ID: 1101640050

View in Genome Browser
Species Human (GRCh38)
Location 12:106581320-106581342
Sequence GCTGAGGCCCAGAACGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 302}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101640047_1101640050 24 Left 1101640047 12:106581273-106581295 CCAAAGCTTGAGAGGGGGCAACT 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG 0: 1
1: 0
2: 7
3: 52
4: 302
1101640044_1101640050 27 Left 1101640044 12:106581270-106581292 CCCCCAAAGCTTGAGAGGGGGCA 0: 1
1: 0
2: 1
3: 19
4: 117
Right 1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG 0: 1
1: 0
2: 7
3: 52
4: 302
1101640046_1101640050 25 Left 1101640046 12:106581272-106581294 CCCAAAGCTTGAGAGGGGGCAAC 0: 1
1: 0
2: 1
3: 5
4: 136
Right 1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG 0: 1
1: 0
2: 7
3: 52
4: 302
1101640045_1101640050 26 Left 1101640045 12:106581271-106581293 CCCCAAAGCTTGAGAGGGGGCAA 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG 0: 1
1: 0
2: 7
3: 52
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101640050 Original CRISPR GCTGAGGCCCAGAACGATGA AGG Intronic
901435329 1:9244009-9244031 GCTGAGGCTCAGGTCAATGAAGG - Intronic
901460572 1:9388859-9388881 GCTGAGGCCCAGAGGGTTCAAGG + Intergenic
901863406 1:12088897-12088919 GCTGAAGCCCAGGATGAAGAGGG - Intronic
901988989 1:13097305-13097327 GCAGAGGCTCAGAACTTTGAAGG + Intergenic
901992824 1:13129462-13129484 GCAGAGGCTCAGAACTTTGAAGG - Intergenic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902687156 1:18085727-18085749 AATGAGGCCAAGAACAATGAGGG - Intergenic
902763824 1:18601682-18601704 ACTGAGGCCCAGAGGGGTGATGG - Intergenic
903016400 1:20364914-20364936 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
903465003 1:23545882-23545904 GCTGAGACCCAGAAATAAGAAGG - Intergenic
903577105 1:24345758-24345780 GCTGAGGCTCAGAGAGGTGAAGG - Intronic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
904373097 1:30063079-30063101 GCTCAGGCCCAGACTGATGATGG - Intergenic
904561755 1:31402918-31402940 ACTGAGGCCAAGACCGAAGAAGG - Intergenic
904619573 1:31767090-31767112 ACAGAGGCCCAGAAAGCTGAAGG - Intergenic
904659934 1:32076800-32076822 GCGGCGGCCCAGAACGATGGTGG - Exonic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
906193494 1:43914300-43914322 ACTAAGGCCCAGAATGGTGAGGG - Intronic
906283475 1:44569855-44569877 GCTGGGGCCCAGGACGATGCGGG - Intronic
906845175 1:49183990-49184012 ACTGAGGCCCAGAAAGGTGAAGG + Intronic
907220603 1:52904698-52904720 GCTGTGGCCCAGAACGAGGAGGG - Exonic
907411347 1:54285896-54285918 ACTGAGTCCCAGAACGAGAAAGG - Intronic
907966283 1:59333039-59333061 ACTGAGGCTCAGAAAGTTGATGG + Intronic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
911240660 1:95462360-95462382 GCTGAGACCCAGAAAGACCAAGG + Intergenic
911263799 1:95719370-95719392 ACTGAGACCCAGAAAGGTGATGG - Intergenic
913286609 1:117232485-117232507 ACTGAGGCACAGAAAGGTGAAGG - Intergenic
915836912 1:159184289-159184311 GCTGCGGCCCAGAATACTGAAGG - Intronic
917751234 1:178055373-178055395 GCTGTAGCCCAGAACTATGTGGG - Intergenic
920114078 1:203607589-203607611 GCTGAGACCCAGAGAGCTGAAGG - Intergenic
920341898 1:205280357-205280379 GCTGAGGCTCAGAAGGATGAAGG + Intergenic
921164751 1:212498773-212498795 GCTGAGGCCCAGCAAGAGGGAGG - Intergenic
