic
942972353 2:181971671-181971693 GGGCCCTAAATAAACCTGAAAGG - Intronic
943087074 2:183325066-183325088 GGGCATTAAATAATAGTAAAGGG + Intergenic
943181543 2:184549086-184549108 GGGCATTACATAATAACAAAAGG + Intergenic
943258200 2:185624870-185624892 GGGCACTAATTTATATTTAAAGG + Intergenic
943427650 2:187756532-187756554 GGTCACTATATAATAATAAAGGG - Intergenic
943552801 2:189361342-189361364 GGCCATTATATAATAATGAAGGG - Intergenic
943923722 2:193743669-193743691 GGGCATTACATAATAATAAAGGG + Intergenic
944167672 2:196740618-196740640 GGGCATTATATAATAGTAAAGGG - Intronic
944358229 2:198819544-198819566 AGACACTAAATAATAAAGATTGG + Intergenic
944481125 2:200158889-200158911 AGGCACTGAATAATAATGAGAGG + Intergenic
944625881 2:201568338-201568360 GGGAACTAAATTGTAATGTAGGG + Intronic
944918214 2:204383199-204383221 GGGCATTACATAATGATAAAGGG - Intergenic
944960958 2:204873437-204873459 GGGGACAAATGAATAATGAATGG - Intronic
944990249 2:205227413-205227435 GGTCACTATATAATGATAAAGGG - Intronic
945018254 2:205543081-205543103 GCTCAGTAAATATTAATGAACGG + Intronic
945042868 2:205756698-205756720 GGGAACTAAAGAATCATCAAGGG - Intronic
945243738 2:207699404-207699426 GGGCACTATTTTATAAAGAATGG - Intergenic
945430466 2:209757429-209757451 GGGCATTACATAATAATAAAGGG + Intergenic
945711809 2:213306555-213306577 GGGTACTAAATAAACTTGAAAGG - Intronic
945771183 2:214044931-214044953 GGGCCCTAAATAAACTTGAAAGG + Intronic
945820607 2:214660382-214660404 GGGCATTACATAATGATAAAGGG - Intergenic
946509171 2:220335549-220335571 GGGTCCTAAATAAAACTGAAAGG - Intergenic
946513785 2:220389021-220389043 GGTCACTATATAATGATAAAGGG - Intergenic
947008897 2:225543991-225544013 GGTCACTATACAATGATGAAAGG - Intronic
947276653 2:228399555-228399577 GGGCATTACATAATTATAAAGGG - Intergenic
947491293 2:230596708-230596730 GGGCATTACATAATGATAAAGGG + Intergenic
947492363 2:230606027-230606049 GGGCACTACATAATGGTAAAGGG + Intergenic
947673487 2:231957835-231957857 AGGCAGTAAAAGATAATGAAAGG - Intergenic
947700416 2:232229757-232229779 GAGCCCTTAGTAATAATGAAGGG + Intronic
1168917383 20:1501200-1501222 GGGCTCTAAATAAACTTGAAAGG - Intergenic
1168941450 20:1715070-1715092 GGTCACTATATAATTATAAAAGG + Intergenic
1169134457 20:3188865-3188887 GAGCACTAAATAATGCTCAAAGG + Intergenic
1169500458 20:6155606-6155628 GGGCATTACATAATAACAAAGGG - Intergenic
1169999053 20:11594986-11595008 GGACATTATATAATAATTAAAGG + Intergenic
1170006438 20:11674933-11674955 TGGCACACAATAAAAATGAATGG + Intergenic
1170416735 20:16151335-16151357 GGGCATTATATAATGATAAAGGG + Intergenic
1170496831 20:16933026-16933048 GGGCACTACATAATGGTAAAGGG + Intergenic
1170636972 20:18115493-18115515 GGGCATTACATAATGATAAATGG - Intergenic
1171081715 20:22193250-22193272 GGGCATTACATAATGGTGAAGGG + Intergenic
1171725399 20:28615120-28615142 GGCCATTATATAATAATAAAGGG - Intergenic
1171939312 20:31309489-31309511 GGTCATTATATAATAATAAAGGG - Intergenic
1173069472 20:39747995-39748017 GGTTACTATATAATAATAAAGGG - Intergenic
1173127179 20:40348717-40348739 GGTCACTATATAATGATAAAGGG + Intergenic
1173364101 20:42369546-42369568 AGCCACAAAATAAAAATGAAAGG + Intronic
1173776969 20:45716731-45716753 GGGCACTATATAATGGTAAACGG + Intergenic
1174928876 20:54791855-54791877 GGGCACTACATAATGATAAACGG - Intergenic
1176631371 21:9141717-9141739 GGGCACTACATAATGGTAAAAGG - Intergenic
1177213079 21:18094127-18094149 GGTCACTATATAATGATAAAAGG + Intronic
1177661387 21:24087883-24087905 GGACACTATATAATGATAAAAGG + Intergenic
1177721921 21:24918325-24918347 GGGCATTATATAATGATAAAGGG - Intergenic
1177764007 21:25435877-25435899 GGGCATTACATAATAGTAAAGGG + Intergenic
1178069660 21:28949859-28949881 GGTGAGTAAATAATAATGATGGG - Intronic
1178230331 21:30776314-30776336 GGACACCACAAAATAATGAAAGG - Intergenic
1179121668 21:38552076-38552098 GGGCATTATATAATGATAAAGGG - Intronic
1179929871 21:44560238-44560260 GGGCATTACATAATGATAAAGGG + Intronic
1180118735 21:45730757-45730779 GGACATTATATAATAATTAAGGG - Intronic
1180542726 22:16466032-16466054 GGGCACTACGTAATGATAAAGGG + Intergenic
1180599153 22:17003085-17003107 GGGCATTAAATAATGGTAAAGGG + Intronic
1181445219 22:22966966-22966988 GGTCACTATATAATGATAAAGGG - Intergenic
1184327780 22:43803577-43803599 GGTCACTATATAATGATAAAGGG + Intronic
1184809475 22:46820962-46820984 GGGCATTACATAATGATAAAGGG - Intronic
1184811553 22:46837155-46837177 GGGCATTGTATAATGATGAAGGG + Intronic
949131681 3:509857-509879 GGGCATTACATAATGATAAAGGG - Intergenic
949452875 3:4206363-4206385 GGGTACTAAATAAATTTGAAAGG - Intronic
949663206 3:6305720-6305742 GGGCATTATATAATGATAAAAGG + Intergenic
950245791 3:11417404-11417426 GGGCATTACATAATAATAAAGGG - Intronic
950622895 3:14220920-14220942 GGACACTATATAATGATAAAAGG - Intergenic
950701139 3:14748466-14748488 GGGAAGAAAATAATAATGATTGG - Intronic
951223299 3:20092656-20092678 GGGCATTATATAATGATAAAGGG - Intronic
951237876 3:20255838-20255860 GGGCATTAAATTATAATAAAGGG - Intergenic
951259670 3:20492757-20492779 GGTCACTATATAATGATAAAGGG - Intergenic
951262036 3:20521686-20521708 GGACATTATATAATAATAAAAGG - Intergenic
951268660 3:20599717-20599739 AGGCATTACATAATAATAAAGGG - Intergenic
951379729 3:21968693-21968715 GGGCCCTAAATAATCAGCAATGG + Intronic
951494668 3:23313194-23313216 GGTCACTATATAACAATAAAAGG - Intronic
952022231 3:29037484-29037506 GGGCACTATGTAATTATAAAAGG - Intergenic
952027120 3:29097031-29097053 AGTCACTATATAATAATGAAAGG - Intergenic
952230756 3:31427811-31427833 GGGCATTACGTAATAATAAAGGG - Intergenic
952563048 3:34618300-34618322 GGTCACTATATAATGATAAAAGG - Intergenic
953087569 3:39685653-39685675 GGTCACTATATAATGATAAAGGG + Intergenic
953382398 3:42482349-42482371 GGACATTATATAATAATAAAAGG + Intergenic
953397698 3:42586129-42586151 GGGGACTGAGAAATAATGAAAGG - Intronic
953893074 3:46769848-46769870 GGTCACTACATAATGATAAAGGG + Intronic
954474747 3:50733456-50733478 GGGCATTATATAATGATTAAGGG - Intronic
954491301 3:50908950-50908972 GGGCATTACATAATGATAAAAGG - Intronic
954491809 3:50913554-50913576 GGGTCCTAAATAATCTTGAAAGG - Intronic
954502087 3:51027674-51027696 GGGCATTACATAATGATAAAGGG - Intronic
954724287 3:52594310-52594332 GGGCACTACATAATGGTAAAGGG - Intronic
954769067 3:52949543-52949565 GGACATTACATAATAATAAAGGG - Intronic
955274466 3:57533964-57533986 GGGCCCTAAATAAACTTGAAAGG - Intronic
956215665 3:66846077-66846099 GGGCAATAAAAAATGATAAAGGG + Intergenic
956279661 3:67542727-67542749 GGGCATTACATAATGATAAAGGG + Intronic
956299502 3:67754711-67754733 GGGCATTAAATAATGAGAAAGGG + Intergenic
956476370 3:69624548-69624570 GGTCACTACATAATAATAAAGGG + Intergenic
956497101 3:69839710-69839732 GGGTACTGAACATTAATGAATGG - Intronic
957254819 3:77823573-77823595 GGGCATTACATAATGATAAAGGG - Intergenic
957267948 3:77991559-77991581 GGTCACTATATAATGATAAAGGG - Intergenic
957433132 3:80139564-80139586 GGACATTACATAATAATAAAGGG + Intergenic
957451050 3:80383155-80383177 GGGCATTACATAATGATAAAGGG - Intergenic
957485616 3:80858615-80858637 GGGCTCTAAATAAACTTGAAGGG + Intergenic
957629848 3:82705138-82705160 GGGCATTAGATAATGATAAAGGG - Intergenic
957866905 3:86037453-86037475 AAGCACTAAACTATAATGAAAGG + Intronic
