ID: 1101665728

View in Genome Browser
Species Human (GRCh38)
Location 12:106811769-106811791
Sequence GAAGGTATGAAAGGTGTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101665721_1101665728 7 Left 1101665721 12:106811739-106811761 CCCATTTCAGCAGCATTCTGTGG 0: 1
1: 0
2: 0
3: 21
4: 201
Right 1101665728 12:106811769-106811791 GAAGGTATGAAAGGTGTTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 251
1101665723_1101665728 6 Left 1101665723 12:106811740-106811762 CCATTTCAGCAGCATTCTGTGGG 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1101665728 12:106811769-106811791 GAAGGTATGAAAGGTGTTTGAGG 0: 1
1: 0
2: 0
3: 19
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101665728 Original CRISPR GAAGGTATGAAAGGTGTTTG AGG Intronic
901156226 1:7141319-7141341 TATAGTAAGAAAGGTGTTTGGGG - Intronic
901788924 1:11643136-11643158 GGAGGGATGCTAGGTGTTTGGGG - Intergenic
902913244 1:19617194-19617216 AAAGGTATGAAAGGTAAATGTGG - Intronic
903874479 1:26463923-26463945 GATGGGGTGGAAGGTGTTTGAGG + Intronic
904153664 1:28464325-28464347 GAAGTTATTCAACGTGTTTGGGG - Intronic
904458262 1:30660255-30660277 TAAGGTATGCAGTGTGTTTGGGG - Intergenic
904609776 1:31719192-31719214 GAATCCATGAAATGTGTTTGAGG + Intergenic
905221625 1:36451717-36451739 GAATGTAAGAAAGGTGTTGGAGG - Intergenic
906491340 1:46271167-46271189 GAAGATCTGAAAGGTGGTTGTGG + Intronic
906735665 1:48124395-48124417 AAATGTATAAAATGTGTTTGTGG - Intergenic
907247240 1:53116010-53116032 GAAAGAATGAAAGGGCTTTGGGG - Intronic
908537570 1:65092430-65092452 AAAGCTATGAAAGGTGATGGCGG - Intergenic
910095198 1:83513927-83513949 GAAAGTACAAAAGGCGTTTGGGG - Intergenic
910767503 1:90797056-90797078 TAAGGTAGGAAATATGTTTGAGG + Intergenic
911160267 1:94676875-94676897 GAAGATATAAAAGGAGCTTGGGG - Intergenic
912193572 1:107370500-107370522 GAAAGTATGAAAGGGGGGTGAGG - Intronic
912259563 1:108096870-108096892 GAAGGTGTGAAAGGTGCTTTGGG + Intergenic
912592680 1:110842080-110842102 GAAGAAATGACAAGTGTTTGAGG - Intergenic
914418724 1:147508849-147508871 GAGGGTATGAGAGTTGTTGGGGG + Intergenic
915013601 1:152712918-152712940 GAAGGGAAGAAACTTGTTTGAGG - Intergenic
915594805 1:156890402-156890424 TAAGGGATGAGAGGTGTGTGTGG - Intergenic
915989709 1:160501848-160501870 GAAGGGGAGAAAGGAGTTTGTGG + Intronic
917214457 1:172663696-172663718 GGAGCAATTAAAGGTGTTTGAGG + Intronic
919728238 1:200897363-200897385 GATGGCTTGAAAGTTGTTTGAGG + Intronic
922375807 1:224964072-224964094 GATGTTCTGAAAGGTGTCTGTGG + Intronic
923663698 1:235980361-235980383 GAAGCTATGAATGGTTTTTACGG - Intronic
924362937 1:243260004-243260026 GAATGGATGAAAGGTGAATGTGG - Intronic
924428657 1:243977592-243977614 GAGGCTCAGAAAGGTGTTTGGGG + Intergenic
1062913331 10:1228743-1228765 GCAGGAATGAAAAGTGTTCGTGG - Intronic
1063157188 10:3390768-3390790 GGAGGTATGAAGGGTGAATGGGG - Intergenic
1064000377 10:11658837-11658859 GAAGATTTTAAAGGTGTTTGAGG - Intergenic
1065812415 10:29454461-29454483 AAAGGTATTAAAGATTTTTGAGG - Intergenic
