ID: 1101661092

View in Genome Browser
Species Human (GRCh38)
Location 12:106766264-106766286
Sequence GTTTAGAACTTGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101661092_1101661098 7 Left 1101661092 12:106766264-106766286 CCTTCCACCCTCAAGTTCTAAAC 0: 1
1: 0
2: 2
3: 23
4: 194
Right 1101661098 12:106766294-106766316 ACTACTATTCCCTGAACATGTGG 0: 1
1: 0
2: 2
3: 6
4: 105
1101661092_1101661099 13 Left 1101661092 12:106766264-106766286 CCTTCCACCCTCAAGTTCTAAAC 0: 1
1: 0
2: 2
3: 23
4: 194
Right 1101661099 12:106766300-106766322 ATTCCCTGAACATGTGGCCCAGG 0: 1
1: 0
2: 2
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101661092 Original CRISPR GTTTAGAACTTGAGGGTGGA AGG (reversed) Intronic
903913755 1:26748142-26748164 GCTTAGAACTAGGGGCTGGATGG - Intronic
904019455 1:27451349-27451371 GTTAAGAACTTCCAGGTGGAGGG + Intronic
904792046 1:33030033-33030055 TTTTAGAAGTTGATTGTGGAGGG - Intronic
908238220 1:62167745-62167767 GTTTAAACCATGAGGGGGGAGGG - Intergenic
908828562 1:68156966-68156988 ATTGAGAACTTGAGGGCGGAAGG + Intronic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
913077001 1:115348751-115348773 GTCCAGAACTTGAGGGTAAATGG - Intergenic
913179843 1:116311028-116311050 ATTGAGAACTGGATGGTGGATGG - Intergenic
916185578 1:162129338-162129360 GTTTAAAAAATGAGGCTGGATGG - Intronic
916211169 1:162361007-162361029 GTGTAGAGCTGGAGGGTGCAGGG + Intronic
916834886 1:168533296-168533318 TTTTAGAGCTCGAGGATGGAAGG + Intergenic
918305698 1:183244036-183244058 GTCCAGAACTTGAAGGTGGCAGG - Exonic
918438720 1:184544276-184544298 GTTTAGAAGTTGAGGCAGGGTGG + Intronic
918842580 1:189561221-189561243 GCGTAAAACTTGAGGGTGGAAGG + Intergenic
921449111 1:215282272-215282294 GATCAAAACTTCAGGGTGGAAGG + Intergenic
922046564 1:221951094-221951116 GTTTAGCACTATAGGATGGATGG - Intergenic
924692494 1:246364735-246364757 GTTCTGCACTTGGGGGTGGATGG - Intronic
1068485007 10:57646612-57646634 GTTTAGAACTTTAGAGTTTATGG + Intergenic
1070399585 10:76041667-76041689 GTTTGGAGCATGAGGGAGGAGGG - Intronic
1071454214 10:85831274-85831296 CTTGAGTACATGAGGGTGGAGGG + Intronic
1071502531 10:86213873-86213895 GTTAGGAACTGGTGGGTGGATGG - Intronic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1074864215 10:117535560-117535582 GTTTAGGACTGGAAGGCGGAGGG - Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075523491 10:123161159-123161181 TTTAAGGACTTGAGGGAGGAGGG - Intronic
1077327553 11:1970313-1970335 ACTTTGAACTTGGGGGTGGAGGG + Intronic
1080555528 11:33413158-33413180 CTTTAGAAAATGAGGGTGAATGG - Intergenic
1083841552 11:65307746-65307768 TTTTAGAGCTTGAGGGTTGGGGG + Intergenic
1084256588 11:67947035-67947057 GTGCAGATCTGGAGGGTGGAAGG - Intergenic
1084589746 11:70083852-70083874 GTTAAGAACTTGTGGGTAGATGG + Intronic
1085192201 11:74636975-74636997 ATTTAGCACTTGAGGTTTGATGG + Intronic
1086846489 11:91755947-91755969 GGTGACTACTTGAGGGTGGATGG - Intergenic
1088699336 11:112398006-112398028 ATTTAGAGCTGGTGGGTGGAGGG - Intergenic
1089636494 11:119817123-119817145 GATGAGAACTTGAGTCTGGAAGG + Intergenic
1089849231 11:121482129-121482151 GTTTTGGACTTGAAGGAGGAGGG + Intronic