957918928 3:86723282-86723304 GGGCATTACATAATAGTTAAAGG - Intergenic
958078571 3:88715146-88715168 GGTCATTATATAATAATAAAGGG + Intergenic
958098333 3:88975650-88975672 AGGTATTAAATAATAATAAAGGG + Intergenic
958141430 3:89567390-89567412 GGTCACTATATAATGATAAATGG + Intergenic
958434277 3:94078674-94078696 GGGCACTACATAATGGTAAAGGG - Intronic
958497270 3:94861308-94861330 GGGCATCACATAATAATAAAGGG - Intergenic
958694331 3:97508893-97508915 GGGCATTAAATAATGATAAAGGG - Intronic
958757929 3:98272245-98272267 GGGCACTAAATAAATTTGACAGG - Intergenic
958770867 3:98423917-98423939 GGACATTATATAATGATGAAAGG + Intergenic
958799489 3:98738622-98738644 GGGCAATACATAATGATAAAGGG + Intronic
959030854 3:101298135-101298157 GGGCATTACATAATAGTAAAGGG - Intronic
959118583 3:102206686-102206708 GGGCTCTAAATAAACTTGAAAGG - Intronic
959278442 3:104306701-104306723 GGGCATTACATAATAGTAAAGGG + Intergenic
959443842 3:106412814-106412836 GGGCACTAAATAAACTTGAAAGG - Intergenic
959643309 3:108666315-108666337 GGACATTACATAATGATGAAAGG + Intronic
959757221 3:109913226-109913248 GGACATTATATAATAATAAAAGG - Intergenic
959774882 3:110146533-110146555 GGTCACTATATAATGATAAATGG - Intergenic
959797891 3:110454508-110454530 GGTCACTATATAATGATAAAGGG - Intergenic
959867679 3:111290045-111290067 GGACATTATATAATAATAAAAGG - Intergenic
959878003 3:111408923-111408945 GGGCATTATATAATGATAAAAGG + Intronic
960015475 3:112883280-112883302 GGGCACTACATAATGATTAAGGG - Intergenic
960561433 3:119087832-119087854 GGGCATTACATAATGATAAAGGG + Intronic
960712133 3:120542019-120542041 GGGCATTATATAATGATAAAAGG - Intergenic
960757960 3:121038820-121038842 GGTCACTTCATAATAATAAATGG - Intronic
960759854 3:121061705-121061727 GGGCATTACATAATAGTAAAGGG - Intronic
960776770 3:121264887-121264909 GGGCATTACATAATAGTAAAGGG + Intronic
960784758 3:121360135-121360157 GATCACTATAAAATAATGAAGGG - Intronic
962001476 3:131303065-131303087 GGGCACTACATAATGGTAAAGGG - Intronic
962193487 3:133336100-133336122 GGGCCCTAAATAAACTTGAAAGG + Intronic
962334807 3:134518066-134518088 GGACACTTAAAAATTATGAATGG + Intronic
962362874 3:134756327-134756349 GGCCCCTAAATAGTTATGAAGGG + Intronic
962472962 3:135730102-135730124 GGGCATTACATAATGATAAAGGG - Intergenic
962489193 3:135875122-135875144 AGGCACTATATAATGATAAAAGG + Intergenic
962584531 3:136828467-136828489 GGTCATTATATAATAATAAAAGG - Intronic
962673487 3:137733824-137733846 GGACATTATATAATAATAAAAGG - Intergenic
962696714 3:137955735-137955757 GAGCACAACATAATAATAAAAGG + Intergenic
963050894 3:141142772-141142794 GGACATTATATCATAATGAAAGG - Intronic
963101769 3:141614096-141614118 AGCCACTAAAGAATAATGACTGG - Exonic
963282801 3:143402593-143402615 GAACACTTTATAATAATGAAAGG - Intronic
963309997 3:143699720-143699742 GGGCCCTAAATAAACTTGAAAGG + Intronic
963403799 3:144837335-144837357 GGTCACTCTATAATAATAAAGGG - Intergenic
963824611 3:149938513-149938535 AGGCATTACATAATAATAAAGGG - Intronic
963841359 3:150110606-150110628 GGGCACTGCATAATGATAAAAGG - Intergenic
963849144 3:150191707-150191729 GTGTACTATATAATGATGAAAGG - Intergenic
964035578 3:152192550-152192572 GCTTATTAAATAATAATGAAAGG - Intergenic
964258607 3:154808382-154808404 GGTCACTATATAATGATAAAGGG - Intergenic
964486350 3:157188806-157188828 GGGCATTACATAATAATAAAAGG + Intergenic
964934607 3:162066929-162066951 GGGCACTATGTAATAGTAAAGGG + Intergenic
964952609 3:162315259-162315281 GGTCACTATATAATGATAAAGGG - Intergenic
965000798 3:162950263-162950285 GGTTACTATATAATAATGAAAGG + Intergenic
965026403 3:163306786-163306808 GGTCACTATATAATGATAAAGGG + Intergenic
965147542 3:164925998-164926020 AGGCATTATATAATAATAAAGGG - Intergenic
965318328 3:167219045-167219067 GGTCATTATATAATGATGAAGGG + Intergenic
965414934 3:168381596-168381618 GGTCATTATATAATAATAAAGGG - Intergenic
965945892 3:174241120-174241142 GGGAAATAAATAAAAATGTAGGG - Intronic
965974365 3:174604299-174604321 GGTCACTATATAATGATAAAGGG - Intronic
966041944 3:175502090-175502112 GGGAACTAAAGAATAAACAAGGG + Intronic
966079745 3:175986639-175986661 GGCCATTACATAATAATAAAAGG - Intergenic
966251320 3:177868117-177868139 GGGCATTACATAATAGTAAAGGG + Intergenic
966312708 3:178612473-178612495 GGTCACTATATAATGATAAAGGG - Intronic
966374582 3:179282477-179282499 GGTCACTATATAATGATAAAGGG + Intergenic
966442180 3:179957870-179957892 GGGCAGTACACAATACTGAATGG - Intronic
966719590 3:183048521-183048543 GGGCATTAAACAATGATAAAAGG + Intronic
967360697 3:188627550-188627572 GGGCATTACATAATGATAAAGGG + Intronic
967622012 3:191644648-191644670 GGGTATTACATAATAATAAATGG + Intergenic
967709649 3:192690942-192690964 GGTCATTATATAATGATGAAGGG + Intronic
968266204 3:197365313-197365335 GAGCAATGAATAAGAATGAACGG + Intergenic
969473662 4:7407413-7407435 GGTCACTATATAATGATAAAGGG - Intronic
969726915 4:8924808-8924830 GGTCATTAAATAATAATAAAGGG + Intergenic
970288166 4:14541332-14541354 GGGCATTAAATAATGGTAAATGG + Intergenic
970357675 4:15272928-15272950 GGTCACTATATAATGATAAAGGG + Intergenic
970952502 4:21773652-21773674 GGGCATTAGATAACAATAAAGGG - Intronic
971096206 4:23407138-23407160 GGGCGTTAAACAATAATAAAGGG - Intergenic
971114081 4:23622804-23622826 GGGCATTACATAATAATAAAGGG + Intergenic
971746226 4:30584977-30584999 GGGCATTACATAATGTTGAATGG - Intergenic
972278147 4:37578281-37578303 GGTCATTACATAATGATGAAGGG - Intronic
972826993 4:42770016-42770038 GGGCATTATATAATGATAAAAGG + Intergenic
972904409 4:43727764-43727786 GGGCACTAAATAAACTTGAAAGG + Intergenic
972941392 4:44199055-44199077 GGGCATTATATAATAAAAAAAGG + Intronic
972986186 4:44768849-44768871 GGGCACCAAATTACAATGATAGG - Intergenic
973029116 4:45312751-45312773 TGGCATTAAATAATGATAAAGGG + Intergenic
973656336 4:53051919-53051941 GGCCATTAAAGAATAATGACTGG + Intronic
974617397 4:64307216-64307238 GGGCAAGAAACATTAATGAAGGG - Intronic
974732464 4:65885961-65885983 GGGGACTACCTAAGAATGAATGG + Intergenic
974741307 4:66011895-66011917 GGGCATTACATAATGGTGAAGGG - Intergenic
974867692 4:67600724-67600746 GGTCATTATATAATGATGAAAGG - Intronic
975035320 4:69672694-69672716 GGTCACTATATAATGATTAAAGG + Intergenic
975302422 4:72806394-72806416 GGGCATTATATAATAATAAAAGG + Intergenic
975504164 4:75119850-75119872 GGTCACTATATAATGATAAAGGG + Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
975708240 4:77132409-77132431 GGGCAGTAATTAAGAATCAATGG + Intergenic
976109781 4:81659508-81659530 GGTCACTATATAATGATAAAGGG - Intronic
976171236 4:82306969-82306991 GGTCACTATATAATAATAAACGG - Intergenic
976355919 4:84117610-84117632 GGGCATTAAATAATGGTAAAGGG - Intergenic
976375038 4:84336814-84336836 GGGCATTACATAATGATAAAGGG - Intergenic
976518415 4:85998307-85998329 AGGCACTAATTAATGATAAAAGG - Intronic
976728587 4:88240495-88240517 GGGCCCTAAATAAACTTGAAAGG - Intergenic
977390795 4:96407768-96407790 GGGCAGTATAAAATGATGAATGG + Intergenic
977425792 4:96865271-96865293 GGGCATTACATAATAGTGAAGGG + Intergenic
977658131 4:99547478-99547500 GGGCACTGTTTAATTATGAAAGG - Exonic
977822698 4:101493113-101493135 GGTCACTACATAATTATAAATGG - Intronic
977863746 4:101998651-101998673 GGGCACTATATAATGGTAAAGGG - Intronic
977948221 4:102938278-102938300 GGGCACTACGTAATGATAAAGGG + Intronic
