ID: 1101650860

View in Genome Browser
Species Human (GRCh38)
Location 12:106675918-106675940
Sequence CCAATTAGGCAGGACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101650860 Original CRISPR CCAATTAGGCAGGACCTGGT GGG Intronic
904417654 1:30373036-30373058 TCAAAGAGGCAAGACCTGGTTGG + Intergenic
904714234 1:32455024-32455046 CCAATTAGCCAGCCCCTGGATGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906337450 1:44946040-44946062 ACAATTATGCAGGACTTGTTTGG - Intronic
906390082 1:45407545-45407567 CCATTTTGGAGGGACCTGGTGGG + Intronic
907472839 1:54685554-54685576 CCAGTTAGAGAGGACTTGGTGGG + Intronic
907850293 1:58249394-58249416 CCAATTAGGCATAACCTTGTAGG - Intronic
909531220 1:76683944-76683966 GAAATAAGGCAGGAACTGGTGGG - Intergenic
912138945 1:106697501-106697523 ACATGTAGGCGGGACCTGGTGGG + Intergenic
914234445 1:145795412-145795434 CCAATCAAGCAGGACGTGGGCGG - Intronic
922360804 1:224819659-224819681 CCAGATATGCAGGGCCTGGTAGG - Intergenic
922886997 1:229028044-229028066 TCAATTAGGCTTGAGCTGGTGGG + Intergenic
924238630 1:242020770-242020792 CCAAGCAGGCAGGGCCAGGTAGG - Intergenic
1062935126 10:1379805-1379827 CCCAGGAGGCAGGACCTGCTTGG - Intronic
1062954508 10:1531229-1531251 CCAAAAAGGCAAGACCTGTTCGG - Intronic
1064557876 10:16565934-16565956 CTAATTAGATAGGACCTTGTAGG + Intergenic
1068057591 10:52030153-52030175 CCATTTAGGCAGCAAATGGTAGG - Intronic
1068267343 10:54669653-54669675 CGAATTTAGCAGGACCGGGTGGG - Intronic
1069775709 10:70925995-70926017 CCAAGTGGACAGGAGCTGGTGGG - Intergenic
1070518559 10:77230725-77230747 CCAAAGAGGCAGGAACTGGGAGG - Intronic
1071372527 10:84966858-84966880 CCACTCAGGCAGGATCTTGTGGG - Intergenic
1071467460 10:85954701-85954723 CCAGTTCGGAAGGACCTGGGAGG - Intronic
1072239083 10:93478499-93478521 CAAATTACTCAGGGCCTGGTAGG - Intronic
1073245946 10:102090321-102090343 CCAATTAGCCAGCACCTATTAGG + Intergenic
1078506750 11:11956247-11956269 CCATTTTGGCCGGACATGGTTGG + Exonic
1081067547 11:38564474-38564496 CCACTTTGGGAGGCCCTGGTGGG - Intergenic
1081429233 11:42957557-42957579 CTAAAAAGGCAGGACCTGGCCGG + Intergenic
1081649567 11:44814774-44814796 CCCAGTAGGCAGTACCTTGTAGG - Intronic
1081838168 11:46175053-46175075 GCAATTTGGGAGGACCAGGTGGG - Intergenic
1084440701 11:69171194-69171216 GCAATCATGAAGGACCTGGTGGG - Intergenic
1093478423 12:19580279-19580301 CCATTTAGGCAGGATTTGGCAGG - Intronic
1101059393 12:100955225-100955247 GCAATTGAGCAGGACTTGGTAGG + Intronic
1101650860 12:106675918-106675940 CCAATTAGGCAGGACCTGGTGGG + Intronic
1102931391 12:116865063-116865085 CCACGGAGGCAGGACCTTGTGGG - Intronic
1104934554 12:132357605-132357627 CTAATTAGGCAGGTTCAGGTGGG - Intergenic
1105283328 13:18982901-18982923 CCCATTAGACAGGACTTGGTGGG - Intergenic
1111860921 13:93704830-93704852 GCAATGAGGCATGATCTGGTTGG + Intronic
1117458616 14:55922437-55922459 CCAATTATCCAAGTCCTGGTTGG + Intergenic
1117741815 14:58826484-58826506 CCAATTGGGCAGGACCTTCCTGG - Intergenic
1117760356 14:59020897-59020919 CAGTTTAGGCAGGACATGGTGGG + Intergenic