1091067877 11:132533793-132533815 GTTGAGAACTGGAGAGTGGGTGG - Intronic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1202810535 11_KI270721v1_random:25493-25515 ACTTTGAACTTGGGGGTGGAGGG + Intergenic
1094073854 12:26450822-26450844 GTTGAGAACCTTAGAGTGGAGGG + Intronic
1097351478 12:58553792-58553814 GTTTAGAACTGTGGGGTGGCTGG + Intronic
1099256428 12:80319503-80319525 ATTTAGAACTTGATGGTGATAGG - Intronic
1099396678 12:82148311-82148333 GTCTACTACTTGAGGGTGGAAGG - Intergenic
1099843891 12:88004870-88004892 GGGTCCAACTTGAGGGTGGAGGG + Intronic
1099924725 12:89003485-89003507 TTTTAGAATTTGGGGGAGGAGGG + Intergenic
1101661092 12:106766264-106766286 GTTTAGAACTTGAGGGTGGAAGG - Intronic
1105208147 13:18240337-18240359 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1106843548 13:33712293-33712315 GGTTAGAAGTTGAGGCTGGAGGG - Intergenic
1107823750 13:44308937-44308959 GTTTAGAACTGGGGAGTGGAAGG - Intergenic
1109703293 13:66055439-66055461 GGCTTGAATTTGAGGGTGGAGGG + Intergenic
1109906722 13:68852798-68852820 GTATAGAAATTGAGAGTAGAGGG - Intergenic
1110218024 13:73044752-73044774 TTTGGGAACTTGAGGGTAGAGGG + Intergenic
1111255733 13:85665462-85665484 GTGGAGAACTTGAGAGTGAAAGG - Intergenic
1115317002 14:32035433-32035455 GTACAGAACTGGAGGGTGGAGGG + Intergenic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1119983212 14:79105601-79105623 GGTAAGAATTTGGGGGTGGAAGG - Intronic
1121546343 14:94766368-94766390 GCTTAGAATTTCAGGGTGGGAGG - Intergenic
1122599528 14:102914473-102914495 GATTAGAAGTTAAAGGTGGAGGG + Intergenic
1124124644 15:26928542-26928564 GATTAGGACGTGAGGGTGGGGGG + Intronic
1126870384 15:52980916-52980938 TTTGAGAACATGAGTGTGGAGGG - Intergenic
1128953928 15:71919501-71919523 TTTTAGAAATTGAGGGTACAGGG - Intronic
1129150988 15:73687654-73687676 GGTCAGAACTGGAGGGTGGAGGG - Intronic
1129947401 15:79551243-79551265 GTTTATCACTTAAGGGTGGATGG - Intergenic
1146496348 17:33325831-33325853 GTATAGGATTTGAGGATGGAAGG + Intronic
1146884739 17:36463618-36463640 GCTTGGACATTGAGGGTGGAGGG + Intergenic
1147022614 17:37549176-37549198 TTTTAGAATTTGAGGAAGGAAGG - Intronic
1148579812 17:48735789-48735811 GTTTAGGACTTGAGGGGCCAGGG - Intergenic
1149331839 17:55590771-55590793 GTTTGGAACCTTAGGGTGGGTGG - Intergenic
1149644731 17:58232077-58232099 TTTTAGAACTTGGGGCTGGAGGG + Intronic
1151957972 17:77389838-77389860 GTTTAGAACCCGGGGGTGGGGGG + Intronic
1152448764 17:80363244-80363266 GTGGAGAACCTGAGGGTAGATGG - Exonic
1156144345 18:34158409-34158431 TTTTTGAACTCGAGGGTGGGGGG - Intronic
1156253157 18:35371479-35371501 GTTGAGAAGTCCAGGGTGGAGGG + Intronic
1156319084 18:36001233-36001255 GTTTTGACCTTGAGGGTGGAAGG + Intronic
1159277466 18:66239319-66239341 GGAGATAACTTGAGGGTGGAAGG + Intergenic
1162320625 19:9969177-9969199 GTGTAGACCATCAGGGTGGAAGG + Intronic
1166771179 19:45283452-45283474 GATTAGTAGCTGAGGGTGGAAGG - Intronic
926612413 2:14959575-14959597 GTTTAGAAATGGTGGATGGAGGG - Intergenic
928353405 2:30584525-30584547 GTATAGAGCTTGATGGTGTATGG + Intronic
928661668 2:33508131-33508153 ATTGAGAAATTGAGAGTGGAGGG + Intronic
931087075 2:58844325-58844347 GATTAGAACTAGAGGCTGAAAGG + Intergenic
933567994 2:83974829-83974851 GTTTAGAGGTAGAGGGTGGGAGG + Intergenic
934864703 2:97796915-97796937 ACTGAGAACTTGAGGGTGGCAGG - Exonic