977952192 4:102985056-102985078 GAGCATTACATAATAATAAAAGG - Intronic
978047028 4:104142763-104142785 GGTCACTACATAATGATAAAGGG - Intergenic
978116897 4:105030079-105030101 GGGCATTACATAATGATAAAGGG + Intergenic
978230186 4:106388044-106388066 GGCCCCTAAATAATTATGTATGG - Intergenic
978236662 4:106469281-106469303 GGGCATTACATAATAGTAAAGGG - Intergenic
978306698 4:107336340-107336362 GGTCATTATATAATAATAAAGGG - Intergenic
978313498 4:107411658-107411680 GGGCATTACATAATGATAAAGGG + Intergenic
978593464 4:110351680-110351702 GGGCACAAAATAAGACTGGAAGG - Intergenic
978601162 4:110429903-110429925 GGGCATTACATAATAGTAAAGGG - Intronic
978922189 4:114198118-114198140 GGTCACTATATAATAAAAAAGGG - Intergenic
978922505 4:114201246-114201268 GGGCTCTAAATAAACTTGAAAGG - Intergenic
978973193 4:114835848-114835870 GGGCATTAAATAACAGTAAAGGG - Intronic
979046382 4:115871197-115871219 GGTCACTAGATAATGATAAAGGG - Intergenic
979208695 4:118074478-118074500 GGGCATTACATAATGATAAAAGG - Intronic
979403998 4:120286588-120286610 GGGAAATAAAGAATAATGAAAGG - Intergenic
979476052 4:121158508-121158530 TGGCACTGAAAATTAATGAACGG - Intronic
979668034 4:123334417-123334439 GGGCACTACATAATGGTAAAGGG - Intergenic
979723070 4:123926048-123926070 GAGCACTACATAAAAATGACTGG - Intergenic
979907128 4:126308800-126308822 GGGCATTACATAATGATAAAGGG - Intergenic
980088172 4:128413940-128413962 CGGCATTACATAATAATAAAGGG - Intergenic
980276117 4:130652774-130652796 GGGCATTACATAATAGTAAAGGG + Intergenic
980339310 4:131522517-131522539 GGTTACTAAATAATGATAAAGGG - Intergenic
980387329 4:132103101-132103123 GGGCACTACATAATAATAAAGGG + Intergenic
980553285 4:134368696-134368718 GGGAATTTAATAATAAGGAAGGG - Intergenic
980578283 4:134713934-134713956 GCGCAATAAAAAATAATAAAGGG + Intergenic
980621556 4:135313359-135313381 GGGCATATAATAATAATAAAAGG - Intergenic
980626255 4:135378603-135378625 GGGCATTATATAATGGTGAAGGG - Intergenic
980744429 4:136997256-136997278 GGGCGTTACATAATAGTGAAGGG - Intergenic
980808909 4:137850365-137850387 GGACATTATATAATAATAAAGGG - Intergenic
980850209 4:138372560-138372582 GGTCACTACATAATGATAAAGGG + Intergenic
981076005 4:140593096-140593118 GGGCATTAAATAATGATAAAGGG - Intergenic
981199908 4:141968100-141968122 GGGCATTACATAATAGTAAAGGG + Intergenic
981530509 4:145749129-145749151 GGTCACTATATAATGATAAAGGG - Intronic
981555995 4:145995064-145995086 GGGCATTAAATAATAATAAAAGG - Intergenic
981627418 4:146774984-146775006 GGGCATTATATAATAGTAAAGGG - Intronic
981629961 4:146806642-146806664 GGGCACTACATAATGGTAAAGGG + Intronic
981668455 4:147257767-147257789 GCGCAATAAAAAATAATAAAGGG + Intergenic
981796075 4:148597011-148597033 GGCCATTAAATAATAGTAAAGGG - Intergenic
981874104 4:149520084-149520106 GCCCACTAAATAATAATGGTAGG + Intergenic
981978166 4:150757677-150757699 AGGCACTAAATATTTATAAAAGG + Intronic
982286176 4:153738026-153738048 GGGCATTACATAATGATAAAGGG - Intronic
982451266 4:155554703-155554725 GGACATTATATAATAATAAAAGG + Intergenic
982828038 4:160024697-160024719 GGTCATTAAATAATGATAAAGGG - Intergenic
982843497 4:160221646-160221668 GGGCATTACATAATAATACAGGG - Intergenic
982957176 4:161785445-161785467 AGCAACTAAATAATAATGAAAGG + Intronic
983051924 4:163058351-163058373 GGGCATTACATAATGATAAAGGG - Intergenic
983102890 4:163647166-163647188 GGTCACTATATAATGATAAAGGG + Intronic
983165717 4:164474961-164474983 GGTCACTATATAATGATAAAGGG - Intergenic
983392182 4:167146215-167146237 GGGCATTAAATAATGGTAAAGGG + Intronic
983424288 4:167562745-167562767 GGGCATTAAATAATGGTAAAGGG - Intergenic
983456475 4:167970901-167970923 GGTCACTATATAATAATAAAAGG + Intergenic
983477347 4:168230125-168230147 GGACACTATATAATGATAAAAGG + Intronic
983593920 4:169444521-169444543 GGTCATTACATAATGATGAAGGG + Intronic
983655803 4:170082833-170082855 GGTCACTATATAATGATAAAGGG + Intronic
983729655 4:170977405-170977427 GGACACTGTATAATAATAAAAGG - Intergenic
983957969 4:173718890-173718912 GGGCATTACATAATGATAAAGGG + Intergenic
984068599 4:175082346-175082368 GGGCTCTAAATAAATTTGAAAGG - Intergenic
984525904 4:180859568-180859590 GGGCACTACATAATAATAAAGGG - Intergenic
984645279 4:182212463-182212485 GGGCTCTGACTAATAATAAAAGG + Intronic
984978857 4:185258016-185258038 GAACACTAAAGAATAAGGAAGGG + Intronic
985233111 4:187843273-187843295 GGGCATTACATAATAGTAAAGGG + Intergenic
986378588 5:7160564-7160586 GGGCATTACATAATAGTAAAGGG - Intergenic
986548268 5:8923804-8923826 GGGCTCTAAATAAACTTGAAAGG + Intergenic
986549732 5:8938935-8938957 GGGCATTACATTATAATAAATGG + Intergenic
986588384 5:9343192-9343214 GGGTAATAAAAAATGATGAATGG - Intronic
986975140 5:13384981-13385003 GGGCACTATATAATGATAAAGGG + Intergenic
987530827 5:19116893-19116915 GGGCATTAAATAATGGTAAAGGG + Intergenic
987583209 5:19822369-19822391 GGGCATTACATAATCATAAAAGG + Intronic
987745078 5:21959952-21959974 GTGCATTACATAATGATGAAGGG + Intronic
987866533 5:23547245-23547267 GGGCATTACATAATGATAAAGGG - Intergenic
987868515 5:23578675-23578697 GGACACTACATAAAAATGAGTGG + Intergenic
987920562 5:24274773-24274795 GGTCACTATACAATAATAAAAGG - Intergenic
987961830 5:24820446-24820468 GGGCATTATATAATGATAAAGGG + Intergenic
987992270 5:25228319-25228341 GGTCACTATATAATGATAAATGG + Intergenic
988644733 5:33082104-33082126 GGGAACAAAATAATAATAAGAGG + Intergenic
989214972 5:38894601-38894623 AGGCACTACATAATGATAAAGGG + Intronic
989251558 5:39321766-39321788 AATCACTATATAATAATGAAGGG + Intronic
989305664 5:39952426-39952448 GGGCATTAAAAAATTGTGAAGGG + Intergenic
989355232 5:40537077-40537099 GGACATTATATAATGATGAAAGG - Intergenic
989461672 5:41706710-41706732 GGGCATTACATAATGATAAAGGG - Intergenic
990016632 5:51070904-51070926 GGTCATTATATAATAATAAAAGG - Intergenic
990035759 5:51317289-51317311 GGGCATTATATAATGATAAAGGG - Intergenic
990138833 5:52680411-52680433 GGGCATTATATAATGATAAACGG - Intergenic
991128377 5:63092713-63092735 GGGCATTACATAATGATAAAGGG + Intergenic
991158086 5:63461633-63461655 GGGCATTACATAATGATAAAGGG + Intergenic
991205488 5:64045079-64045101 GGTCACTATATAATAATAAGGGG + Intergenic
991238597 5:64428934-64428956 GGTCACTATATAATAATGAAGGG + Intergenic
991663871 5:68977208-68977230 GGTCACTACATAATGATAAAGGG + Intergenic
991765285 5:69970076-69970098 GGGCATTACATAATGATGAAGGG + Intergenic
991782038 5:70148078-70148100 GGGCATTACATAATGATGAAGGG - Intergenic
991844519 5:70845147-70845169 GGGCATTACATAATGATGAAGGG + Intergenic
991874481 5:71148393-71148415 GGGCATTACATAATGATGAAGGG - Intergenic
991923058 5:71676660-71676682 GGTCATTATATAATAATGAAAGG - Intergenic
992404067 5:76439574-76439596 GGTCACTATATAATAACAAAAGG - Intronic
992900454 5:81289715-81289737 GGGCATTATATAATGATAAAGGG + Intergenic
993268991 5:85768827-85768849 GGTCACTATATAATGATAAAGGG - Intergenic
993365811 5:87032947-87032969 GGACATTATATAATAATAAAAGG - Intergenic
993609251 5:90033927-90033949 GGGCATTACATAATGGTGAAGGG + Intergenic
993623581 5:90195819-90195841 GGCCACTATATAATGATAAAGGG + Intergenic
993757391 5:91748943-91748965 GGGCACTAAATAATGATAAAAGG - Intergenic
993779521 5:92049196-92049218 GGGCATTAAATAATGATAAAAGG - Intergenic
993911801 5:93692452-93692474 GGGCATTACATAATAGTAAAGGG + Intronic
