ID: 1101649923

View in Genome Browser
Species Human (GRCh38)
Location 12:106668104-106668126
Sequence GAAGGTAACCCAGCTGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101649923 Original CRISPR GAAGGTAACCCAGCTGCAGT TGG Intronic
901176462 1:7302953-7302975 GAAGGGTACCCAGGTGCTGTGGG + Intronic
903414760 1:23174704-23174726 AAAGCTAACCAAGCTGGAGTTGG + Intronic
908029333 1:59983196-59983218 GATGTTAGCCAAGCTGCAGTTGG + Intergenic
913099261 1:115547960-115547982 CAAGGAAATCCATCTGCAGTTGG - Intergenic
916966272 1:169945489-169945511 GCAGGGATGCCAGCTGCAGTTGG - Intronic
917492820 1:175512869-175512891 TTAGGTAAGCCAGCTCCAGTTGG + Intronic
919772650 1:201172549-201172571 CAGGCTAAGCCAGCTGCAGTTGG - Intergenic
919999126 1:202782875-202782897 GAAAGTAAGCCAGGTGTAGTGGG + Intronic
920350222 1:205333016-205333038 GAAGGAACCCCAGCTGGGGTTGG - Intergenic
924794751 1:247285160-247285182 AAAGGTGGCCCCGCTGCAGTGGG - Intergenic
1064357053 10:14628479-14628501 GAAGGTAACCCCAATGCACTAGG + Intronic
1067038125 10:42933909-42933931 AAAGGTAGCCCAGCTGCAGCCGG + Intergenic
1067179574 10:43974412-43974434 GAAGGGGACCCAGCTCCAGAGGG + Intergenic
1067661024 10:48236309-48236331 GAAGGGAAAACAGCAGCAGTGGG + Intronic
1067957542 10:50808814-50808836 GAAGGAGCCCCAGGTGCAGTGGG + Intronic
1070959801 10:80490639-80490661 GATAGAAACCCAGCTGGAGTCGG + Intronic
1071603243 10:86969109-86969131 GGAGGTGACCCAGCTGCGGTGGG + Intronic
1072073327 10:91942719-91942741 GGAGGTAACCCAGCAGTATTTGG + Intronic
1072552993 10:96493493-96493515 GAGGGCAAGCCAGCTGGAGTGGG + Intronic
1077667951 11:4131637-4131659 GAAGGTGAGCCAGGGGCAGTTGG + Intronic
1077911344 11:6573652-6573674 AAATGTAACCCATATGCAGTGGG - Intronic
1078939712 11:15988852-15988874 GAAGGTCAGCCAGCTGCCGCAGG - Intronic
1079481371 11:20884201-20884223 GATGGTGAGCCTGCTGCAGTTGG - Intronic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1082735054 11:56846106-56846128 GAAGGGGACCCAGCGGCAGTGGG - Intergenic
1083448539 11:62727117-62727139 GAAAGTGACCGAGCTGCGGTCGG - Exonic
1084398214 11:68928729-68928751 GAAGGAAAAGCTGCTGCAGTGGG + Intronic
1084425689 11:69083550-69083572 GTAGCTGACCCACCTGCAGTGGG + Intronic
1086843139 11:91714073-91714095 GGTGGTAATCCAGCTGGAGTAGG - Intergenic
1089441799 11:118523865-118523887 GAAGGTCACCCAACTCCATTGGG + Exonic
1090112420 11:123927997-123928019 AAATGTAAGCCAGGTGCAGTGGG - Intergenic
1092168292 12:6356647-6356669 AGAGGCAACACAGCTGCAGTAGG + Intronic
1101649923 12:106668104-106668126 GAAGGTAACCCAGCTGCAGTTGG + Intronic
1104177735 12:126349323-126349345 GTAGGAGACCCAGCTGCAGATGG + Intergenic
1109231744 13:59765921-59765943 GGAAGAAACTCAGCTGCAGTAGG + Intronic
1110925507 13:81146240-81146262 AAAAGTAAACCAGCTGTAGTGGG - Intergenic
1111595521 13:90404914-90404936 CCAGGTATGCCAGCTGCAGTAGG - Intergenic
1115478979 14:33843381-33843403 GATGGGAACCCAGAAGCAGTGGG - Intergenic
1115613105 14:35067643-35067665 AAAGGGAACCCAGGTGCACTTGG - Intronic
1118305834 14:64654580-64654602 AACGGAAACCCAGCTGAAGTAGG + Intergenic
1118974288 14:70663954-70663976 GAAGGTCACCCAGCTGGAAGGGG - Intronic
1121437249 14:93927910-93927932 CAAGGTGACCCAGCTACAGGTGG - Intronic
1122107127 14:99466682-99466704 GAAGGGAACCCGGCTGGAGAGGG + Intronic