922216726 1:223526107-223526129 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
923400294 1:233610295-233610317 GCAGTGGCCCAGGACGAGGAAGG + Intergenic
924686776 1:246300674-246300696 ACTGAGGCCTAGGAAGATGAAGG - Intronic
1062880543 10:974473-974495 ACCGAGGCCCGGAACAATGAAGG - Intergenic
1062939725 10:1412157-1412179 GCTGAGGCTCGGGACGATGCTGG + Intronic
1063505252 10:6591953-6591975 ACTGAGGCCCAGAGAGATCATGG - Intergenic
1063886101 10:10580562-10580584 ACTGAGGCCCAGAAAAATGAAGG - Intergenic
1063961021 10:11305409-11305431 GCAGAGGCCCAGAGTGTTGAAGG - Intronic
1066754445 10:38696554-38696576 GCTGAGACCCAGAGCAATGGGGG - Intergenic
1067191196 10:44069541-44069563 CCTGAGGCTCAGAAAGATTAAGG + Intergenic
1067299051 10:44992918-44992940 GCTGAGGCCCAGCACAAGGAAGG + Intronic
1067364461 10:45612257-45612279 GCTGAGGCCCAGTGCCATAAGGG + Intergenic
1069501614 10:68957850-68957872 GCAGAGCCCCAGAACAATGTTGG - Intronic
1069650374 10:70042814-70042836 GCTGAGGCCCAGACCCCAGATGG + Intergenic
1070615525 10:77966765-77966787 ACTGAGGCCCAGAGGGATGTGGG + Intergenic
1071703112 10:87964011-87964033 GCTAAGGCCCAGAAAGGTTAGGG - Intronic
1072189247 10:93066875-93066897 ACTGAGGCCCAGAGTGAAGAGGG - Intronic
1074859280 10:117498004-117498026 GCTGAGGCCCAGAGAGGGGAAGG + Intergenic
1075982021 10:126748283-126748305 ACTGAGGCCCGGAAGGAAGAAGG + Intergenic
1075991888 10:126845101-126845123 GCTGAGAGCCATAAGGATGATGG - Intergenic
1076756852 10:132577092-132577114 GCTGAGGCTCAGCAGAATGAAGG + Intronic
1076848946 10:133083620-133083642 CCTGAGGCTCAGGACGCTGATGG - Intronic
1077102567 11:828635-828657 GATGAGGCCCAGGAGGAGGAGGG + Exonic
1080571300 11:33559453-33559475 ACCGAGGCCCAGAATGATCAAGG - Intronic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1081751150 11:45512084-45512106 GCTGAGGCCCAGAAAAAGGAAGG + Intergenic
1082997277 11:59264032-59264054 ACTGAGGCCCACACAGATGAAGG - Intergenic
1083223998 11:61273327-61273349 GCCCAGGCACAGAATGATGAGGG + Intronic
1085705875 11:78786524-78786546 ACTGAGGCTCAGAAAGTTGACGG + Intronic
1086010569 11:82098294-82098316 TCTGAGGCTCAGAAATATGAAGG - Intergenic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1088383367 11:109221356-109221378 GCTGAGGCCCAGGGAGATGAGGG + Intergenic
1089402306 11:118171404-118171426 GCAGAGGCCCAGAGCTCTGAGGG + Intronic
1089497516 11:118915209-118915231 GCTGAGGCTCAGAGGGATAAAGG - Intronic
1090047949 11:123352390-123352412 GCTGAGGCTCAGAGAGGTGAAGG - Intergenic
1091177714 11:133576576-133576598 GCTGAGTCCTAGAACCAGGAAGG + Intergenic
1091770838 12:3150289-3150311 GCTGATGCCCAGAGAGATTAGGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092769549 12:11884274-11884296 ACGGAGGCCCAGAAAGATGGAGG - Intronic
1094104926 12:26801075-26801097 GCTGTGGCCTAAAACGAGGAGGG + Intronic
1094640668 12:32271979-32272001 ACTGAGGCCCAGAGAGATTAAGG - Intronic
1095380226 12:41582009-41582031 GGTGGGGCCCAGGACAATGAAGG - Intergenic
1096707182 12:53429645-53429667 GGTGAGGCCCAGGATGATGTTGG + Intronic
1098719193 12:73873798-73873820 GCTGAGGCTCAGAACTCTGTGGG - Intergenic
1098870898 12:75815833-75815855 ACTGAGGCCCAGAAAGGAGAAGG + Intergenic
1098877810 12:75884795-75884817 CCTGAGCACCAGAACGGTGAAGG - Intergenic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1101736021 12:107463940-107463962 ACAGAGGCCCAGAGAGATGAGGG - Intronic