993944674 5:94103422-94103444 GGGCATTAAATAATGATAAAGGG + Intronic
994227638 5:97272102-97272124 GGGCATTACATAATGATAAAGGG - Intergenic
994228657 5:97286331-97286353 GGGCATTACATAATCATAAAGGG - Intergenic
994233294 5:97334138-97334160 GGGCACTACATAATGGTAAAGGG - Intergenic
994345611 5:98682188-98682210 GGGCACTACATAATGGTAAAGGG + Intergenic
994436405 5:99739748-99739770 GGAAACTAATTGATAATGAATGG - Intergenic
994546308 5:101170838-101170860 GGGCATTACATAATAGTAAAGGG + Intergenic
994707828 5:103227035-103227057 GGGCATTACATAATGAAGAAGGG + Intergenic
994793383 5:104261082-104261104 AGGCATTAAATAATGATAAAGGG + Intergenic
994845509 5:104983996-104984018 GGTCACTATATAATAATAAATGG - Intergenic
994948332 5:106425303-106425325 GGGCATTATTTAATAATAAAGGG - Intergenic
995046917 5:107660891-107660913 GGTCACTAAATTTTAATAAACGG + Intronic
995198729 5:109402442-109402464 GGGCATTATATAATGATTAAGGG + Intronic
995388451 5:111613082-111613104 GGGCATTACATAATGATGGAGGG - Intergenic
995398451 5:111714931-111714953 GGGCATTACATAATGATAAAGGG - Intronic
995573251 5:113503428-113503450 GGGCCCTAAATAAATTTGAAAGG - Intergenic
995722721 5:115153293-115153315 GGACATTAAATAATGATAAAAGG + Intronic
995815970 5:116168241-116168263 GGGCATTACATAATGATAAAGGG + Intronic
995993828 5:118274983-118275005 GGGCATTACATAATGATAAAAGG + Intergenic
996133104 5:119806461-119806483 GGTCACTATATAATGATAAAGGG - Intergenic
996428029 5:123335944-123335966 TGGCACTAAATATTATTAAAAGG - Intergenic
996663405 5:126029696-126029718 GGGCATTAAATCATAGTAAAGGG + Intergenic
996778383 5:127157839-127157861 GGGCATTACATAATGGTGAAGGG - Intergenic
996780052 5:127175537-127175559 GGACATTATATAATGATGAAAGG - Intergenic
996837509 5:127810242-127810264 TGACACTAAATAACAATGAATGG - Intergenic
996968543 5:129334452-129334474 GGTCACTATATAATGATAAAGGG + Intergenic
997003308 5:129787827-129787849 GGTCATTATATAATAATAAAGGG + Intergenic
997065946 5:130558751-130558773 GGACATTAAATAATGATAAAGGG + Intergenic
997067763 5:130582013-130582035 GGGCATTAAATAATGGTAAAGGG + Intergenic
999732803 5:154487892-154487914 GGGCACTAAAAAATGATCACTGG + Intergenic
999999387 5:157123173-157123195 GGACATTATATAATAATAAATGG + Intronic
1000271637 5:159690023-159690045 GGTCACTATATAATGATAAAGGG + Intergenic
1000392204 5:160735402-160735424 GGTCACTATATAATGATAAAGGG + Intronic
1000511411 5:162188231-162188253 GGACATTATATAATAATAAAAGG - Intergenic
1000548312 5:162628133-162628155 GGGCACCACATAATGGTGAAGGG + Intergenic
1000584632 5:163081824-163081846 GGACATTATATAATAATAAAAGG + Intergenic
1000860185 5:166448262-166448284 GGGCATTACATAATGGTGAAGGG - Intergenic
1001050893 5:168413539-168413561 AGGCACTAAATAACAGTTAAAGG - Intronic
1001338464 5:170821647-170821669 GGTCACTATATAAAAATAAAAGG + Intergenic
1001344046 5:170874562-170874584 GGGCATTACATAATGATAAAGGG - Intronic
1001478584 5:172069442-172069464 GGGCATTATATAATTATAAAAGG + Intronic
1001637892 5:173225697-173225719 GGACAATAATGAATAATGAATGG + Intergenic
1001733551 5:173979542-173979564 GGGCATTATATAATAATAAAAGG - Intronic
1001738885 5:174033314-174033336 GGGCATTACATAATGATAAAGGG - Intergenic
1001792881 5:174475034-174475056 GGACACTATATAATAATAAAAGG + Intergenic
1001979176 5:176026575-176026597 GGCCATTATATAATGATGAAGGG - Intronic
1002011363 5:176284743-176284765 GGGCAATAAAAAATGATAAAGGG + Intronic
1002238240 5:177817188-177817210 GGCCATTATATAATGATGAAGGG + Intergenic
1002393287 5:178933351-178933373 GGGGACAAAATAACAATGCAGGG - Intergenic
1002686054 5:181010425-181010447 GGGCATTAAATAATGGTAAAGGG + Intergenic
1003297268 6:4842501-4842523 GGGCATTATATAATGATAAAAGG - Intronic
1003436656 6:6096061-6096083 GGGCAATAAAAAATAATAAAAGG - Intergenic
1003437369 6:6104107-6104129 GGGCATTACATAATGATAAAAGG - Intergenic
1003438506 6:6117948-6117970 GGGCATTAAATAATGGTAAAAGG - Intergenic
1003710765 6:8586915-8586937 GGGCATTACATAATGATAAAGGG + Intergenic
1003901274 6:10658163-10658185 GGGCACCTAAAAATTATGAAGGG - Intergenic
1004010295 6:11679216-11679238 GGGCCCTAAGTAATCATTAAAGG + Intergenic
1004096780 6:12562923-12562945 GGACATTATATAATGATGAAAGG + Intergenic
1004655052 6:17651709-17651731 GGACACTTAATAATATTAAAAGG + Intronic
1004750423 6:18556866-18556888 AGGCATTAAATAATAAAGGAAGG - Intergenic
1004760360 6:18658830-18658852 GGGCATTACATAATAGTAAAGGG + Intergenic
1004766079 6:18728621-18728643 GGGCATTACATAATGATAAAGGG + Intergenic
1004788402 6:18995727-18995749 GGGCATTACATAATGATAAAGGG - Intergenic
1004935205 6:20500759-20500781 GGGCATTACATAATGATAAAGGG + Intergenic
1005171562 6:22991521-22991543 GGGCATTACATAATAGTAAAAGG - Intergenic
1005420726 6:25646886-25646908 GGTCACTAAACAATAATAAAAGG + Intergenic
1005638292 6:27771744-27771766 TGGCATTATATAATAATAAAAGG + Intergenic
1005766816 6:29019588-29019610 GGTCACTATATAATGATGAAGGG - Intergenic
1005927876 6:30459517-30459539 GGTCACTATATAATGATAAAGGG + Intergenic
1007314613 6:40976972-40976994 GGGCATTATATAATGGTGAAGGG - Intergenic
1007954922 6:45909008-45909030 GGGCATTACATAATAGTAAAGGG - Intronic
1007978725 6:46128865-46128887 AGGCACAAACTAATAATCAACGG + Intergenic
1008171895 6:48218098-48218120 GGACATTACATAATAATAAAAGG + Intergenic
1008177357 6:48285413-48285435 GGTCACTATGTAATAATAAAGGG - Intergenic
1008187545 6:48412543-48412565 GAGCACTAAATGAGAATGCAAGG + Intergenic
1008215336 6:48781283-48781305 GGTCACTATATAATGATAAAGGG + Intergenic
1008230301 6:48978887-48978909 GGGGAGTATATAAAAATGAATGG + Intergenic
1008250079 6:49229065-49229087 GGTCACTATATAATGATAAAGGG - Intergenic
1008349800 6:50476858-50476880 GGGCATTACATAATGATAAAGGG + Intergenic
1008351953 6:50501845-50501867 GGTCACTATATAATGATAAAAGG + Intergenic
1008727301 6:54438243-54438265 GGTCACTACATAATAATAAAGGG - Intergenic
1008763408 6:54881475-54881497 AGGCAATAAATAAACATGAAAGG + Intronic
1008785349 6:55160739-55160761 GGGCATTACATAATGATAAAGGG + Intronic
1008816037 6:55567907-55567929 GGTTTCTAAACAATAATGAAGGG - Intronic
1009025678 6:57997521-57997543 AGCTACTAAGTAATAATGAAAGG + Intergenic
1009192548 6:60646839-60646861 GGACAGTAAATAATAATTCAAGG - Intergenic
1009679420 6:66872605-66872627 AGGCAATAAAAAATAATAAAGGG - Intergenic
1009771305 6:68145691-68145713 GGGCTCTAAATAAACTTGAAAGG - Intergenic
1009775348 6:68198363-68198385 GTGCATTAAATAATGATAAATGG + Intergenic
1009847109 6:69147876-69147898 GGTCATTATATAATAATAAAGGG - Intronic
1010079550 6:71844307-71844329 GGGCATTACATAATGATAAAGGG - Intergenic
1010140012 6:72602880-72602902 GGGCCCTAAATAAACTTGAAAGG - Intergenic
1010174266 6:73008519-73008541 GGGCATTATATATTAATAAAAGG + Intronic
1010181686 6:73094139-73094161 GGGCATTATATAATGATAAAAGG - Intronic
1010281191 6:74025460-74025482 GGGCATTATGTAATAATAAAAGG - Intergenic
1010328212 6:74589169-74589191 GGTCACTACATAATGATAAAGGG + Intergenic
1010412025 6:75571325-75571347 GGGCATTACATAATAGTAAAGGG + Intergenic
1010473365 6:76257154-76257176 GGGCATTACATAATGATAAAGGG - Intergenic
1010475849 6:76286466-76286488 GAGCCCTAAATAATTTTGAATGG - Intergenic
1010499351 6:76577216-76577238 GGCTTCTAAATAATATTGAAAGG + Intergenic
1010500705 6:76595911-76595933 GGACATTAAATAATAATGAAAGG + Intergenic
