ID: 1101660632

View in Genome Browser
Species Human (GRCh38)
Location 12:106762092-106762114
Sequence GGAATGTAAGCACTGTCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101660631_1101660632 -10 Left 1101660631 12:106762079-106762101 CCTGCATTGTCTTGGAATGTAAG 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1101660632 12:106762092-106762114 GGAATGTAAGCACTGTCTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 144
1101660629_1101660632 7 Left 1101660629 12:106762062-106762084 CCACATCTGTCACAGTACCTGCA 0: 1
1: 1
2: 2
3: 42
4: 503
Right 1101660632 12:106762092-106762114 GGAATGTAAGCACTGTCTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 144
1101660628_1101660632 8 Left 1101660628 12:106762061-106762083 CCCACATCTGTCACAGTACCTGC 0: 1
1: 0
2: 2
3: 33
4: 226
Right 1101660632 12:106762092-106762114 GGAATGTAAGCACTGTCTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101660632 Original CRISPR GGAATGTAAGCACTGTCTTG AGG Intronic
902551892 1:17224242-17224264 GGACTGGAAGCCCTGTCTGGGGG - Intronic
902552094 1:17225233-17225255 GGAAAGTAAGCCCTGCCTTGTGG + Intronic
902672103 1:17981812-17981834 GAAAAGCAAGCACTGGCTTGCGG - Intergenic
903418791 1:23203300-23203322 AAAATCTAATCACTGTCTTGAGG + Intergenic
903926089 1:26831735-26831757 GGTCTGAAAGCACTGCCTTGGGG + Intronic
907338195 1:53714523-53714545 GGAATTTTCACACTGTCTTGAGG - Intronic
910145320 1:84073429-84073451 GGAATGTAAGCTATGTATGGAGG - Intergenic
915067982 1:153242883-153242905 TAAATGTAAGCAATGTCTTATGG - Intergenic
915706097 1:157845194-157845216 GGAACATAAGCACTGTCTTCAGG + Intronic
919139078 1:193547526-193547548 GGAATGCAAAGAGTGTCTTGTGG - Intergenic
919248248 1:195016635-195016657 TGAATGAAGGCACTGTCTAGTGG - Intergenic
920080112 1:203367006-203367028 TGAATGTAAGCACTGTGCTAGGG + Intergenic
920649614 1:207826964-207826986 GGAATGCAAGCACTGTGTACCGG + Intergenic
922528874 1:226327750-226327772 AGAATGTTAGCTCTGGCTTGTGG + Intergenic
1063082349 10:2780349-2780371 GGAATCCAAGTACTGTCTTTTGG - Intergenic
1064394719 10:14972343-14972365 GCAATGTAAGATGTGTCTTGTGG + Intronic
1065173090 10:23051317-23051339 AGAATGTTAGCTCTGGCTTGTGG - Intergenic
1065443785 10:25776545-25776567 AGAATGTGAGCTCTGGCTTGTGG - Intergenic
1067345279 10:45433769-45433791 GGAATGTTAGCTGTGGCTTGTGG + Intronic
1067797035 10:49328148-49328170 GGAATGTTAGCTCTGGCTTGTGG + Intergenic
1071256918 10:83879271-83879293 CAAATGCAAGCACTGTCATGGGG + Intergenic
1071424960 10:85540116-85540138 GGAATGTGGGCAGTGTCTAGGGG - Intergenic
1072722330 10:97788736-97788758 GGAACGTAGGCACGGGCTTGGGG - Intergenic
1073695450 10:105861318-105861340 GGAATGTATGCACTGTGTGGAGG - Intergenic
1075183532 10:120233831-120233853 GGCATGTGAGCACAGTCTTCTGG + Intergenic
1078067405 11:8087437-8087459 GGGAAGCCAGCACTGTCTTGTGG + Intronic
1080250573 11:30228694-30228716 GGAGTGGAAGCATTGTCTTTAGG - Intergenic
1085578782 11:77631648-77631670 AGAATATATGCACTGTCATGTGG + Intronic