1101960311 12:109244355-109244377 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1101963825 12:109268593-109268615 GCTGAGGCACAGAGAGGTGAAGG + Intergenic
1101969598 12:109303701-109303723 ACTGAGGCCCAGTGAGATGACGG - Intronic
1102449251 12:113028585-113028607 TCTGAGCCCCTGCACGATGATGG - Intergenic
1102795071 12:115682105-115682127 TCTGAGACCCAGAGGGATGAAGG - Intergenic
1103204815 12:119120385-119120407 ACTGAGGCCCAGGAAGATGAAGG - Intronic
1106494971 13:30267822-30267844 TCTGAGGCCCAAAACACTGAAGG - Intronic
1107307802 13:39040831-39040853 GCTGAGGCCCAGAAATCTTATGG - Intronic
1107452377 13:40521508-40521530 GCTGACGGCCAGAAAGAAGATGG + Intergenic
1108144693 13:47464076-47464098 GCTCAGGCCCAGAGAGATCACGG - Intergenic
1110513662 13:76383021-76383043 TCTGAGGCCCAAAGAGATGATGG - Intergenic
1111640870 13:90968274-90968296 GCTGTGGCCCAGGAAGAAGAGGG - Intergenic
1113214814 13:108027599-108027621 ACTGAGGCCCAGGACCATGGAGG + Intergenic
1115344400 14:32326998-32327020 TCTGAAGCCCAGAAAGATAATGG - Intergenic
1116102874 14:40464620-40464642 ACTGAGGGCCAGAACACTGAGGG - Intergenic
1117974107 14:61280992-61281014 GCCCAGGCCCAGGCCGATGAAGG + Exonic
1118374912 14:65168336-65168358 ACTGAGGCCCAGAAAGATCTTGG + Intergenic
1118474849 14:66106914-66106936 TCGGAGGCCAAGAACTATGAAGG + Intergenic
1118770476 14:68939412-68939434 TCTGTGGGCCAGAATGATGATGG + Intronic
1118849635 14:69573805-69573827 GCTGAGCGCCAGAACGGGGATGG + Intronic
1120638831 14:86984883-86984905 GCTGAGGACCAGACAGTTGATGG + Intergenic
1121844404 14:97160260-97160282 ACTGAGGCTCAGAAAGGTGAAGG - Intergenic
1121947170 14:98134415-98134437 ACTGAGGCCCAGAAGGCTAATGG + Intergenic
1122301151 14:100731862-100731884 GCTGAGGCTCAGGAAGCTGAAGG - Intronic
1122409162 14:101517311-101517333 GCTGAGACCCAGCAAGGTGAAGG - Intergenic
1122829616 14:104389413-104389435 GCTGATGCCCAGAGAGATGTGGG + Intergenic
1122893415 14:104743415-104743437 GCTGATGCCGTGAAGGATGAGGG + Intronic
1122994050 14:105253118-105253140 GGTGAGGCCCAGACCGAGAAGGG + Intronic
1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG + Intronic
1124578254 15:30928066-30928088 GCTGAGGCCAAGAACGGAGGTGG + Intronic
1127318277 15:57817790-57817812 TCAGAGGCCCAGAAGGAAGAGGG - Intergenic
1127736513 15:61845038-61845060 ACTGCAGCCCAGAATGATGAAGG - Intergenic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128232608 15:66046142-66046164 ACTGAGGCTCAGAAAGGTGAAGG + Intronic
1128619910 15:69140077-69140099 ACTGAGGCCCAGAGAGATCAAGG + Intergenic
1129254673 15:74327288-74327310 GCTGGGGCCCAGAGCGAGGAAGG - Intronic
1129254843 15:74328409-74328431 TCTGAGGCTCAGAAAGGTGAAGG + Intronic
1129518791 15:76172708-76172730 ACTGAGGCCAAGAAGGATGAGGG + Intronic
1129669265 15:77598116-77598138 CCTGAGGCTCAGAAAGGTGAAGG + Intergenic
1130306265 15:82713995-82714017 GTTGAGGCCCAGAGAGAGGAAGG - Intergenic
1131100274 15:89683212-89683234 GATGAGGCCAAGAACGGAGAAGG - Exonic
1131908389 15:97169207-97169229 GCTGAGGCCCAGAGAGGAGATGG + Intergenic
1134802468 16:17098285-17098307 TCTGAGGCCCAGAGAGATTAGGG + Intergenic
1135690003 16:24528754-24528776 GCTGGAGCCCAGAAGGCTGAAGG - Intergenic