1010596431 6:77769396-77769418 GGGTTCTAAATAAACATGAAAGG + Intronic
1010638724 6:78294476-78294498 GGTCACTATATAATGATAAAGGG + Intergenic
1010707528 6:79132876-79132898 GGACATTATATAATAATAAAAGG - Intergenic
1010811195 6:80300414-80300436 GGGCATTACATAATGATAAAGGG + Intronic
1010887935 6:81266937-81266959 GGCCACTATATAATGATAAAGGG + Intergenic
1010945891 6:81972470-81972492 GGGCATTACATAATGATAAAGGG + Intergenic
1011174347 6:84543223-84543245 GGGCATTAAATAATTGTAAAGGG + Intergenic
1011209406 6:84938398-84938420 GGCCATTACATAATAATAAAGGG + Intergenic
1011319774 6:86078538-86078560 GGTCATTATATAATAATAAAAGG - Intergenic
1011321339 6:86096626-86096648 GGGCATTACATAATAGTAAAGGG + Intergenic
1011394825 6:86895260-86895282 GGACACTATATAATAATAAAAGG + Intergenic
1011815887 6:91189958-91189980 GGGCACTACATAATGGTAAAGGG - Intergenic
1011886806 6:92107072-92107094 GGGCATTATATAATGATAAAGGG - Intergenic
1012082824 6:94783196-94783218 GGGCATTAAATAATGGTAAAGGG - Intergenic
1012159053 6:95859938-95859960 TGGAAATAAATAATGATGAAGGG - Intergenic
1012339568 6:98103292-98103314 GGGCATTAAATAATGGTAAAGGG - Intergenic
1012363529 6:98411857-98411879 GGGCACTACATAATGGTAAAGGG - Intergenic
1012483696 6:99696609-99696631 GGGCTCTAAATAAATTTGAAAGG - Intergenic
1012486348 6:99725810-99725832 GGGCTCTAAATAAATTTGAAAGG - Intergenic
1012607042 6:101170434-101170456 GGTCACTATATAATAATAAACGG - Intergenic
1012668864 6:102015176-102015198 GGGCATTAAATAATAGTAAAGGG - Intronic
1012702357 6:102476166-102476188 GGGCATTACATAATGATAAAGGG + Intergenic
1012827745 6:104166480-104166502 GGTCACTATATAATGATAAAGGG + Intergenic
1012965849 6:105671825-105671847 GGACATTAAATAATGATAAAAGG + Intergenic
1013255055 6:108376968-108376990 GGGCATTACATAATGATAAAGGG - Intronic
1013708486 6:112869207-112869229 GGGCATTAAATAATGATAAAGGG + Intergenic
1014132348 6:117848602-117848624 GGGCATTATATAATGATAAAGGG + Intergenic
1014235232 6:118946710-118946732 GGGCATTATATAATGATAAAAGG + Intergenic
1014459121 6:121674302-121674324 GGGCTCTAATTAGTAATAAAGGG - Intergenic
1014525568 6:122497621-122497643 GGGCACTACATAATGATAAAGGG + Intronic
1014583302 6:123164605-123164627 GGTCACTACATAATAATAAAAGG + Intergenic
1014584838 6:123184866-123184888 GGGCATTACATAATGATAAAGGG + Intergenic
1014854588 6:126383678-126383700 GGGCATTACATAATGATGAAGGG + Intergenic
1014859981 6:126453977-126453999 GGGCACTACATAATGGTAAAGGG + Intergenic
1014890640 6:126839942-126839964 GAGCATTACATAATAATAAAGGG + Intergenic
1015030568 6:128589449-128589471 GATCACTATATAATGATGAAGGG + Intergenic
1015136774 6:129881271-129881293 GGGCATTACATAATGGTGAAAGG - Intergenic
1015377064 6:132523074-132523096 GGGTACTATATAATAATAAAGGG - Intergenic
1015472095 6:133617019-133617041 GGGCACTACATAATGGTAAAGGG + Intergenic
1016111713 6:140232490-140232512 GGGCATTACATAATGATAAAGGG + Intergenic
1016136625 6:140552051-140552073 GGTCACTATATAATGATAAAGGG - Intergenic
1016153898 6:140780349-140780371 GGGTTCTAAATAATCTTGAAAGG + Intergenic
1016195828 6:141338291-141338313 GGTCACTATATAATGATAAATGG + Intergenic
1016365312 6:143309905-143309927 GAGTACTACATAATAATGAAGGG + Intronic
1016418148 6:143855183-143855205 GGGCATTACATAATAGTAAAGGG - Intronic
1016570793 6:145509990-145510012 GGGCATTACATAACAATAAAGGG + Intronic
1016643251 6:146375629-146375651 GGTCACTATATAATGATAAAAGG - Intronic
1017601514 6:156087876-156087898 GGGCATTACATAATAGTAAAGGG + Intergenic
1018316948 6:162565988-162566010 GGTCACTATATAATGATAAAGGG + Intronic
1019141380 6:169946801-169946823 GGGAATTACATAATAATAAAGGG + Intergenic
1020635107 7:10686960-10686982 GGACATTATATAATAATAAAAGG + Intergenic
1021034714 7:15784344-15784366 GGGCTCTAAATAATCTTAAAAGG + Intergenic
1021130751 7:16910536-16910558 GGTCACTATATAATGATAAATGG - Intergenic
1021211815 7:17863220-17863242 GGGCACTAAATAAATATGAGTGG + Intronic
1021353973 7:19630893-19630915 GGTCACTATATAATTATGAAGGG + Intergenic
1021487753 7:21185664-21185686 GGTTGCTAAATAATACTGAAAGG - Intergenic
1021753766 7:23831340-23831362 GGTCATTATATAATAATAAAGGG - Intronic
1021824518 7:24535346-24535368 GGGCATTACATAATGATAAAAGG - Intergenic
1022034119 7:26517783-26517805 TGGCACTCAGTAAAAATGAATGG + Intergenic
1022348501 7:29542129-29542151 GGTCACTATATAATGATAAAGGG + Intergenic
1022646448 7:32233592-32233614 GGACATTACATAATAATAAAAGG + Intronic
1022754537 7:33271613-33271635 GGGCATTACATAATAGTAAAGGG + Intronic
1022878006 7:34554955-34554977 GGGCATTAAATAATGGTAAAAGG + Intergenic
1022970478 7:35512418-35512440 GGCCATTACATAATGATGAAGGG + Intergenic
1023037072 7:36141275-36141297 GTGCACTGAATAATGATAAAAGG + Intergenic
1023118665 7:36887329-36887351 TGGCACTAAATAGCAAAGAATGG + Intronic
1023211532 7:37810600-37810622 GGGCATTGCATAATAATAAAGGG + Intronic
1023877984 7:44300539-44300561 GAGCATTACATAATAATAAAAGG + Intronic
1023886132 7:44358072-44358094 GGGCATTACATAATGATAAAGGG - Intergenic
1023887527 7:44370573-44370595 GGTCACTATATAATGATTAAGGG + Intergenic
1024170204 7:46777519-46777541 GGGCACTAAGTAAACTTGAAAGG + Intergenic
1024353158 7:48388182-48388204 GGACGCTAAATAATAATTAATGG - Intronic
1024412271 7:49058796-49058818 GGCCACTATATAATGATAAATGG - Intergenic
1024498566 7:50074674-50074696 GGTCACTATATAATAATAAAGGG + Intronic
1024592088 7:50896530-50896552 GGGCATTACATAATGATAAAGGG + Intergenic
1024682035 7:51700787-51700809 GGGCATTACGTAATAATAAAGGG + Intergenic
1024859772 7:53824784-53824806 GGGCACTACATAATGGTAAAAGG + Intergenic
1025138971 7:56447215-56447237 GAACATTAAATAATAATAAAAGG + Intergenic
1025482834 7:61005661-61005683 GGTCACTAAACAATAATAAAAGG + Intergenic
1026478825 7:70761595-70761617 GGGCACTCAATAGAAAAGAATGG - Intronic
1027445822 7:78272677-78272699 GGGCATTACATAATGATAAAGGG - Intronic
1027447431 7:78290351-78290373 GGGCATTACATAATAGTAAAGGG + Intronic
1027576011 7:79932148-79932170 GGGCATTACATAATAGTAAAGGG - Intergenic
1027715252 7:81661365-81661387 GGGCATTACATAATGATAAATGG + Intergenic
1027733046 7:81900540-81900562 GGACATTATATAATGATGAAAGG - Intergenic
1028027880 7:85868835-85868857 GGGCACTACATAAGGATAAAAGG + Intergenic
1028077171 7:86531364-86531386 GGGCACTACATAATGGTAAATGG - Intergenic
1028197384 7:87922668-87922690 GGACATTATATAATGATGAAAGG + Intergenic
1028327257 7:89542368-89542390 GGGCATTACATAATGATAAAGGG + Intergenic
1028329890 7:89577141-89577163 GGGCATTACATAATGATAAATGG + Intergenic
1028337202 7:89672677-89672699 GGGCATTACATAATAGTAAAGGG - Intergenic
1028346045 7:89784338-89784360 GGGCACTACATAATGGTAAAGGG - Intergenic
1028782655 7:94755352-94755374 GGGCATTAAATAATGGTAAAGGG - Intergenic
1028915705 7:96256473-96256495 GGGCATTATATAATGATAAAGGG + Intronic
1029313686 7:99691631-99691653 GGCCACTACATAATGATAAAGGG - Intronic
1029804171 7:102978778-102978800 GGTGACTACATAATAATTAAAGG + Intronic
1029879000 7:103786606-103786628 GGGCATTACATAATAGTAAAGGG + Intronic
1029925075 7:104307053-104307075 TGGCACTAAATAGTAAAGAATGG + Intergenic
1030166200 7:106558180-106558202 GGCCACTACATAATGATAAAGGG - Intergenic
1030183403 7:106734540-106734562 GGTCACTATATAATGATAAAAGG - Intergenic
1030370220 7:108691500-108691522 GGTCACTATATAATGATAAAGGG - Intergenic
