ID: 1101649059

View in Genome Browser
Species Human (GRCh38)
Location 12:106658522-106658544
Sequence GCAAATTCTGAGCCACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101649059_1101649065 -8 Left 1101649059 12:106658522-106658544 CCTCCTTGTGGCTCAGAATTTGC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1101649065 12:106658537-106658559 GAATTTGCTCTGGGAAAGAGGGG 0: 1
1: 0
2: 1
3: 45
4: 284
1101649059_1101649067 23 Left 1101649059 12:106658522-106658544 CCTCCTTGTGGCTCAGAATTTGC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1101649067 12:106658568-106658590 GCTTTTTCTCCTTCCTTTTCTGG 0: 1
1: 1
2: 12
3: 131
4: 834
1101649059_1101649066 -4 Left 1101649059 12:106658522-106658544 CCTCCTTGTGGCTCAGAATTTGC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1101649066 12:106658541-106658563 TTGCTCTGGGAAAGAGGGGTAGG 0: 1
1: 2
2: 2
3: 25
4: 278
1101649059_1101649064 -9 Left 1101649059 12:106658522-106658544 CCTCCTTGTGGCTCAGAATTTGC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1101649064 12:106658536-106658558 AGAATTTGCTCTGGGAAAGAGGG 0: 1
1: 0
2: 2
3: 39
4: 356
1101649059_1101649063 -10 Left 1101649059 12:106658522-106658544 CCTCCTTGTGGCTCAGAATTTGC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1101649063 12:106658535-106658557 CAGAATTTGCTCTGGGAAAGAGG 0: 1
1: 0
2: 4
3: 32
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101649059 Original CRISPR GCAAATTCTGAGCCACAAGG AGG (reversed) Intronic