935415828 2:102817527-102817549 GTGTACAATTTGAGGGTTGATGG + Exonic
937060229 2:118975241-118975263 GTTTCTAAATTAAGGGTGGATGG - Intronic
938751518 2:134335526-134335548 GTTTAGAAATTGAGGGGAGGAGG - Intronic
941233721 2:162943295-162943317 GTATTTAACCTGAGGGTGGAGGG - Intergenic
941641807 2:167996907-167996929 GTCTAGACTTTGAGGCTGGATGG + Intronic
945566159 2:211402812-211402834 GTTTAGAACATCAAGATGGATGG - Intronic
948923440 2:241078622-241078644 GCTCAGGACTGGAGGGTGGAGGG + Intronic
1169640324 20:7743927-7743949 ATTTAGAACTTGATTTTGGAAGG - Intergenic
1170085916 20:12531385-12531407 GTTTTGAACTTGAGGGAAGAAGG + Intergenic
1176974048 21:15298435-15298457 TTTCAGGAATTGAGGGTGGAAGG - Intergenic
1177419273 21:20835052-20835074 CTTGAGTACTTGAGGGTGGAAGG - Intergenic
1177531411 21:22363031-22363053 GTTGACTACCTGAGGGTGGATGG + Intergenic
1177686188 21:24440000-24440022 GTTTAGAACCTTAGGGTGTAGGG + Intergenic
1178834529 21:36085318-36085340 GTTTAAAACTTGAGCCTGGTTGG - Intergenic
1179403899 21:41109652-41109674 GTTTAGAATTTGATGGGAGAAGG + Intergenic
1180758709 22:18182226-18182248 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1180768996 22:18366018-18366040 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1180777316 22:18496377-18496399 GTTTGGAAGTTCAGAGTGGAAGG - Intergenic
1180810036 22:18753687-18753709 GTTTGGAAGTTCAGAGTGGAAGG - Intergenic
1180826871 22:18869242-18869264 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181196182 22:21187939-21187961 GTTTGGAAGTTCAGAGTGGAAGG - Intergenic
1181213347 22:21305185-21305207 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1181523993 22:23468172-23468194 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1183939492 22:41285349-41285371 GTTTATAAAGTGAGTGTGGAGGG - Intronic
1185040626 22:48501984-48502006 GTTTTGAACTTAAAGCTGGAGGG + Intronic
1203230618 22_KI270731v1_random:106902-106924 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
1203277011 22_KI270734v1_random:95152-95174 GTTTGGAAGTTCAGAGTGGAAGG + Intergenic
951322185 3:21258549-21258571 GTTTATGACTTGAAGGAGGATGG + Intergenic
952794189 3:37224382-37224404 GTTCAGAACTTGAAAGTAGAAGG + Intergenic
953510957 3:43538680-43538702 CTTTTGGACTTGAGGGTGGTTGG + Intronic
954353584 3:50066234-50066256 GTTTACCACTTTAGGCTGGAAGG - Exonic
955423765 3:58766421-58766443 GCTTAGACCTTGGTGGTGGAAGG - Intronic
958682584 3:97351050-97351072 TTTTAGAGCTTGAGGATGGCAGG - Intronic
960084139 3:113572643-113572665 GATTAGAACTTGAATGTGTATGG + Intronic
962015774 3:131438873-131438895 GTTTAGGACTTGAGGAGAGAAGG + Intergenic
962409934 3:135132309-135132331 GTGTAGAACTCAAGGGTAGAAGG - Intronic
963343278 3:144063557-144063579 GATAAGATATTGAGGGTGGAGGG - Intergenic
964450931 3:156812564-156812586 GTTTTGAAATTCTGGGTGGATGG - Intergenic
965770534 3:172177090-172177112 GATCAGAAATTGAGGATGGAGGG + Intronic
966284958 3:178284716-178284738 GTTTAGAGGTGGTGGGTGGATGG + Intergenic
967840303 3:193999902-193999924 GTTGAGAAGTTGATGGTGGGAGG + Intergenic
969542134 4:7799029-7799051 GCTGAAAACTGGAGGGTGGATGG - Intronic
970356705 4:15260987-15261009 GTTTACAACTTGAGGCTGTTTGG - Intergenic
971356014 4:25895870-25895892 GCTGTGAACTTGTGGGTGGAAGG + Intronic