1030482504 7:110121755-110121777 GGGCATTACATAATAGTAAAGGG + Intergenic
1030531433 7:110715995-110716017 GGGCATTACATAATGATGAAGGG - Intronic
1030706189 7:112696457-112696479 GGTCACTATATAATGATAAAGGG - Intergenic
1030822828 7:114116403-114116425 AAGCACAAAATAATAATAAATGG + Intronic
1031530515 7:122870362-122870384 GGTCATTATATAATAATAAAGGG + Intronic
1031602704 7:123731219-123731241 GGACACTACATAATGATAAAAGG + Intronic
1031638864 7:124137612-124137634 GGTCACTATATAATGATAAAGGG - Intergenic
1031652237 7:124304790-124304812 GGGCACTACATAATGGTAAAGGG - Intergenic
1031655278 7:124347536-124347558 GGTCATTATATAATAATAAAAGG - Intergenic
1031796716 7:126184472-126184494 GGACATTATATAATAATAAAAGG - Intergenic
1031865034 7:127029570-127029592 GGGCATTAAATAATGGTAAAGGG - Intronic
1032437984 7:131917467-131917489 GGGCATTATATAATGATAAAAGG + Intergenic
1033499819 7:141936596-141936618 GGGCCCTAAATAAACTTGAAGGG + Intronic
1033691516 7:143741925-143741947 GGACACTATATAATAACGGAGGG + Intergenic
1033831432 7:145258485-145258507 GGGTACTACATAATGATAAAGGG + Intergenic
1034003531 7:147443118-147443140 CGGCCCTAAATAATCTTGAAAGG - Intronic
1034126809 7:148679400-148679422 GGTCACTATATAATGATAAAGGG + Intergenic
1034365735 7:150545062-150545084 GGGCATTACATAATGATAAAGGG + Intergenic
1034708310 7:153167907-153167929 GGCCATTATGTAATAATGAAGGG - Intergenic
1034714860 7:153232726-153232748 GGGCATTACATAATGATAAACGG - Intergenic
1035490141 7:159268825-159268847 GGGCACTGTATAATAATAAAGGG - Intergenic
1038075151 8:24064875-24064897 GGGCACTAAAGAAAAAGGAATGG - Intergenic
1038083062 8:24162268-24162290 GGGCATTACATAATAGTAAAGGG - Intergenic
1038172947 8:25154740-25154762 AGGCACTAACCAATACTGAAAGG + Intergenic
1039002082 8:32992826-32992848 GGTCACTATATAATCATAAAGGG - Intergenic
1039002418 8:32995974-32995996 GGGCTCTAAATAAACTTGAAAGG - Intergenic
1039312669 8:36335216-36335238 GGGCACTAAATACTGATAAAGGG + Intergenic
1039642559 8:39239833-39239855 GGGCATTATATAATGATAAAGGG + Intronic
1040544679 8:48389339-48389361 GGGCACTACATAATGGTAAAGGG - Intergenic
1040556919 8:48487958-48487980 GGCCATTACATAATAGTGAAGGG + Intergenic
1040613054 8:49005269-49005291 GGCCATTACATAATAGTGAAGGG - Intergenic
1040736782 8:50517710-50517732 GGGCATTATATAATGATAAAAGG + Intronic
1041093040 8:54321137-54321159 GGGCACTATATAATAATAAAGGG + Intergenic
1041365649 8:57100920-57100942 GGTCACTGTATAATAATAAAGGG + Intergenic
1041372320 8:57174831-57174853 GGGCATTACATAATGATAAAGGG + Intergenic
1041668564 8:60469414-60469436 GAGCACTGCATAATAATGGAAGG + Intergenic
1041826873 8:62105074-62105096 GGGCAGTACATAATGATAAAGGG + Intergenic
1042096773 8:65224783-65224805 GAGCACTAAATAATAAGGAAAGG + Intergenic
1043034768 8:75182352-75182374 GGGCATTACATAATGATAAAAGG + Intergenic
1043223612 8:77697441-77697463 GGGCATTACATAATGATAAAGGG - Intergenic
1043305512 8:78788951-78788973 GTGCATTACATAATAATAAAGGG - Intronic
1043311757 8:78869293-78869315 GGTCACTATATAATAATAAAAGG - Intergenic
1043537593 8:81223566-81223588 GGACATTATATAATAATAAAAGG - Intergenic
1043760680 8:84063695-84063717 GGGCCCTAAATAATCTTGAAAGG - Intergenic
1043848379 8:85187524-85187546 GGTCACTATATAATAATAAAAGG - Intronic
1043985637 8:86692460-86692482 GGACATTATATAATAATAAAAGG - Intronic
1044038405 8:87335441-87335463 GGGCATTACATAATGATAAAGGG - Intronic
1044315242 8:90743198-90743220 TGGCACTACATAATGATGAAGGG - Intronic
1044499828 8:92940533-92940555 GGTCATTATATAATAATAAATGG + Intronic
1044504400 8:93001543-93001565 GGTCACTATATAATGATAAAGGG + Intronic
1044546798 8:93468724-93468746 GGCCATTACATAATAATAAAGGG + Intergenic
1045151543 8:99414149-99414171 GGGCATTACATAATGATAAAGGG - Intronic
1045207700 8:100059546-100059568 GGTCACTATATAATGATAAAGGG + Intronic
1045877768 8:107002165-107002187 GGGCATTACATAATCATAAAGGG + Intergenic
1045945577 8:107791471-107791493 GGTCACTATATAATGATAAAGGG + Intergenic
1046070766 8:109250472-109250494 AGGCAGGAAATAATAGTGAAAGG - Intronic
1046073264 8:109284194-109284216 GGGCATTACATAATAATAAAGGG + Intronic
1046167203 8:110452148-110452170 GGGCTCTAAATAAACTTGAAAGG - Intergenic
1046254945 8:111683820-111683842 GGACATTATATAATGATGAAGGG + Intergenic
1046475277 8:114734072-114734094 GGGCATTAAATAATAGTAAAGGG + Intergenic
1046502085 8:115091462-115091484 GGGCATTACATAAAAATAAAGGG - Intergenic
1046870864 8:119204764-119204786 GGGCCCTACATAATCTTGAATGG + Intronic
1047119872 8:121890040-121890062 AGGGATTACATAATAATGAAGGG - Intergenic
1047841430 8:128757767-128757789 AGTCATTAAATAATAATAAAGGG + Intergenic
1047875418 8:129131741-129131763 GGACACCAAATAATAATTTAGGG - Intergenic
1047939297 8:129813442-129813464 GGGCATTACATAATGATAAAGGG - Intergenic
1048037431 8:130690750-130690772 GGCCATGAAATAATGATGAAGGG - Intergenic
1048041677 8:130735561-130735583 GGGCACTACATAGTGATAAAGGG + Intergenic
1048068176 8:130993214-130993236 GGTCACTATACAATAATAAAGGG + Intronic
1048120233 8:131572355-131572377 GGGCAATATATAATGATAAAAGG - Intergenic
1048723202 8:137351403-137351425 GGTCACTATATAATGATAAAGGG - Intergenic
1049872090 8:144988241-144988263 GGGCATTACATAATAGTAAAAGG - Intergenic
1049964849 9:769147-769169 GGGCACTACATAATGGTAAAGGG + Intergenic
1050441112 9:5665148-5665170 GGGCATTACATAACAATAAAGGG - Intronic
1050639134 9:7647236-7647258 GGGCATTAAATAATGATAAAGGG - Intergenic
1050639868 9:7655921-7655943 GGGCAGTAAATAATAAAGACAGG + Intergenic
1050684306 9:8149711-8149733 GGGCATTACATAATGATAAAGGG + Intergenic
1050807287 9:9696536-9696558 GGACACTACATAATGATAAAAGG - Intronic
1050983612 9:12053474-12053496 GGTCATTAGATAATTATGAATGG - Intergenic
1051832985 9:21301419-21301441 GGGCATTACATAATGATAAAGGG + Intergenic
1051863142 9:21649581-21649603 GGGCATTACATAATAGTAAAGGG - Intergenic
1051885905 9:21892524-21892546 GGGCATTATATAATGATAAAGGG + Intronic
1051923533 9:22296325-22296347 GGTCACTATATAATGATAAAGGG - Intergenic
1051932978 9:22408639-22408661 GGGCATTACATAATAATAAAGGG + Intergenic
1051981254 9:23021484-23021506 GGGCATTATATAATCATTAAGGG - Intergenic
1052299300 9:26935463-26935485 GGGCAATAAATAATCATGACTGG + Intronic
1052628568 9:31007167-31007189 GGGCATTACATAATGATAAAGGG + Intergenic
1052752991 9:32510994-32511016 GGGCATTATATAATAGTAAAGGG + Intronic
1052767175 9:32652806-32652828 GGGCATTATATAATGATAAAGGG + Intergenic
1052783579 9:32806384-32806406 GGGCATTACATAATGATAAAGGG + Intergenic
1053028393 9:34751458-34751480 GGTCATTATATAATAATGAAGGG + Intergenic
1053454523 9:38223142-38223164 GGTCACTATATAATGATAAAGGG - Intergenic
1053819002 9:41945994-41946016 GGGCATTACACAATAATAAAGGG + Intronic
1053873931 9:42523677-42523699 GGTCACTAAATAATGAGAAAGGG + Intergenic
1054109268 9:61089646-61089668 GGGCATTACACAATAATAAAGGG + Intergenic
1054268402 9:62943079-62943101 GGTCACTAAATAATGAGAAAGGG - Intergenic
1054611589 9:67241479-67241501 GGGCATTACACAATAATAAAGGG - Intergenic
1054831986 9:69635750-69635772 GGTCACTATATAATGATAAAGGG + Intronic
1055123394 9:72689673-72689695 GGGCATTAAATAGTAATAAAAGG - Intronic
1055125127 9:72710576-72710598 GGACACTAAATCATGATAAAAGG - Intronic
1055243514 9:74214365-74214387 GGTCACTATATAATGATAAAGGG - Intergenic
1055373130 9:75622076-75622098 GGGCATTACATAATAGTAAAGGG - Intergenic