1122201158 14:100123599-100123621 GAAGGTAACCCAGCACCCGCAGG + Exonic
1122347454 14:101069389-101069411 CAAGGTCACCCAGCTGGAGGTGG + Intergenic
1123023184 14:105411671-105411693 GATGGTAGCCCAGCTGGTGTCGG + Exonic
1132081888 15:98873104-98873126 GAAGGTAAAGCTGCTCCAGTGGG + Intronic
1132627340 16:897767-897789 GAGGGTGGCCCAGCTGCAGCAGG + Intronic
1133315976 16:4884316-4884338 GAAGGTAACCCATACGCAGAAGG - Exonic
1133635666 16:7662696-7662718 AAAAGTCACCCAGCTGCAGGTGG + Intronic
1142140972 16:88472745-88472767 GCTGGGAACCCAGCAGCAGTGGG + Intronic
1142195193 16:88736373-88736395 GAAGGTCAGCCAGCTGTGGTAGG + Exonic
1144056000 17:11541180-11541202 GATGGAAACCCAGCTGCTCTGGG + Intronic
1144269876 17:13605431-13605453 GAATGTATCCCAGCTCCAGGAGG + Intergenic
1147547228 17:41411457-41411479 GAAGGTGCGCCAGCTGGAGTGGG - Intergenic
1152059362 17:78058566-78058588 CAAGCTAAACCAGCAGCAGTGGG + Intronic
1153813783 18:8775757-8775779 GAAGGAACCCCAGCTGCAGAAGG - Intronic
1154266024 18:12879942-12879964 GAAAGTAACACAGCTTGAGTAGG - Intronic
1154529890 18:15332271-15332293 GATGGTTCCCCAGCTGCAGGAGG + Intergenic
1157530936 18:48419818-48419840 GTAGGAAAGGCAGCTGCAGTGGG + Intergenic
1160393651 18:78556616-78556638 CGAGGAAACCCAGCTGCAGGCGG - Intergenic
1165106206 19:33470960-33470982 GAGGATGCCCCAGCTGCAGTGGG - Intronic
1165705750 19:37975191-37975213 GTATGTATCACAGCTGCAGTTGG - Intronic
1165767554 19:38360721-38360743 TAAGGTACACCAGCTGCAGGGGG - Exonic
928330503 2:30354606-30354628 GAAGGGACCCCAGATGCATTGGG + Intergenic
928460416 2:31467331-31467353 TAATGTAACTCAGCTGCAGCAGG + Intergenic
930219879 2:48735661-48735683 GAAAGTAACCCAACTCCACTGGG - Intronic
931457514 2:62423892-62423914 GAAGGTCAGGCAGCCGCAGTAGG + Intergenic
933598214 2:84303786-84303808 GAAGGAAACCAAGATGCTGTTGG + Intergenic
934906544 2:98210022-98210044 GAAGGTCACCCAGCAACAGCAGG - Intronic
936774305 2:115954516-115954538 GAAGGTAATGCAGCAGGAGTAGG - Intergenic
948978039 2:241475927-241475949 GAAGCTAACGGAGCTGCAGCGGG + Exonic
949077562 2:242070733-242070755 AAAGGACACCCAGCTGCAGGTGG - Intergenic
1170485624 20:16813046-16813068 TAATGAAACCCAGCTGCAGAAGG - Intergenic
1172587649 20:36095714-36095736 CCAGGTAACCCTGCTGCTGTTGG - Intronic
1173577171 20:44119973-44119995 GAAGGAACTCCAGCTGCAGCAGG + Intronic
1175467929 20:59205177-59205199 AAAGGTGACCCAGCAGCAGGTGG + Intronic
1178954940 21:37013451-37013473 GAACGTAAGTCATCTGCAGTTGG - Intronic
1179032340 21:37731588-37731610 CAAGGTTACACAGCTGCAATTGG + Intronic
1179949308 21:44700686-44700708 GAAGGTTTCCCTGCTGCAGGTGG - Intronic
1182831242 22:33306269-33306291 GAAGGTAAAACAGGTGCAGGAGG - Intronic
1183988870 22:41584760-41584782 GAAGAAAACCAAGCTGCAGAGGG - Intronic
956850887 3:73227466-73227488 GAAGTTAGACCAGCTCCAGTGGG - Intergenic
959149650 3:102592934-102592956 GAAAGCAAAACAGCTGCAGTAGG - Intergenic
959262746 3:104102576-104102598 GAGGGTAGCGCAGCTGCAATTGG - Intergenic
960992069 3:123318345-123318367 GAAGGTGACCCACCTGCAGAAGG - Intronic
962528735 3:136258894-136258916 GAAGCTTACACACCTGCAGTGGG - Intronic
964862975 3:161221830-161221852 GAAGGAAACCCAACTCCACTGGG - Exonic
965097695 3:164255127-164255149 GAAGGTCCCCCAGCTCCAGAAGG + Intergenic