1136230211 16:28881228-28881250 ACTGAGGCTCAGAGGGATGAAGG - Intronic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1136994867 16:35182549-35182571 ACTGAGGCCCAGGACTATGGGGG - Intergenic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137384668 16:48030326-48030348 GCTGAGGCCCAGAGAGGTGAAGG - Intergenic
1137995026 16:53201041-53201063 GCTGAGGCCCAGATAAATGATGG + Intronic
1138615756 16:58164722-58164744 GCTGAGGTCTAGAAGGCTGAAGG + Intronic
1138862997 16:60781861-60781883 TTTGAGGCTCAGAAAGATGACGG - Intergenic
1139459338 16:67109554-67109576 GCTGAGGCCCAGCAGGAGGGAGG - Intergenic
1139631502 16:68234503-68234525 CCTGAGGCCCAGAAGGCTCATGG + Intronic
1141422591 16:83926375-83926397 ACTGAGGCCCAGAGAGCTGAAGG + Exonic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1143002839 17:3805847-3805869 GCTGAGGCCCAGGGAGGTGAGGG + Intergenic
1143278255 17:5730781-5730803 GCTGAAGCCAGGAACCATGATGG + Intergenic
1143683392 17:8494232-8494254 GCTGAGGGCCTGAACTAAGACGG - Intronic
1143921782 17:10336082-10336104 ACTGAGGCCCAGAGAGGTGAAGG + Intronic
1143964991 17:10750711-10750733 ACTGAGGCACAAAACGCTGAAGG - Intergenic
1144942898 17:18953505-18953527 ACTGAGGCCCAGGAAGCTGAGGG - Intronic
1146815950 17:35942690-35942712 GCTCAGGCACAGAAGGATGGGGG + Intronic
1146986391 17:37223714-37223736 GCTGAGGCACAGAGAGATTATGG - Intronic
1148427906 17:47616148-47616170 ACTGAGACCCAGAGGGATGAAGG + Intronic
1148652322 17:49259199-49259221 ACTGAGGCCCAGAATGGGGAAGG + Intergenic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1149412024 17:56418671-56418693 ACTGAGACCCAGAAAGGTGAAGG + Intronic
1149594283 17:57855017-57855039 TCTGAGGACCAGGAGGATGAAGG + Intergenic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152299632 17:79487484-79487506 GCTGAGGACGAGGATGATGATGG - Intronic
1153521921 18:5961930-5961952 GCTGGGGCCCAGGACACTGAGGG + Intronic
1157126490 18:44961034-44961056 GCTGGTGTCCAGAATGATGAGGG + Intronic
1161272550 19:3397962-3397984 ACTGAGGCACAGAGAGATGAAGG - Intronic
1162151228 19:8646987-8647009 ACTGAGGCACAGAGCGATCAAGG - Intergenic
1162899380 19:13785490-13785512 GCTGAGACTCAGAAAGGTGAAGG - Intergenic
1163344594 19:16732426-16732448 CCTGAAGCCCAGTACGAAGAGGG - Intronic
1166114224 19:40642957-40642979 GCTGAGGCTCAGAGAGAGGAAGG + Intergenic
1166359402 19:42246604-42246626 CCTGAGGCCCAGAAAGGGGAAGG - Intronic
1166516883 19:43453868-43453890 ACTGAGGCACAGAAAGATGATGG + Intergenic
1167698742 19:51030025-51030047 GCTGGGGCCCTGACCAATGAGGG + Intronic
1168652093 19:58097943-58097965 GCTGAGATCCAGATCGGTGAGGG - Intronic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
925578438 2:5384819-5384841 CATGAGGCCCAGAACGCAGATGG + Intergenic
925584981 2:5456492-5456514 GCTGAGACCCTCAAGGATGAAGG - Intergenic
926278148 2:11421593-11421615 GCTGAGGCTCAGGAGGATGAGGG - Intergenic
927869658 2:26615503-26615525 GTTGAGGCCCAGGAAGAGGAAGG + Intronic
928125473 2:28612456-28612478 GCTGAGCCCCAGAGTGAGGAAGG - Intronic
930877999 2:56241482-56241504 TCAGAGGCCCAGAAAGATAATGG - Intronic
931345092 2:61439273-61439295 GCTGAGGCACAGCAGGAGGAGGG - Intronic
932846219 2:75138215-75138237 GCAGAGGCCCAGCAGGAAGACGG + Intronic
934028152 2:88017694-88017716 GCTGAGGCTCAGAGAGATTAAGG - Intergenic
934678027 2:96263728-96263750 GCTGTGGCTCAGAAAAATGAAGG - Intronic
937214594 2:120303611-120303633 GAAGAGGCACAGAGCGATGAGGG - Intergenic
937932970 2:127219931-127219953 GCTGCTGCCCAGAAGGCTGACGG - Intronic