1055783004 9:79840760-79840782 AGGCATTACATAATGATGAAGGG - Intergenic
1056003284 9:82240742-82240764 GGGCATTACATAATAGTAAATGG - Intergenic
1056671865 9:88636774-88636796 GGGCATTATATAATGATAAAAGG - Intergenic
1057015978 9:91652663-91652685 GGGCATTACATAATGATAAAAGG + Intronic
1057711984 9:97453804-97453826 GGGCATTACATAATAGTAAAGGG + Intronic
1058313653 9:103536438-103536460 GGGCATTACATAATGATAAATGG + Intergenic
1058658110 9:107243408-107243430 TTGCACTAAATAAAAGTGAATGG + Intergenic
1059381024 9:113925232-113925254 GGGCATTACATAATGATAAAGGG - Intronic
1059954833 9:119504584-119504606 GGGCATTATATAATAGTAAAGGG + Intronic
1060500492 9:124150017-124150039 TGGCAGTAAATAATTCTGAAAGG - Intergenic
1060678555 9:125539847-125539869 GGTCAGTAAAAAAAAATGAAAGG + Intronic
1060744419 9:126121408-126121430 GGTCAGTAAATAAAAATTAAGGG + Intergenic
1060774371 9:126360809-126360831 GGTCACTTAATAATGATGAAGGG - Intronic
1061915302 9:133748848-133748870 GGTCACTATATAATGATGAGGGG - Intergenic
1061959307 9:133979938-133979960 GGGCACAGAATAAGGATGAATGG - Intronic
1203754203 Un_GL000218v1:109331-109353 GGGCACTACATAATGGTAAAGGG - Intergenic
1203443894 Un_GL000219v1:36368-36390 GGGCATTACATAATGATAAAGGG + Intergenic
1203514702 Un_KI270741v1:155277-155299 GGGCATTACATAATGATAAAGGG + Intergenic
1203625967 Un_KI270750v1:22260-22282 TGACAAAAAATAATAATGAAAGG - Intergenic
1186181069 X:6973940-6973962 GGGCATTACATAATGATAAAGGG - Intergenic
1186202452 X:7168240-7168262 GGGAACTGAATTATAATGTAGGG + Intergenic
1186290747 X:8095518-8095540 TAGCACTAAATAATTATAAATGG - Intergenic
1186911383 X:14171209-14171231 GGTCACTATATAATGATAAAGGG - Intergenic
1187090003 X:16086200-16086222 GGGTAGTAAATAATTATTAAGGG - Intergenic
1187301951 X:18059304-18059326 GGGCATGAAATAATAAAGCAGGG + Intergenic
1187330796 X:18337525-18337547 GGGCATTACATAATGATAAAGGG + Intronic
1187641084 X:21290887-21290909 GGGCATTACATAATGATAAAGGG - Intergenic
1187695948 X:21920487-21920509 GGACATTATATAATAATAAAAGG - Intergenic
1187751992 X:22476951-22476973 GGGCATTATATAATGATAAAAGG - Intergenic
1187818385 X:23257967-23257989 GGGCACTACATAATAGTAAAGGG + Intergenic
1188059861 X:25588101-25588123 GGTCATTATATAATAATGAAGGG - Intergenic
1188077961 X:25802857-25802879 GGTCACTATATAATGATAAAAGG - Intergenic
1188091610 X:25971109-25971131 GGGCATTATGTAATAATCAAGGG + Intergenic
1188586972 X:31788802-31788824 GGTCATTAAATAATGATAAAAGG - Intronic
1188702216 X:33278825-33278847 GGTCACTACATAATGATAAAGGG + Intronic
1188706875 X:33345079-33345101 AGGAAGTAAATAATAATGATTGG - Intergenic
1188741461 X:33787737-33787759 GGGCATTACATAATGATAAAGGG - Intergenic
1188796963 X:34479254-34479276 GGGCATTAAATAATGGTAAAAGG - Intergenic
1188893035 X:35634139-35634161 GGGCATTACATAATGATAAAGGG - Intergenic
1189189036 X:39080823-39080845 GGGCATTACATAATGATAAAGGG - Intergenic
1189595086 X:42555947-42555969 GGGCATTACATAATGATAAAGGG - Intergenic
1189653341 X:43213465-43213487 GGGCATTACATAATGATAAAAGG + Intergenic
1189658094 X:43267839-43267861 GGGCTCTAAATAAACTTGAAAGG - Intergenic
1189714866 X:43854753-43854775 GAGCAGTAAATAATAATGAGGGG + Intronic
1189722047 X:43930115-43930137 GGGAACTAAATAATTACAAATGG - Intergenic
1189940421 X:46115623-46115645 GGGCATTACATAATAGTAAAGGG - Intergenic
1190015404 X:46822626-46822648 GGTCACTATATAATGATAAAGGG + Intergenic
1190371213 X:49742897-49742919 GGTCACTAAATAATAAAAACAGG + Intergenic
1190506130 X:51127627-51127649 GGGCATTACATAATGATAAAGGG + Intergenic
1190820853 X:53970750-53970772 GGGCATTACATAATGATAAAGGG + Intronic
1190902848 X:54695614-54695636 TGGGACTAAATATTAATCAAAGG - Intergenic
1190907994 X:54746992-54747014 GGGCCCCAAATAAACATGAAAGG - Intergenic
1190944783 X:55081421-55081443 GGTCACTATACAATAATAAAGGG - Intergenic
1190964570 X:55286737-55286759 GGTCACTATATAATAATAAAGGG - Intronic
1190978867 X:55436565-55436587 GGACATTAAATAATGATAAAGGG + Intergenic
1191115624 X:56849157-56849179 GGGCATTACATAATGATAAAGGG + Intergenic
1191139502 X:57101693-57101715 GGACATTATATAATAATAAAAGG + Intergenic
1191144646 X:57153099-57153121 GGACATTACATAATAATAAAAGG - Intergenic
1191149955 X:57209788-57209810 GGGCCCTAAATAACCTTGAAAGG - Intergenic
1191159824 X:57317421-57317443 GGGCATTACATAATCATAAAGGG + Intronic
1191198823 X:57755141-57755163 GGTCACTATATAATGATAAAGGG + Intergenic
1191222172 X:58001376-58001398 GGTCACTATATAATAATAAAGGG + Intergenic
1191650525 X:63532283-63532305 GGTCACTATATAATGATAAAGGG + Intergenic
1191695163 X:63982154-63982176 GGTCACTATATAATGATAAAAGG + Intergenic
1191819737 X:65291929-65291951 GAGCATTAAATAATGATGAAGGG + Intergenic
1191919671 X:66241514-66241536 GGGTACTATATAATGATAAAGGG + Intronic
1191949041 X:66568534-66568556 GGCCACTATGTAATGATGAAGGG - Intergenic
1191983516 X:66952953-66952975 ATGCAATAAAAAATAATGAAGGG + Intergenic
1192820568 X:74640717-74640739 TGGCGCAAAATAATACTGAATGG + Intergenic
1192836476 X:74804847-74804869 GGGCTCTAAATAAACTTGAAAGG - Intronic
1192872605 X:75199072-75199094 GGGCTCTAAATAAACTTGAAAGG + Intergenic
1192889082 X:75368931-75368953 GGGTATTATATAATAATGAATGG - Exonic
1192892461 X:75405573-75405595 GGTCACTATATAATGATAAAGGG + Intronic
1192991670 X:76465601-76465623 GGACACTATATAATGATAAAAGG - Intergenic
1193019719 X:76778801-76778823 GGGCAATACATAATGATAAAGGG - Intergenic
1193056396 X:77156036-77156058 GGGCATTAAATAATGGTAAAGGG + Intergenic
1193098240 X:77578196-77578218 GGGCCCTAAATAAAACTGAAAGG + Intronic
1193147200 X:78089643-78089665 GGACACTATATAATGATAAAGGG - Intronic
1193163315 X:78254293-78254315 GGTCACTATATAATGATAAAGGG - Intergenic
1193168980 X:78314810-78314832 GGGCTCTAAATAATCTTGAAAGG + Intronic
1193192617 X:78590121-78590143 GGTCACTATATAATGATAAAGGG - Intergenic
1193204607 X:78733695-78733717 GGTCACTATATAATAATAAAGGG - Intergenic
1193287767 X:79733124-79733146 TGTCACTACATAATAATAAAGGG + Intergenic
1193355744 X:80518927-80518949 GGGCATTATATAATAGTAAAGGG - Intergenic
1193364177 X:80610690-80610712 GGGCATTACATTATAATAAAAGG + Intergenic
1193366801 X:80644161-80644183 GGGTACTAAATAAACTTGAAAGG - Intergenic
1193471146 X:81906070-81906092 AGTCACTATATAATAATAAAAGG - Intergenic
1193526895 X:82602364-82602386 GGTCACTATATAATAATAAATGG - Intergenic
1193575435 X:83189900-83189922 GGGCATTACATAATAACAAAAGG - Intergenic
1193584991 X:83310790-83310812 GGGCTCTAAATAAACTTGAAAGG + Intergenic
1193610668 X:83628282-83628304 GGGCATTACATAATGATAAAGGG - Intergenic
1193622958 X:83779154-83779176 GGGCATTACATAATATTAAAGGG + Intergenic
1193642572 X:84029115-84029137 GGGTACTAAATAAACATGAAAGG + Intergenic
1193665666 X:84312765-84312787 GGTCACTATATAATGATAAAGGG + Intergenic
1193703628 X:84793118-84793140 GGGCACTACATAATGGTAAAGGG + Intergenic
1193747117 X:85295970-85295992 GGGCATTACATAATGATGATGGG - Intronic
1193788189 X:85786010-85786032 GGGCATTACATAATGATAAAGGG + Intergenic
1193793410 X:85844002-85844024 GGTCACTATATAATGATAAAGGG + Intergenic
1193821256 X:86168269-86168291 GGTCACTATATAATGATAAAGGG - Intronic
1193863512 X:86700492-86700514 GAGCATTACATAATAATAAAGGG - Intronic
1193894069 X:87089062-87089084 TGGCACTATATAATGATAAAGGG + Intergenic