1088713875 11:112531858-112531880 GGAGTTTAAGCACTCTCTTATGG + Intergenic
1090758692 11:129816484-129816506 GGAAGCTAAGCACTGGCTCGGGG - Intronic
1091255685 11:134183012-134183034 GGAAGGCAAGAACTGTCTTCAGG - Intronic
1092257193 12:6933692-6933714 GGCATGCCAGCAATGTCTTGTGG + Intronic
1094141151 12:27183039-27183061 GTAAGTAAAGCACTGTCTTGAGG + Intergenic
1095726704 12:45461761-45461783 GAAATGTAAGCACTTCCCTGAGG + Intergenic
1097051477 12:56225691-56225713 GGAGAGTAAGTGCTGTCTTGGGG + Exonic
1098703741 12:73661754-73661776 GGAATTGAAGCTCTGTCTTTTGG - Intergenic
1099637540 12:85233709-85233731 GGAATCTAAGCACAGATTTGAGG + Intronic
1101660632 12:106762092-106762114 GGAATGTAAGCACTGTCTTGAGG + Intronic
1101698684 12:107151485-107151507 AGAATGTTAGCTCTGGCTTGTGG + Intergenic
1104236299 12:126940959-126940981 GAAATGTAAGCACTATCTACTGG - Intergenic
1113442346 13:110338973-110338995 GGATTGTAATCAGTGACTTGTGG + Intronic
1115368788 14:32588671-32588693 AGACTGTAAGCACTGTCTGTAGG - Intronic
1116889083 14:50249860-50249882 GGAGTGTAAGCCTTGACTTGGGG - Intronic
1119671992 14:76526945-76526967 GGAAAGTAAGTCCTGGCTTGTGG - Intergenic
1123779396 15:23610763-23610785 AGAATGTAGACAATGTCTTGAGG - Intronic
1124860041 15:33430486-33430508 AGAATGTTAGCACTGACTTAGGG + Intronic
1125381658 15:39092660-39092682 GACATGTCAGCACTGCCTTGAGG + Intergenic
1130035314 15:80355147-80355169 GGAATGTTTGCACTGCTTTGTGG + Intronic
1130294962 15:82640110-82640132 CTAATTTAGGCACTGTCTTGGGG + Intronic
1133925310 16:10187492-10187514 GCCATCAAAGCACTGTCTTGAGG - Intergenic
1133926078 16:10193634-10193656 GCTATGTTAGCACTGTCTTATGG + Intergenic
1138066894 16:53951239-53951261 GTAATGTGAGCATTGTGTTGGGG - Intronic
1139589326 16:67924675-67924697 GGGCTGTCAGCCCTGTCTTGGGG + Intronic
1141153388 16:81580062-81580084 AGAATGGAACCAGTGTCTTGGGG + Intronic
1141915435 16:87093451-87093473 GGAAGGTGAGCGCCGTCTTGGGG + Intronic
1141983027 16:87561589-87561611 GCAATGTGACCACTTTCTTGGGG - Intergenic
1145821006 17:27835495-27835517 AGAATGTAAGCTCTGGTTTGTGG - Intronic
1149294350 17:55248299-55248321 GAAATGGAAGCACCATCTTGAGG + Intergenic
1149495461 17:57114632-57114654 GGAAAGTAAGCAGTGCCCTGAGG + Exonic
1149776729 17:59364047-59364069 GGAAATTAATGACTGTCTTGTGG + Intronic
1157103003 18:44746888-44746910 AGTGTGTAAGCACTGTCTTCAGG + Intronic
1162656239 19:12132727-12132749 TGAATGTAAGCACTGTGGTAAGG - Exonic
1162727982 19:12701286-12701308 GGCAAGTCAGCACTGTCTTGGGG - Intronic
1165005429 19:32802479-32802501 GGAATTTAAGCACTGGGCTGTGG + Intronic
925607927 2:5677871-5677893 AGAACATAAGCACTGTTTTGGGG - Intergenic
927145340 2:20161946-20161968 GCAATGTTTGAACTGTCTTGTGG + Intergenic
928344255 2:30476041-30476063 GGACCTTAAGCACTGTCCTGGGG + Intronic
930040652 2:47120374-47120396 AGAATGTTAGCTCTGGCTTGTGG + Intronic
932230602 2:70081077-70081099 GAAATGTAAGAAATGTGTTGGGG - Intergenic
932782682 2:74571694-74571716 GGCATTTAAACACTGTTTTGCGG + Intronic