972774075 4:42225336-42225358 GTTAAGAACATGGGGGTGGAAGG + Intergenic
973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG + Intronic
973851469 4:54965465-54965487 GGTTAGGTCATGAGGGTGGAGGG + Intergenic
974572588 4:63673025-63673047 GTTTAGAACTTGACTGGGAAAGG - Intergenic
975607016 4:76165063-76165085 AATTAGAAGTTGGGGGTGGAGGG + Intronic
975665713 4:76732987-76733009 GTACTGAACTTGAGGGTGAATGG + Intronic
977421675 4:96808511-96808533 GGTTAGAACTTGGGGTTGAATGG + Intergenic
977621152 4:99138944-99138966 GATTAGAATTAGTGGGTGGAAGG + Intronic
978643956 4:110906590-110906612 GTTTTGAACTTGGGTGGGGAAGG + Intergenic
981997319 4:150988930-150988952 GTTTATAAATTGGGGGTGGGGGG + Intronic
983689717 4:170453392-170453414 GTTTAGAAGTTGAGGTTCCAAGG - Intergenic
985910893 5:2881311-2881333 GTGTAGTACTAGAGAGTGGAGGG + Intergenic
987709891 5:21492971-21492993 GTTTGGAACTTGAGGCTAGGAGG + Intergenic
988749721 5:34181192-34181214 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
989198986 5:38744520-38744542 GTTTGGGACTTTATGGTGGAAGG - Intergenic
989522977 5:42423197-42423219 GTTTGGAACTTGATTGTTGATGG + Intergenic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
990989091 5:61667956-61667978 GTTGAGAAGTTGTGGGTGGATGG + Intronic
991141995 5:63255217-63255239 GTTTAGAACTGTAGGGTAGAAGG - Intergenic
991166127 5:63566707-63566729 ATTGAGAACTTGAGGATGCAGGG + Intergenic
991737980 5:69644396-69644418 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
991760214 5:69912028-69912050 GTTTGGAACTTGAGGCTAGGAGG + Intergenic
991787118 5:70206072-70206094 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
991789556 5:70224122-70224144 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
991814305 5:70499232-70499254 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
991817440 5:70520524-70520546 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
991839445 5:70787079-70787101 GTTTGGAACTTGAGGCTAGGAGG + Intergenic
991879564 5:71206462-71206484 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
991882004 5:71224491-71224513 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
994460517 5:100064459-100064481 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
994484664 5:100377870-100377892 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
997813266 5:136992811-136992833 GTTCAGAACTTGAATTTGGATGG + Intronic
998257688 5:140601120-140601142 GTATAGAAATCAAGGGTGGATGG - Intergenic
998858349 5:146417822-146417844 TATTAGAACTTGGTGGTGGAGGG + Intergenic
999045148 5:148459223-148459245 GATAAGAACTCGAGGGGGGAGGG + Intronic
999313707 5:150570364-150570386 TTAGAGAACTGGAGGGTGGAGGG - Intergenic
999373780 5:151072352-151072374 GTTTAGAATCTCAGGCTGGAAGG + Intronic
999630456 5:153565606-153565628 GCTTAGAACCTGATGGTGGGAGG - Intronic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1000619603 5:163468777-163468799 GTATAGAATTTTAGGGTGGCAGG + Intronic
1000790433 5:165600347-165600369 ATTTTGTACCTGAGGGTGGAAGG - Intergenic
1002390603 5:178908964-178908986 GTTTAGTGCTAAAGGGTGGAAGG + Intronic
1003814403 6:9821745-9821767 GCCCAGTACTTGAGGGTGGAGGG - Intronic
1004320493 6:14628062-14628084 GTTTAGAACATTAGGTGGGATGG - Intergenic