971319345 4:25592733-25592755 GTAGGTCACCCAGCTTCATTAGG + Intergenic
971834773 4:31748642-31748664 GCAGGGACACCAGCTGCAGTTGG - Intergenic
974916486 4:68184096-68184118 AGAGGTAATCCAGTTGCAGTAGG + Intergenic
982448648 4:155525251-155525273 GAAAGTAACCCAGAAGCAGGTGG - Intergenic
985787984 5:1909852-1909874 GAAAGAAACCCAGCGGCGGTCGG - Intergenic
987002351 5:13672637-13672659 GGATGAAAACCAGCTGCAGTTGG + Intergenic
988519290 5:31931499-31931521 GCAGGACACCCAGCTGCAGCTGG + Intronic
992478553 5:77127577-77127599 AAATGTATCCCTGCTGCAGTAGG - Intergenic
997309853 5:132870703-132870725 GAAGGAAAGACAGCTGCTGTGGG + Intergenic
997425990 5:133803018-133803040 GAAGGAAGCCCACCTGTAGTAGG + Intergenic
997501347 5:134376851-134376873 GGAGGTGACCAAGCTGCTGTGGG - Intronic
1001580814 5:172797024-172797046 AAAGGAAACCAAGCAGCAGTGGG - Intergenic
1003973085 6:11317622-11317644 CAAGTCAACCCAGCGGCAGTTGG - Intronic
1008285919 6:49650293-49650315 GAAGGAAAACCAGCTGTTGTGGG + Intergenic
1012991558 6:105931475-105931497 CAAGGTTACCCACCTGGAGTTGG + Intergenic
1014391440 6:120871340-120871362 GAGAGGATCCCAGCTGCAGTGGG + Intergenic
1017248926 6:152259128-152259150 GAGGATATCCCAGCTGCAATGGG - Intronic
1021254215 7:18370176-18370198 GAAGGTAACCCAGTTGGGGCTGG - Intronic
1022384252 7:29887094-29887116 GAAGGGGCCCCAGCTGCAGCAGG - Intronic
1023121219 7:36910860-36910882 GAAGGTTACACAGGAGCAGTAGG - Intronic
1023529419 7:41137053-41137075 GCAGGGACGCCAGCTGCAGTGGG - Intergenic
1024043937 7:45574885-45574907 GCAGGTGCCCCAGCTGCAGCAGG + Exonic
1027058179 7:75064761-75064783 GAAGGAAACCCAGGGGCAGTTGG - Intronic
1029433668 7:100548942-100548964 GAAGGTCACCTATCTGCAGGTGG + Intronic
1029667565 7:102005687-102005709 GAGGGGAACCCAGCATCAGTGGG - Intronic
1031379166 7:121063469-121063491 AGAAATAACCCAGCTGCAGTTGG - Intronic
1032536357 7:132667961-132667983 CAAGGTTACCCAGCTAGAGTTGG + Intronic
1035536117 8:392618-392640 AAAGGACACCCAGCTGCAGGTGG - Intergenic
1035613195 8:982751-982773 AAAGGTAGCCCAGCTGCTTTAGG - Intergenic
1036752061 8:11449653-11449675 GCAGGCCACCCAGCAGCAGTGGG + Intronic
1043475914 8:80606071-80606093 GAAGGGAACACAGGTGCAGGGGG + Intergenic
1047400584 8:124543159-124543181 GAAGGCCACCCAGCTGCTGAAGG + Exonic
1048186171 8:132243054-132243076 GAAGGAACCCTAGCAGCAGTGGG + Intronic
1049337512 8:142094290-142094312 CAAGGTCACACAGCTGCAGGTGG - Intergenic
1049532508 8:143161427-143161449 ACAGGTGACCCAGCTGAAGTGGG + Intergenic
1050184722 9:2960694-2960716 TAAGGTAACACAGCTACAGATGG - Intergenic
1050875735 9:10633726-10633748 AAAGATAACCCAGTTGCAATGGG - Intergenic
1051263731 9:15290856-15290878 GAAGGAGACACAGTTGCAGTAGG - Intronic
1052765274 9:32634292-32634314 GATGGTGACACAGCTGCATTGGG - Exonic
1053188727 9:36041386-36041408 GATGGGAGCCCTGCTGCAGTGGG + Intronic
1057039660 9:91838690-91838712 GCAGGAGACCCCGCTGCAGTCGG + Intronic
1060213365 9:121723863-121723885 CAAGGTCCCCCAGCAGCAGTGGG - Intronic
1062566870 9:137167491-137167513 GACGGGAACACAGCTGCAGCTGG - Intronic
1187398187 X:18936036-18936058 CAAGGTAACCCAGTGGCAGAGGG - Exonic
1192468833 X:71378883-71378905 GATGGTGACACAGCTGCATTGGG + Exonic
1201901327 Y:19047859-19047881 GGAAGAGACCCAGCTGCAGTAGG + Intergenic