939141747 2:138362286-138362308 GCTGAGGCCCAGATAGCTGAAGG + Intergenic
943754992 2:191548451-191548473 GCTGAGACCGAGAACTGTGATGG + Intergenic
944229738 2:197380688-197380710 GCAGAGGCCATGAATGATGAAGG - Intergenic
944856520 2:203773298-203773320 GCAGAGGCCATGAATGATGAAGG - Intergenic
945049087 2:205806483-205806505 CCTGATGCCCAGAAGGCTGAGGG - Intergenic
945979171 2:216295342-216295364 GCTTAAGCCCAGAAAGTTGAGGG - Intronic
946399426 2:219460811-219460833 GCTGAGGCCCTGCACGGAGAAGG - Intronic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
948742897 2:240059752-240059774 GCTGATGCCCATAACAATGTAGG - Intergenic
948867330 2:240782632-240782654 GCTGAGGCCCGGAGCGAAGCTGG + Intronic
1168886800 20:1266005-1266027 GCTGAGGCCCAGAGAGGTGAAGG + Intronic
1169695740 20:8385182-8385204 GCTCAGGCCCAGGAAGATCAGGG + Intronic
1170667791 20:18401819-18401841 GCCTAGGCCCAGAACTATCACGG + Intronic
1171292514 20:23990358-23990380 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1171426446 20:25051539-25051561 GCAGATGCCCAGAACGGGGACGG - Intronic
1171427279 20:25057126-25057148 TCTGAGGCCGAGAACGAGAACGG + Intronic
1172444545 20:34986198-34986220 GGTGAGGGGCAGTACGATGAAGG + Exonic
1173268646 20:41511037-41511059 ACTGAAGCCCAGAACGATCCAGG - Intronic
1173595541 20:44256828-44256850 ACTGAGGCCCAGAAAGTTTAAGG + Intronic
1173710032 20:45146944-45146966 GCTTATGCCCAGAACCATGTTGG + Intergenic
1173944729 20:46941415-46941437 ACTGAGCCCCAGAAAGATGAAGG - Intronic
1174858642 20:54069743-54069765 ACTGAGGCCCAGAGGGCTGAGGG + Intronic
1176517387 21:7796229-7796251 ACTGAGGCTCACAAAGATGAGGG - Intergenic
1178024051 21:28444830-28444852 AATGAGGCACAGAAAGATGAAGG + Intergenic
1178651415 21:34426241-34426263 ACTGAGGCTCACAAAGATGAGGG - Intergenic
1180193498 21:46180687-46180709 GCTGAGGCCCAGAGCATTAAGGG + Intronic
1180823582 22:18848122-18848144 GCTGAGGCCCAGAAATGTGAAGG - Exonic
1181124009 22:20691221-20691243 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1181189157 22:21126424-21126446 GCTGAGGCCCAGAAATGTGAAGG + Exonic
1181210042 22:21284071-21284093 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1181399477 22:22642873-22642895 GCTGAGGCCCAGAAATGTGAAGG + Intergenic
1181649939 22:24253195-24253217 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1181652998 22:24271161-24271183 CCCGAAGCCCAGAACGAGGACGG - Intronic
1181707438 22:24657551-24657573 GCTGAGGCCCAGAAATGTGAAGG + Intergenic
1182280069 22:29213464-29213486 GGTGTGGCACAGAAAGATGAAGG + Intronic
1183154330 22:36063461-36063483 GCTTAGGCCAAAAACAATGAAGG + Intergenic
1183591526 22:38781870-38781892 GTGGAGGCCCAGAGCGATGAGGG - Intronic
1184487935 22:44792402-44792424 GGTGAGGCCCAGGAGGAGGAAGG - Intronic
1184747650 22:46465393-46465415 ACTGAGGCCCAGGACTCTGAGGG - Intronic
1203216905 22_KI270731v1_random:11362-11384 GCTGAGGCCCAGAAATGTGAAGG + Intergenic
1203273724 22_KI270734v1_random:74028-74050 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
950459610 3:13113381-13113403 GCTGAGGCCCAGAGAGGTCAAGG - Intergenic
950864621 3:16179263-16179285 ACTGAGGCACAGAAAGATGGAGG + Intronic
952503761 3:33989115-33989137 GCTCAGGCCCAGGGAGATGAGGG + Intergenic
953125726 3:40090177-40090199 GATGAGGCCCAGAAAGATCAGGG - Intronic
955590326 3:60527918-60527940 GCTGAGGCACAGACCAATGGTGG - Intronic
