ID: 1101642115

View in Genome Browser
Species Human (GRCh38)
Location 12:106594542-106594564
Sequence GCGAGAATGCCCCGCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 206}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101642115_1101642119 -5 Left 1101642115 12:106594542-106594564 CCCAGGCTGCGGGGCATTCTCGC 0: 1
1: 0
2: 0
3: 13
4: 206
Right 1101642119 12:106594560-106594582 CTCGCCTCGGCTGCCTCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 129
1101642115_1101642126 21 Left 1101642115 12:106594542-106594564 CCCAGGCTGCGGGGCATTCTCGC 0: 1
1: 0
2: 0
3: 13
4: 206
Right 1101642126 12:106594586-106594608 AGCTGAGGAGGCGCTGGGAGTGG 0: 1
1: 0
2: 10
3: 77
4: 686
1101642115_1101642124 15 Left 1101642115 12:106594542-106594564 CCCAGGCTGCGGGGCATTCTCGC 0: 1
1: 0
2: 0
3: 13
4: 206
Right 1101642124 12:106594580-106594602 GGGCACAGCTGAGGAGGCGCTGG 0: 1
1: 0
2: 3
3: 56
4: 436
1101642115_1101642123 9 Left 1101642115 12:106594542-106594564 CCCAGGCTGCGGGGCATTCTCGC 0: 1
1: 0
2: 0
3: 13
4: 206
Right 1101642123 12:106594574-106594596 CTCACAGGGCACAGCTGAGGAGG 0: 1
1: 0
2: 2
3: 31
4: 342
1101642115_1101642125 16 Left 1101642115 12:106594542-106594564 CCCAGGCTGCGGGGCATTCTCGC 0: 1
1: 0
2: 0
3: 13
4: 206
Right 1101642125 12:106594581-106594603 GGCACAGCTGAGGAGGCGCTGGG 0: 1
1: 0
2: 1
3: 31
4: 295
1101642115_1101642127 22 Left 1101642115 12:106594542-106594564 CCCAGGCTGCGGGGCATTCTCGC 0: 1
1: 0
2: 0
3: 13
4: 206
Right 1101642127 12:106594587-106594609 GCTGAGGAGGCGCTGGGAGTGGG 0: 1
1: 1
2: 2
3: 66
4: 529
1101642115_1101642121 6 Left 1101642115 12:106594542-106594564 CCCAGGCTGCGGGGCATTCTCGC 0: 1
1: 0
2: 0
3: 13
4: 206
Right 1101642121 12:106594571-106594593 TGCCTCACAGGGCACAGCTGAGG 0: 1
1: 0
2: 2
3: 37
4: 339
1101642115_1101642118 -6 Left 1101642115 12:106594542-106594564 CCCAGGCTGCGGGGCATTCTCGC 0: 1
1: 0
2: 0
3: 13
4: 206
Right 1101642118 12:106594559-106594581 TCTCGCCTCGGCTGCCTCACAGG 0: 1
1: 0
2: 0
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101642115 Original CRISPR GCGAGAATGCCCCGCAGCCT GGG (reversed) Intronic