1123858918 15:24443177-24443199 CAGATTAGACAGGACCTGATGGG - Intergenic
1125456398 15:39864131-39864153 CAAATCAGGCAGCATCTGGTAGG - Intronic
1127708232 15:61568092-61568114 CCAGCTTGGCAGGACCAGGTGGG + Intergenic
1128556418 15:68634940-68634962 CCAAACAGGAAGCACCTGGTGGG + Intronic
1131191599 15:90321347-90321369 GCAATTAGGCTGGACGTGGTGGG + Intergenic
1135259642 16:20969858-20969880 CCAGTTTGACAGGGCCTGGTGGG + Exonic
1135760441 16:25133731-25133753 CCAATTAGTGAGGACTTTGTAGG - Intronic
1136225345 16:28856722-28856744 CCAACTTGGCAGGACCTCCTGGG + Intronic
1139710295 16:68770796-68770818 CCAGTGTGGCAGGGCCTGGTGGG + Intronic
1141642821 16:85351226-85351248 CCTCTTCGGCAGGAACTGGTTGG - Intergenic
1144761661 17:17710737-17710759 CAAATGAGGCAGGGCCTTGTGGG - Intronic
1149002977 17:51775951-51775973 CCAATTGTGCAGGATCTTGTGGG + Intronic
1151455241 17:74222000-74222022 CCACTGAGGCAGGGCCTGGAAGG - Intronic
1164798745 19:31058219-31058241 CCACTTAGGCAGCTGCTGGTAGG + Intergenic
1165648960 19:37469174-37469196 CCAGTGTGGGAGGACCTGGTGGG + Exonic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1167578667 19:50329620-50329642 ACCGCTAGGCAGGACCTGGTGGG + Intronic
1167745877 19:51351620-51351642 CCAAAAAGGCAGGGCCTGGGTGG - Intronic
928213235 2:29339473-29339495 CCAACCAGGCAGGACCCTGTGGG + Intronic
928400785 2:30977335-30977357 GCACTTTGGGAGGACCTGGTGGG - Intronic
930044258 2:47155196-47155218 TCAATAAGGGAAGACCTGGTGGG - Exonic
933302092 2:80552928-80552950 TCAATTAGGCCGGGCCTAGTGGG + Intronic
934577896 2:95414526-95414548 CCAGTGAGGCAGGACCAGGATGG - Exonic
934601543 2:95662176-95662198 CCAGTGAGGCAGGACCAGGATGG + Intergenic
936410296 2:112252581-112252603 CCAATCATGGAGGAACTGGTAGG - Intronic
939706520 2:145460276-145460298 TAAATTATGCAGGACCTTGTGGG + Intergenic
940013782 2:149082271-149082293 CCGATTAGGGAGGCCCTGGGAGG + Intronic
941601275 2:167546513-167546535 CCTATTAGTCAGGACATTGTGGG + Intergenic
942687540 2:178549144-178549166 CCACTGTGGGAGGACCTGGTGGG + Exonic
946945681 2:224819265-224819287 CCATTAAGGAAGGACTTGGTAGG + Intronic
947721070 2:232369632-232369654 CCAGCTCCGCAGGACCTGGTAGG + Intergenic
1172164299 20:32889548-32889570 CCAAGTAGGCAGGGGGTGGTCGG + Intronic
1173107627 20:40152597-40152619 ACAATTAGGAAGGAACTGTTGGG + Intergenic
1174105512 20:48159908-48159930 CCAGTCAGGCAGGAACTGTTAGG - Intergenic
1175465159 20:59185743-59185765 CCACTGAGGCAGGAGCTGGACGG + Intergenic
1176248915 20:64110807-64110829 CCAGCCAGGCAGGCCCTGGTAGG + Intergenic
1179355947 21:40659730-40659752 CCCATTAGGCTGTACCTGATGGG + Intronic
1181107112 22:20582049-20582071 CCAATTAAGCAGGTCCAGGTGGG + Intronic
1182872229 22:33658089-33658111 CAAATTAGGCTGGACTTGTTCGG - Intronic
1183696932 22:39428821-39428843 CCAATTAGAAAGGCCCTGGAGGG + Intronic
949903113 3:8836256-8836278 GGAATTAGACAGGACCTGGAGGG + Intronic
952528875 3:34242678-34242700 CGATTTAGGCAGGACCAGGTTGG + Intergenic
954346588 3:50004873-50004895 GCAATTTGGCAGGTCCAGGTGGG - Intronic
954665623 3:52250014-52250036 CGCAAAAGGCAGGACCTGGTGGG - Exonic