932959624 2:76397563-76397585 AGAATGTTAGCTCTGGCTTGTGG - Intergenic
938687049 2:133748723-133748745 GGAATGAAAGAACTTTCTAGAGG + Intergenic
939943355 2:148378864-148378886 GGAAAGTAACAAATGTCTTGTGG + Intronic
939977235 2:148732347-148732369 AGAATGGAATCACTGACTTGTGG - Intronic
941331267 2:164180292-164180314 GGAATGCAAGCTCTGGCTTTTGG - Intergenic
941880644 2:170476867-170476889 GGTATATAAGCACTGGGTTGGGG + Intronic
941903763 2:170701954-170701976 AGAATGTTAGCTCTGGCTTGTGG + Intergenic
942072275 2:172326740-172326762 GGTATATAAGCACTGACCTGTGG - Intergenic
944850683 2:203716008-203716030 GGAAGGTTAGCACAGCCTTGAGG - Intronic
948239316 2:236416380-236416402 TGAGTGTCAGCACTGTCATGTGG + Intronic
1170467893 20:16639506-16639528 AGAATGTAAGCTCTGGCCTGTGG + Intergenic
1172151319 20:32792533-32792555 GGAATGTAGGCCCTGGCTGGGGG + Intronic
1177774399 21:25551805-25551827 AGAATGTACTCACTGTCATGAGG + Intergenic
1177937882 21:27372242-27372264 TGATTCTAAGCACTGACTTGAGG + Intergenic
1179321863 21:40300019-40300041 GCAAAGTAAGAATTGTCTTGAGG - Intronic
1181601499 22:23954918-23954940 GGAAGGTAAGGACTGGCTTTCGG - Intergenic
1183497974 22:38161081-38161103 GGAATATAAGCAGTCTCTGGAGG + Intronic
1184425659 22:44407781-44407803 AGAGGGTAAGCTCTGTCTTGTGG - Intergenic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
949295778 3:2520686-2520708 GGAATTTAGGCTCTATCTTGTGG - Intronic
949471293 3:4399722-4399744 GAAATTTACGCACTGTTTTGAGG - Intronic
950617788 3:14176074-14176096 GAAATGTAATAACTGCCTTGCGG - Intronic
951671924 3:25193088-25193110 GGAATGTTAGCAATTACTTGAGG - Intronic
952939198 3:38428699-38428721 GAACTGTAAACACTGTCTTTTGG + Intergenic
955026959 3:55177092-55177114 GTAATGTATACACTGTCTAGAGG + Intergenic
955380630 3:58435142-58435164 GGAATGTTTGGAATGTCTTGGGG - Intergenic
958214259 3:90541892-90541914 GGAATGTTTGGACTTTCTTGAGG - Intergenic
958612270 3:96442219-96442241 GGAATGCAAGCATAGTCTTTTGG - Intergenic
959461435 3:106630497-106630519 GGAATGTGACAAATGTCTTGTGG + Intergenic
960740534 3:120828267-120828289 GGAAAGCAAGCACAGTCTTGAGG - Intergenic
963018347 3:140847514-140847536 GAGATGTAATCACTGTTTTGTGG + Intergenic
963927721 3:150968857-150968879 GGAATATATGCAGTGTCTGGAGG - Intronic
963963636 3:151339700-151339722 GGAAAGTATGCCCTGTTTTGAGG - Intronic
964160204 3:153637500-153637522 GGAATTTGAGCTCAGTCTTGAGG + Intergenic
967372609 3:188764790-188764812 GGAATAAAAGCACTGGTTTGGGG - Intronic
977688231 4:99873796-99873818 GGTAAGTAAGCACTGGCTTCAGG + Intergenic
980811691 4:137891068-137891090 GAAATGTATGCACTATTTTGTGG - Intergenic
981784565 4:148462614-148462636 GGAAAATTAGCAGTGTCTTGGGG - Intergenic
982438685 4:155407692-155407714 GGAATGTAAGCATTCTTTTTTGG + Intergenic
982635583 4:157892440-157892462 GGAATGTTATGATTGTCTTGTGG - Intergenic
984144784 4:176046968-176046990 GGAATGTAAGCAATTTGTTCTGG - Intergenic
987422405 5:17736015-17736037 GGAAGGAGAGCACAGTCTTGGGG + Intergenic
988180168 5:27781306-27781328 GTCATGTAAGCACTCTGTTGTGG + Intergenic