956594467 3:70950548-70950570 GCTGAGGACCAAAGAGATGAAGG + Intergenic
957538021 3:81531445-81531467 GATGAGACCCAGAACCATGTTGG - Intronic
960261548 3:115574050-115574072 GCAGAGGCCCAGAATGACAAAGG + Intergenic
960789881 3:121417158-121417180 GCTGAGGCACAGAAGGAACAGGG + Intronic
962030270 3:131592298-131592320 ACTGAGGCACAGAAAGATGAAGG + Intronic
962606428 3:137036188-137036210 ACTGAGGCCCAGAGAGATGGGGG + Intergenic
962825488 3:139096623-139096645 ACTGGGGCCCAGAAAGAGGAAGG - Intronic
962852790 3:139320157-139320179 GCTGAGGCCCAGATTTCTGAGGG - Intronic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
968748276 4:2372387-2372409 GCTGAGGACTAGAAGGAGGATGG - Intronic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969180224 4:5435000-5435022 GCTGAGGCCCACAGAGATTAGGG - Intronic
969325904 4:6443720-6443742 GCTGAGGCTCTGAAAGATGCTGG + Intronic
978579090 4:110214705-110214727 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
979670662 4:123357244-123357266 GCTGAGGGCCACAAAGAGGAGGG - Intergenic
981689686 4:147493872-147493894 CCTGAGCCCCAGAACATTGAAGG - Intronic
984363666 4:178770792-178770814 GCTCAGGCCCATAAGGATGACGG + Intergenic
984851026 4:184152508-184152530 GGGGAGGCCTAGAACGTTGAAGG - Intronic
987708285 5:21482111-21482133 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
987708459 5:21482927-21482949 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
988751152 5:34191218-34191240 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
988751328 5:34192028-34192050 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
988751496 5:34192844-34192866 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
988807711 5:34755880-34755902 ACTGAGGCACAGAAAGATTATGG + Intronic
991736292 5:69633142-69633164 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991736459 5:69633949-69633971 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991736639 5:69634771-69634793 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991736811 5:69635587-69635609 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991758252 5:69899556-69899578 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991758426 5:69900372-69900394 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991758604 5:69901194-69901216 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991758774 5:69902001-69902023 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991812788 5:70488781-70488803 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991812960 5:70489588-70489610 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991813135 5:70490416-70490438 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991815914 5:70510065-70510087 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991816267 5:70511697-70511719 GCTGAGGCCAAGAAATGTGAGGG - Intergenic
991837655 5:70775438-70775460 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991837833 5:70776260-70776282 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
991838003 5:70777067-70777089 GCTGAGGCCAAGAAATGTGAGGG + Intergenic
993325510 5:86530549-86530571 ACTGAGGTCCAGATAGATGAAGG - Intergenic
994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994486518 5:100390370-100390392 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994486686 5:100391189-100391211 GCTGAGGCCCAGAAACATGAGGG - Intergenic