955317059 3:57947918-57947940 CCAATTGTGTAGGACCTTGTAGG + Intergenic
956741864 3:72281652-72281674 CAGATGGGGCAGGACCTGGTGGG - Intergenic
958084875 3:88794713-88794735 CGAGTCAGGGAGGACCTGGTGGG - Intergenic
959987934 3:112598084-112598106 CAAATTTGGGAAGACCTGGTTGG - Intergenic
964910257 3:161772359-161772381 CCACTTGGGCAGGACTTGGCAGG - Intergenic
965785556 3:172331270-172331292 CCAATCACACAGGACCTTGTGGG - Intronic
974177773 4:58345732-58345754 GGGTTTAGGCAGGACCTGGTGGG + Intergenic
977840666 4:101699798-101699820 CCAATTACGTGGGACCTGATAGG - Intronic
978157498 4:105506465-105506487 TATATTAGGCAGGGCCTGGTAGG - Intergenic
983073135 4:163293033-163293055 GAAATTAGGCTGGACGTGGTGGG + Intergenic
992885707 5:81157846-81157868 CCTATTGGGAGGGACCTGGTGGG - Intronic
993296971 5:86153200-86153222 CAAACTAGGCAGGAACTGGAGGG + Intergenic
998839132 5:146234745-146234767 CAAATTAGGCTGGGCATGGTGGG + Intronic
1001017839 5:168157584-168157606 AAAATTAGGCAGAACTTGGTTGG + Intronic
1003161154 6:3635882-3635904 CCACTGAGGCAGCAGCTGGTGGG - Intergenic
1003467816 6:6398147-6398169 CAATTTAGGCAGGGCCTAGTGGG - Intergenic
1007307027 6:40914932-40914954 CCATTTAGGCTGCACCTGATGGG + Intergenic
1007321825 6:41033278-41033300 GCACTTAGGGAGGAACTGGTAGG + Intronic
1009914154 6:69971978-69972000 CCAACTTTGCAGGACCTTGTGGG - Intronic
1012299446 6:97566579-97566601 CCAATGAGGCAGGACCCTGTGGG - Intergenic
1017234420 6:152104779-152104801 CTAATGAGGCAGCTCCTGGTGGG + Intronic
1019706467 7:2499372-2499394 TCAGGTGGGCAGGACCTGGTGGG + Intergenic
1020742434 7:12039022-12039044 CCATGTAGGAGGGACCTGGTGGG - Intergenic
1021434233 7:20596027-20596049 GCAATTTAGCAGGACCTGGTGGG + Intergenic
1025777636 7:64573047-64573069 CCATTTAGGCTGGGCTTGGTGGG - Intergenic
1028557229 7:92137067-92137089 CCACTTTGGGAGGCCCTGGTGGG + Intronic
1028984829 7:97001671-97001693 CAAACCAGGCAGGACCTGGATGG - Intergenic
1031170638 7:118288480-118288502 TCTATTAGGCAGCACATGGTTGG - Intergenic
1034241045 7:149611151-149611173 TCAAATAGGCAGGACCGGCTGGG + Intergenic
1036125428 8:6057639-6057661 CAGATTAGGAAGGACCTGGTAGG - Intergenic
1041854801 8:62439046-62439068 CAAATTAGGCAAGACCTCCTAGG + Intronic
1042594986 8:70437409-70437431 CCAATTATTAAGCACCTGGTAGG - Intergenic
1045376653 8:101581084-101581106 CCATGTAGACAGGGCCTGGTGGG - Intronic
1046624430 8:116561704-116561726 CCAATTAGGTAGGGCCTGCCTGG - Intergenic
1046973215 8:120245601-120245623 GAAATTAGGCAGGACTTGCTGGG + Intronic
1056578845 9:87876011-87876033 CCACCCAGGCAGGACCTGGACGG + Intergenic
1187544120 X:20230622-20230644 CTTATTATGCAGGGCCTGGTAGG + Intronic
1190759905 X:53430529-53430551 GCAATAGGGCAGGACCCGGTAGG - Exonic
1190812548 X:53898271-53898293 CCTATTTGGCAGGGCCTTGTGGG - Intergenic
1191586518 X:62833284-62833306 CCAATTAGGTGGGACCTAATGGG - Intergenic
1192359560 X:70430551-70430573 CAAATTGGGTAGGACCTTGTAGG + Intronic
1197700301 X:129594684-129594706 CCATTGATGCAGGGCCTGGTGGG - Intergenic
1202032235 Y:20589414-20589436 CCAATTTGGGAGGCCATGGTAGG - Intronic