ID: 1101663421

View in Genome Browser
Species Human (GRCh38)
Location 12:106787680-106787702
Sequence CAGGATCTGATGGGCTTATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3099
Summary {0: 1, 1: 13, 2: 224, 3: 647, 4: 2214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101663421_1101663429 13 Left 1101663421 12:106787680-106787702 CCCGATAAGCCCATCAGATCCTG 0: 1
1: 13
2: 224
3: 647
4: 2214
Right 1101663429 12:106787716-106787738 CTACCACGAGAACAGTATGGGGG 0: 304
1: 1533
2: 2272
3: 4259
4: 5356
1101663421_1101663426 10 Left 1101663421 12:106787680-106787702 CCCGATAAGCCCATCAGATCCTG 0: 1
1: 13
2: 224
3: 647
4: 2214
Right 1101663426 12:106787713-106787735 TCACTACCACGAGAACAGTATGG 0: 355
1: 1864
2: 3474
3: 8061
4: 8465
1101663421_1101663427 11 Left 1101663421 12:106787680-106787702 CCCGATAAGCCCATCAGATCCTG 0: 1
1: 13
2: 224
3: 647
4: 2214
Right 1101663427 12:106787714-106787736 CACTACCACGAGAACAGTATGGG 0: 330
1: 1790
2: 3003
3: 6622
4: 9295
1101663421_1101663428 12 Left 1101663421 12:106787680-106787702 CCCGATAAGCCCATCAGATCCTG 0: 1
1: 13
2: 224
3: 647
4: 2214
Right 1101663428 12:106787715-106787737 ACTACCACGAGAACAGTATGGGG 0: 338
1: 1756
2: 2548
3: 4687
4: 5528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101663421 Original CRISPR CAGGATCTGATGGGCTTATC GGG (reversed) Intronic
Too many off-targets to display for this crispr