994486855 5:100392008-100392030 GCTGAGGCCCAGAAATATGAGGG - Intergenic
995328508 5:110919494-110919516 GCTGCGGCCAAAAACCATGATGG - Intergenic
995672662 5:114624644-114624666 GCTGAAGCCCAGAGCACTGAAGG + Intergenic
996282298 5:121745349-121745371 ACTGAGGCCCAGAATGTTGCTGG + Intergenic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
999259557 5:150229493-150229515 ACTGAGGCTCAGAGAGATGAAGG + Intronic
999276965 5:150337955-150337977 GGTGAGGCCAAGGACGGTGAAGG + Intronic
999281316 5:150368069-150368091 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
999519365 5:152334799-152334821 GCTGAGGCCCAGAGAAAAGAAGG - Intergenic
1000403005 5:160852240-160852262 GCCGAGTCCCAGAACAGTGAAGG + Intergenic
1001636210 5:173212104-173212126 ACTGAGGCTCAGAAAGGTGATGG - Intergenic
1001672318 5:173484256-173484278 ACTGAGGCACAGAGAGATGAAGG + Intergenic
1003623248 6:7720839-7720861 GGTGAGACCCAGAACGAAGAAGG - Intergenic
1005153003 6:22774256-22774278 CCTGATGCCCAGAACCATGGTGG + Intergenic
1005549302 6:26897856-26897878 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1005549479 6:26898673-26898695 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1005549655 6:26899493-26899515 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1005915260 6:30345532-30345554 GGTGAGGCCCGGGACGAGGAGGG - Exonic
1005922907 6:30416992-30417014 GCTGAGGGCCTGGATGATGATGG + Intergenic
1006361027 6:33587158-33587180 ACTGAGGCTCAGAAAGAGGAAGG - Intergenic
1006790876 6:36700401-36700423 ACTGAGCCTCAGAACTATGAGGG - Intronic
1007299684 6:40857463-40857485 CCTGAGGCCCAGGGAGATGAAGG + Intergenic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1008496946 6:52143730-52143752 CCTGAGCCTCAGAAGGATGAGGG - Intergenic
1009020042 6:57938966-57938988 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1011701603 6:89960287-89960309 GCCAAGGCCCAGAAAGGTGAAGG + Intronic
1012980068 6:105819916-105819938 GCTGAAGCTCAGAATGAGGATGG + Intergenic
1012996380 6:105979827-105979849 CCTGAGGCCCAGGACAGTGAAGG + Intergenic
1014153846 6:118089221-118089243 GATGAGGGCCAGAATGGTGAGGG + Intronic
1016410275 6:143775497-143775519 TCTGAGGCCCAGAGAGATTAAGG + Intronic
1018641401 6:165907579-165907601 GCTGAGGAGCAGGATGATGAGGG - Intronic
1019164605 6:170089738-170089760 GCTCAGGCCCAGACCGCAGAAGG - Intergenic
1022478925 7:30730302-30730324 GCTGAGGCTCAGAAAGGTTAAGG - Intronic
1024696400 7:51860580-51860602 GCTGAGGCCCAGATGTCTGAAGG - Intergenic
1025603532 7:63022727-63022749 ACTGAGGCCCAGAAAGGTGAAGG - Intergenic
1025712760 7:63927374-63927396 GCTAAGGCCCAGCAGCATGAAGG - Intergenic
1026868760 7:73838296-73838318 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1026995080 7:74610471-74610493 TCTGAGGTTCAGAAAGATGAAGG + Intergenic
1029280224 7:99430557-99430579 ACTGAGGCACAGAGAGATGAAGG - Intronic
1030398544 7:109019118-109019140 TCTCAGGGCCAGAATGATGAAGG - Intergenic
1034341952 7:150363092-150363114 GGGGAGGCCCCGAAAGATGAAGG - Intergenic
1036149739 8:6286335-6286357 GATGAGGCCCACACTGATGAGGG + Intergenic
1036781680 8:11651980-11652002 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
1037596632 8:20359734-20359756 CCTGAGGCACAGAAAGCTGAGGG + Intergenic
1038355770 8:26827974-26827996 GCTGGAGCCCAGAAAGTTGAGGG - Intronic