1005547789 6:26887535-26887557 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1005832756 6:29683731-29683753 GTTGAGACCTTGAGGGTATAAGG + Intergenic
1008380281 6:50833409-50833431 GTTTAGAACATGAGGATAGGAGG + Intronic
1008966607 6:57319167-57319189 GTTCAGGAATTCAGGGTGGATGG + Intronic
1009018552 6:57928616-57928638 GTTTGGAACTTGAGGCTAGGAGG - Intergenic
1010133040 6:72517792-72517814 GATTAGAAAATCAGGGTGGATGG - Intergenic
1012551779 6:100469753-100469775 TTTTGGAACTTGAGCGTGCATGG + Intergenic
1013943529 6:115694463-115694485 GTTAAGAAATTGAAGGTGGGGGG - Intergenic
1014815253 6:125928226-125928248 CTTTAGAACTTGGTGGTGGAGGG + Exonic
1017732481 6:157329819-157329841 GTTCAGAACTTTAGGCAGGAAGG + Intergenic
1022619002 7:31963658-31963680 GATTAAAAGTTGAGGGTAGAGGG + Intronic
1024081649 7:45861611-45861633 GTTTAGATCTGCAGGGTGGGTGG - Intergenic
1024322568 7:48085663-48085685 GTGTTGAACTATAGGGTGGATGG - Intergenic
1025927671 7:65972584-65972606 GTTTGGAACTTGAGGCTAGGGGG - Intronic
1026240169 7:68566979-68567001 GTTAAAAAGTTGAGGGTGGGAGG + Intergenic
1027678153 7:81184814-81184836 GGGTACTACTTGAGGGTGGAAGG + Intronic
1030076871 7:105744569-105744591 GTTTTGCATTTGTGGGTGGAAGG - Intronic
1032954257 7:136952026-136952048 GTTTAGCATTTGAGGGTCTAGGG - Intronic
1034274674 7:149818813-149818835 GATCAGAAGTTGAGGCTGGAAGG - Intergenic
1034782018 7:153889053-153889075 GTTCAGAACTTGACTCTGGACGG + Intronic
1038182571 8:25242844-25242866 GTTTGTCACTGGAGGGTGGATGG + Intronic
1038675714 8:29621049-29621071 GGTGAGAAATTCAGGGTGGAGGG + Intergenic
1038825559 8:30996237-30996259 ATTTAAAAATTGAGGGGGGAGGG - Intronic
1040817819 8:51527377-51527399 GATTGGAATTTGAGGGTAGAAGG - Intronic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG + Intergenic
1044574373 8:93752273-93752295 GGGTACTACTTGAGGGTGGAGGG + Intergenic
1045098686 8:98825138-98825160 CTTTTGAACTTGAGGGGGAAGGG + Intronic
1046316217 8:112505919-112505941 GTTGATAACTTGAGGGTAGAAGG - Intronic
1049755846 8:144311018-144311040 GATGAGAACTTGTGTGTGGAGGG - Intronic
1050190052 9:3015478-3015500 GCTTAGAACATGAGGTTGGAGGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057415495 9:94858700-94858722 GATTAGGTCATGAGGGTGGAGGG + Intronic
1059762415 9:117351041-117351063 GTGTAGACGTTGAGGGTGCAAGG - Intronic
1059884911 9:118735240-118735262 GTTTAGAACCTGAGGTTAGAAGG + Intergenic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1186118417 X:6330226-6330248 GTTTCCAACTTGTGGGTGGAGGG - Intergenic
1188447545 X:30271846-30271868 GTGGAGGACTTGAGAGTGGAAGG - Intergenic
1192224329 X:69217860-69217882 GTTTGGAAGTAGAGGCTGGATGG + Intergenic
1192588821 X:72342579-72342601 TTTTAGAACTAGAAGCTGGAGGG + Intronic
1193300259 X:79881060-79881082 GTGAAGAAACTGAGGGTGGATGG + Intergenic
1195412597 X:104584233-104584255 GTTTAGGACTTGGGTGGGGAAGG + Intronic
1195502302 X:105615643-105615665 TTATAGAGCTAGAGGGTGGAAGG + Intronic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1196940919 X:120775025-120775047 GTTGCTAGCTTGAGGGTGGAAGG - Intergenic
1197309341 X:124884367-124884389 GTTTAGGATTTGGGGGTGGGTGG + Intronic
1198632998 X:138663019-138663041 CTCTAGACTTTGAGGGTGGAGGG - Intronic
1198746953 X:139900824-139900846 ATTAAGAACTTGGGGTTGGAGGG - Intronic