1193908715 X:87276202-87276224 GGGCATTAAATAATAATAAAGGG - Intergenic
1193963518 X:87954363-87954385 GGGCATTATATAATGATAAAGGG + Intergenic
1193965325 X:87977760-87977782 GGGCATTGTATAATAATAAAAGG + Intergenic
1194016175 X:88624506-88624528 GGGCCCTAAATAAATTTGAAAGG + Intergenic
1194016841 X:88632598-88632620 GGCCACTATATAATGATAAAGGG + Intergenic
1194072757 X:89348241-89348263 GGGCATTACATAATGATAAAGGG - Intergenic
1194118750 X:89935545-89935567 GGGCATTACATAATAGTAAAGGG - Intergenic
1194132884 X:90104216-90104238 GGGCATTACATAATGATAAAGGG - Intergenic
1194176036 X:90649744-90649766 GGGCATTACATAATGGTGAAAGG + Intergenic
1194238126 X:91409941-91409963 GGGCATTACATAATGATAAAGGG + Intergenic
1194338475 X:92679577-92679599 GGTCACTATATAATGATAAAGGG - Intergenic
1194373731 X:93107579-93107601 GGGCATTACATAATAATAAATGG - Intergenic
1194477170 X:94372490-94372512 GGTCACTACATAATGATAAAGGG + Intergenic
1194515458 X:94846029-94846051 GGTCACTATATAATAATAAAGGG - Intergenic
1194546609 X:95242587-95242609 GGGCACTATATAATTATAAAGGG + Intergenic
1194574803 X:95599082-95599104 GGTCACTATATAATGATAAAGGG + Intergenic
1194791311 X:98154112-98154134 GGGCATTATATAATAAAAAAGGG - Intergenic
1194892323 X:99395539-99395561 GGTCACTATATAATGATAAAGGG - Intergenic
1194893757 X:99413832-99413854 GGGCATTACATAATGATAAAGGG - Intergenic
1194954566 X:100163749-100163771 GGTCACTATATAATGATAAAGGG - Intergenic
1195014753 X:100766946-100766968 GGTCTCTAAATAATCTTGAAAGG - Intergenic
1195172667 X:102284316-102284338 GGGCACTGCATAATGATAAAGGG - Intergenic
1195186199 X:102402779-102402801 GGGCACTGCATAATGATAAAGGG + Intronic
1195212877 X:102667586-102667608 GGGCATTACATAATATTAAACGG - Intergenic
1195224891 X:102783216-102783238 GGTCACTATATAATGATGAAAGG - Intergenic
1195306943 X:103593082-103593104 GGGCATTACATAATGATAAAGGG - Intergenic
1195443558 X:104924066-104924088 GGGCATTAAATAATGATAAAGGG + Intronic
1195482813 X:105367062-105367084 GGTCATTAAATAATAATAAAGGG - Intronic
1195529724 X:105940088-105940110 GTGAACTACATAATTATGAAAGG + Intronic
1195541206 X:106065473-106065495 GGGCATTACATAATAATAAAGGG - Intergenic
1195558544 X:106255957-106255979 GGTCACTATATAATAATAAAGGG - Intergenic
1195828632 X:109031060-109031082 CGTCACTATATAATAATAAAGGG - Intergenic
1195831122 X:109060114-109060136 GGTCATTATATAATAATAAAGGG - Intergenic
1195972550 X:110489574-110489596 GGGCATTATATAATGATAAAAGG - Intergenic
1196000128 X:110774102-110774124 GGGCATTACATATTAATAAAGGG - Intronic
1196013123 X:110909421-110909443 GGGCACTACATAATGGTAAAGGG - Intergenic
1196024354 X:111024558-111024580 GGACATTATATAATAATAAAAGG + Intronic
1196071893 X:111533920-111533942 GGTCACTATATAATGATAAAGGG - Intergenic
1196304899 X:114089846-114089868 GGTCACTATATAATGATAAAGGG + Intergenic
1196307825 X:114125551-114125573 GGGCACTACATAATGGTAAAGGG - Intergenic
1196380403 X:115083292-115083314 GCGCAATAAAAAATAATGAAGGG - Intergenic
1196418699 X:115500673-115500695 GGGCATTACATAATGATGAAGGG - Intergenic
1196494438 X:116307531-116307553 GGGCACTAAATAAACATGAAAGG - Intergenic
1196588664 X:117460247-117460269 GGGCACCAAATAAACTTGAAAGG + Intergenic
1196982441 X:121229955-121229977 GGGCATTACATAATGATAAAGGG - Intergenic
1197122592 X:122909262-122909284 GGGCATTACATAATGGTGAAGGG + Intergenic
1197184983 X:123575896-123575918 GGGCATTACATAATGATAAAGGG + Intergenic
1197319351 X:125008287-125008309 GGGCATTATATAATCATAAAGGG + Intergenic
1197379353 X:125720871-125720893 GGTCACTATATAATGATAAAGGG + Intergenic
1197390904 X:125862811-125862833 GGGCATTACATAATAATAAATGG + Intergenic
1197393434 X:125896708-125896730 GGGGATTACATAATAATAAAGGG - Intergenic
1197428304 X:126325334-126325356 GGGCATTACATAATGATAAAGGG + Intergenic
1197429357 X:126341927-126341949 GGGCCCTAAATAAAATTGAAAGG + Intergenic
1197434671 X:126411641-126411663 AGTCACTATATAATGATGAAGGG + Intergenic
1197482002 X:126997978-126998000 GGTCACTATATAATGAAGAAGGG + Intergenic
1197492219 X:127131321-127131343 GGTCACTATATAATGATAAATGG + Intergenic
1197558782 X:127991982-127992004 GGGCTCTAAATAAACTTGAAAGG + Intergenic
1197562776 X:128045351-128045373 GGGCATTACATAATGATAAAGGG - Intergenic
1197600599 X:128523079-128523101 GGTCACTATATAATAATAAAGGG + Intergenic
1197661290 X:129176242-129176264 GGTCACTATATAATAATAAAGGG - Intergenic
1197677896 X:129350107-129350129 AGTCACTATATAATAATGAAGGG + Intergenic
1197991535 X:132323757-132323779 GGGCATTACATAATGATAAAGGG + Intergenic
1198027420 X:132720836-132720858 GGTCACTATATAATGATAAAGGG + Intronic
1198042569 X:132868188-132868210 GGGCATTACATAATGATAAAGGG + Intronic
1198085883 X:133281360-133281382 GGGCACTACATAATGGTAAATGG + Intergenic
1198612225 X:138414398-138414420 GGTCATTATATAATAATAAAGGG + Intergenic
1198695127 X:139327781-139327803 GGTCACTATATAATGATAAAGGG + Intergenic
1198804366 X:140479114-140479136 GGACATTATATAAAAATGAAAGG + Intergenic
1198855892 X:141015775-141015797 AGTCACTATATAATAATGAAGGG - Intergenic
1198876237 X:141230363-141230385 AGTCACTATATAATAATGAAGGG + Intergenic
1198906801 X:141571592-141571614 AGTCACTATATAATAATGAAGGG + Intergenic
1198917094 X:141685275-141685297 AGTCACTATATAATAATGAAGGG + Intronic
1198974859 X:142325295-142325317 GGGCATTACATAATGGTGAAGGG - Intergenic
1198975940 X:142335641-142335663 GGGCACTAAATAATGATAAATGG + Intergenic
1199035755 X:143049405-143049427 GGTCACTATATAGTAATAAAAGG - Intergenic
1199154242 X:144527391-144527413 GGTAATTAAATAATGATGAAGGG + Intergenic
1199196312 X:145034878-145034900 GGTCACTATATAATAATAAAGGG - Intergenic
1199308470 X:146295023-146295045 GGTCACTAAATAATAATAACAGG - Intergenic
1199398911 X:147374282-147374304 GGGCATTACATAATGATAAAGGG - Intergenic
1199441269 X:147870311-147870333 GGTCACTATATAATGATAAAGGG + Intergenic
1199909017 X:152264903-152264925 GGTCACTATATAATGATAAAGGG + Intronic
1200175061 X:154108525-154108547 GGGCACTAAATACCAGGGAAAGG + Intergenic
1200364099 X:155643207-155643229 GGTCACTATATAATGATAAAGGG - Intronic
1200471622 Y:3593111-3593133 GGGCATTACATAATAGTAAAGGG - Intergenic
1200478672 Y:3674296-3674318 GGGCATTACATAATGATAAAGGG - Intergenic
1200522668 Y:4230688-4230710 GGGCATTACATAATGGTGAAAGG + Intergenic
1200646879 Y:5796359-5796381 GGTCACTATATAATGATAAAGGG - Intergenic
1200681760 Y:6221619-6221641 GGGCATTACATAATAATAAATGG - Intergenic
1200726996 Y:6683981-6684003 GGGCATTACATAATGATAAAGGG - Intergenic
1200728148 Y:6699756-6699778 GGGCATTACATAATGATAAAGGG - Intergenic
1201183614 Y:11374961-11374983 GGGCACTACTTAATGATAAAGGG + Intergenic
1201394887 Y:13537541-13537563 GGGCACTAAATAATAATAAAGGG + Intergenic
1201566588 Y:15371096-15371118 GGGCATTAAATAATGGTAAAGGG + Intergenic
1201688566 Y:16735824-16735846 GGGCATTACATAATAGTAAAGGG - Intergenic
1201760667 Y:17534218-17534240 GGTCATTATATAATAATAAAGGG - Intergenic
1201772847 Y:17634277-17634299 GAGCATTAAATAATAATAAAAGG - Intergenic
1201828708 Y:18271709-18271731 GAGCATTAAATAATAATAAAAGG + Intergenic
1201840886 Y:18371772-18371794 GGTCATTATATAATAATAAAGGG + Intergenic
1201922409 Y:19247676-19247698 AGGCATTACATAATGATGAAGGG + Intergenic
1202065699 Y:20937364-20937386 GGCCACTACATAATAATAAATGG + Intergenic