1039439492 8:37584813-37584835 ACCGAGGCACAGAAAGATGAAGG - Intergenic
1041198455 8:55425481-55425503 CCTGAGGCTCAGAAGGATCAAGG - Intronic
1044816110 8:96115119-96115141 GCTGAGTCCTAGAAGGAAGATGG - Intergenic
1045051102 8:98326798-98326820 GCTGAAGCCCAGAATCATGAAGG + Intergenic
1045295066 8:100865377-100865399 CCTGAGGCTCAGAACCCTGAAGG - Intergenic
1045502535 8:102754290-102754312 GCAGAGGCCCAGAGCGGAGATGG + Intergenic
1045584892 8:103523058-103523080 GCTGTGGCCAGGAATGATGATGG + Intronic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1047416187 8:124666652-124666674 TCTGAGGTCCAAAAAGATGAAGG + Intronic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1048442567 8:134470573-134470595 GTTGAGGCCCAGAGCAAAGAGGG + Intergenic
1048878496 8:138855059-138855081 GCTGAGACTCAGAAGGATGCTGG - Intronic
1049016360 8:139922831-139922853 GCTCAGGCCCAGAGAGCTGAAGG + Intronic
1050022528 9:1299483-1299505 GCTGAGGGCAAGGACAATGAGGG - Intergenic
1050965308 9:11794275-11794297 GCTCAGGCACAGAACAAAGAGGG - Intergenic
1053600365 9:39603617-39603639 GCTGAGGCTCAGAGAGATTAAGG + Intergenic
1053858016 9:42357473-42357495 GCTGAGGCTCAGAGAGATTAAGG + Intergenic
1054253163 9:62738767-62738789 GCTGAGGCTCAGAGAGATTAAGG - Intergenic
1054567279 9:66773266-66773288 GCTGAGGCTCAGAGAGATTAAGG - Intergenic
1054813755 9:69455373-69455395 GCTGAGGCCCAGGATGGTGCGGG + Intronic
1057295003 9:93829746-93829768 GCTAAGGCCCAGAAGCATGGAGG + Intergenic
1057919885 9:99088271-99088293 GCTAGGGCCCAGCATGATGATGG + Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058460780 9:105180487-105180509 GCTGAGGCACAAAAGGATGCTGG + Intergenic
1058734247 9:107879437-107879459 ACTGAGGCCCAGAGGGTTGAGGG + Intergenic
1059130656 9:111745323-111745345 CCTGAGGCACAGAACAATTAAGG + Intronic
1060047413 9:120351686-120351708 GCTGAGGCCCAGAGAGTTTAAGG + Intergenic
1060212507 9:121719213-121719235 GCTGAGGCCAGGAATGAGGAGGG + Intronic
1060416020 9:123431363-123431385 ACTGAGGCCCAGAAACATTAAGG + Intronic
1060887570 9:127166561-127166583 GCAGAGTCACAGAACAATGAAGG - Intronic
1060943857 9:127558436-127558458 ACTGAGGCCCAGGAAGATGATGG - Intronic
1060965285 9:127709018-127709040 ACTGAGGCTCAGAAGGATAAAGG - Intronic
1060969708 9:127731090-127731112 GCAGAGGCCCAGAAAGGTCAAGG + Exonic
1060982552 9:127802306-127802328 GCTGAGGCCCAGAACTGGGGAGG - Intronic
1061181432 9:129027340-129027362 ACTGAGGCCCAGTGAGATGAAGG + Intronic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061759657 9:132841660-132841682 ACTGAGGCCCAGATGGAGGAAGG - Intronic
1061798561 9:133102313-133102335 ACTGAGGCCCAAAAAGGTGAGGG + Intronic
1186792424 X:13011940-13011962 TCTGAGGCTCAGAAAGATGAAGG - Intergenic
1187274423 X:17805605-17805627 GCTGAGGCCCAGTGGGATGAAGG + Intronic
1190894605 X:54604789-54604811 ACTGAGGCACAGAAAGATTAAGG - Intergenic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1192203272 X:69080770-69080792 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
1192204344 X:69086225-69086247 GATGAGGCCCAGAGAGGTGAAGG - Intergenic
1196933496 X:120705457-120705479 GCTGAGGCCAAGAATGGTTAGGG + Intergenic
1198953418 X:142099250-142099272 GCTAACGCAAAGAACGATGAGGG + Intergenic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1200794992 Y:7332857-7332879 GCTGAAGCCCAGGACGCTGAGGG - Intergenic