988663302 5:33297506-33297528 AGAATGTTAGCTCTGGCTTGTGG - Intergenic
988995968 5:36715221-36715243 GCAATCTCAGCTCTGTCTTGAGG + Intergenic
989970223 5:50515053-50515075 GGTATGTAAGTACTGCATTGGGG + Intergenic
990216800 5:53542187-53542209 GAACTGTAACCACTGTCTTGAGG - Intergenic
995458813 5:112380903-112380925 GGAATGTAAGAATGGTCTGGTGG - Intronic
998486926 5:142511164-142511186 GGAATGTAAGCACAGGCAAGGGG - Intergenic
999289879 5:150417445-150417467 GGAATGTTAGCTCTGGCCTGTGG - Intergenic
1000237741 5:159377912-159377934 GGAATGGTAGCAATCTCTTGAGG - Intergenic
1002591843 5:180295889-180295911 AGAATGGAAGCCCTGTCTGGGGG - Intergenic
1003011267 6:2429481-2429503 GGAGTGTAAGCATTCTCTTCTGG + Intergenic
1003517860 6:6832732-6832754 GCAATGCCTGCACTGTCTTGGGG + Intergenic
1005229599 6:23684755-23684777 GGAATGTATGGAATATCTTGGGG - Intergenic
1006183360 6:32166983-32167005 GGGAGGGAAGCACTGTCATGTGG + Exonic
1006773945 6:36577475-36577497 GGAAGATAAGCACTGGCTTGAGG - Intergenic
1007240264 6:40419769-40419791 GGAGTGTAAGCTGTGTCCTGGGG - Intronic
1008028089 6:46661732-46661754 AGAATGACAGCACTGTCATGAGG + Intronic
1008412333 6:51194114-51194136 GGAAAGAAATCAATGTCTTGAGG - Intergenic
1008933160 6:56961229-56961251 AGACTGTAAGAAGTGTCTTGGGG + Intronic
1016886858 6:148967206-148967228 CAAATGTAAGCACTGTGTTCGGG + Intronic
1018642710 6:165919250-165919272 GGAATGTATGCACTGTCTCTTGG + Intronic
1019145030 6:169970870-169970892 GGGGTGTGAGCACTGGCTTGAGG + Intergenic
1021480531 7:21110816-21110838 AGAATATAAGAAATGTCTTGGGG - Intergenic
1022138795 7:27474328-27474350 AGAATTTCAGCACTGTTTTGTGG - Intergenic
1023834402 7:44059863-44059885 GGGATTTATGCACTGTCCTGTGG + Intronic
1024052914 7:45640547-45640569 AGAATGTCAGCTCTGGCTTGTGG + Intronic
1024115138 7:46185546-46185568 GGAATGTAAACACAGGCCTGGGG + Intergenic
1030938938 7:115620774-115620796 GGAATGTTAGCTGTGTGTTGGGG + Intergenic
1032592351 7:133203752-133203774 GTAATGAAAGCACTTTTTTGAGG - Intergenic
1033895269 7:146061788-146061810 GGGATATAATAACTGTCTTGTGG + Intergenic
1038820012 8:30943529-30943551 GGAGGGTAAGTATTGTCTTGAGG + Intergenic
1045322534 8:101092613-101092635 GGAAGGCAAGCACTGGTTTGTGG + Intergenic
1046245869 8:111561984-111562006 GGAATGCAATCAATATCTTGGGG - Intergenic
1047795631 8:128252442-128252464 GGAATCAAATCACTGTCTTCAGG - Intergenic
1053326560 9:37157954-37157976 GAAATGCAACTACTGTCTTGAGG + Intronic
1056877362 9:90347406-90347428 GATATGTGAGCACTGACTTGAGG + Intergenic
1058265275 9:102891044-102891066 AGAATGAATGTACTGTCTTGTGG - Intergenic
1186769184 X:12800804-12800826 GGAATGGAAACCATGTCTTGAGG - Intronic
1187832645 X:23398524-23398546 GGAATGTAAACATTCCCTTGAGG + Exonic
1189893305 X:45628217-45628239 GGAATGTTAGCTCTGACTTGTGG + Intergenic
1191996210 X:67097769-67097791 TGAAAGAAAGCACTGTCTTATGG + Intergenic
1195081988 X:101380016-101380038 GGAATGAAAGCACAGTGTTTAGG + Intronic
1197214973 X:123859468-123859490 GTAAGATAAGCACTGTCTTTGGG - Intergenic