1067515908 10:46943380-46943402 GAAGGAAGGAAACGTGTATGTGG + Intronic
1067566866 10:47345838-47345860 GAAGTTATGAAAGGAAGTTGAGG - Intergenic
1067646342 10:48108430-48108452 GAAGGAAGGAAACGTGTATGTGG - Intergenic
1069275943 10:66590900-66590922 TAAGGCATCAAAGTTGTTTGTGG + Intronic
1069685243 10:70313804-70313826 AAACGTATGATTGGTGTTTGAGG + Intronic
1071679214 10:87687691-87687713 GAAGAAATGATAAGTGTTTGAGG + Intronic
1072165477 10:92808806-92808828 GAAGGTCTGAAAGGTAGATGAGG - Intergenic
1074861766 10:117515302-117515324 TAAGGTATGAAATGAGTTGGGGG + Intergenic
1077677630 11:4210657-4210679 GAAGGAATGACTGGTGTTGGTGG + Intergenic
1079785154 11:24663277-24663299 GATGGTTTAAAAGTTGTTTGTGG + Intronic
1079841226 11:25401954-25401976 AAAGGTTTGAAAGGTCTTTGGGG + Intergenic
1079923501 11:26461430-26461452 GAAGGTGTGAAAGGAGTGGGGGG - Intronic
1080170158 11:29291545-29291567 AAAGTTATGAATGGTGGTTGAGG - Intergenic
1081066434 11:38546364-38546386 AAAGGTATTAATGGTTTTTGTGG - Intergenic
1083548529 11:63567009-63567031 GAAGGTTTTAAAGTTGATTGTGG + Intergenic
1083659505 11:64245660-64245682 GGAGCTGTGACAGGTGTTTGGGG - Intronic
1084468711 11:69342723-69342745 GAAGGGAGGGGAGGTGTTTGGGG + Intronic
1084628123 11:70324599-70324621 AAAGGTATGAAAAGTATTTCAGG - Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089345774 11:117790500-117790522 GAAGGTCTCACAGCTGTTTGTGG - Intronic
1092474837 12:8809594-8809616 GTAGGGATGACAGGTTTTTGGGG - Intergenic
1092528971 12:9328521-9328543 GAAGGGAGGGTAGGTGTTTGGGG + Intergenic
1094353203 12:29549400-29549422 GGAGGTATGGAAGGTCTTTCTGG + Intronic
1098301458 12:69058523-69058545 AAAGGAATAAAAAGTGTTTGAGG - Intergenic
1099174450 12:79404369-79404391 GAGGGTGTGGAAGGTGTTTTGGG - Intronic
1099820823 12:87707087-87707109 AAAGAGATGAAAGGTGATTGGGG + Intergenic
1099979350 12:89580998-89581020 GAAGATAGGAATGGAGTTTGGGG + Intergenic
1100558718 12:95725028-95725050 GAAGTTATTTTAGGTGTTTGTGG - Intronic
1100693374 12:97063987-97064009 GAAGGGAAGAAAGATGTTTCAGG + Intergenic
1100712308 12:97270961-97270983 GAAGGTATTAAAGGATTTTAAGG + Intergenic
1101250670 12:102931635-102931657 GAAGGTAGGCAAGGAGATTGAGG - Intronic
1101250724 12:102932035-102932057 GATGTTAGGAAAGGGGTTTGAGG + Intronic
1101268095 12:103113366-103113388 GAAGAGAAGGAAGGTGTTTGGGG + Intergenic
1101627138 12:106456202-106456224 GAAGGAATGACAGCTGTTTTGGG + Intronic
1101665728 12:106811769-106811791 GAAGGTATGAAAGGTGTTTGAGG + Intronic
1103617294 12:122162435-122162457 GAAGGAAGGAAAGGAGGTTGGGG - Intergenic
1103635697 12:122303403-122303425 TAAGGTAGGAAGGGTGTTGGGGG - Intronic
1105916479 13:24921835-24921857 GAAGGTATAGAAGGTGTGTTTGG - Intronic
1106644758 13:31620569-31620591 AAAGAAATGAAAAGTGTTTGAGG - Intergenic
1107650259 13:42537831-42537853 GAAGATATTAAAGTAGTTTGTGG + Intergenic
1109089867 13:58028586-58028608 GAATGAATGAAAAGTGTTTGTGG + Intergenic
1109379602 13:61542489-61542511 GAAGTTAAGAAATGTGTTTATGG + Intergenic
1110422534 13:75329119-75329141 GAGGGGAAGAAAGGTGTGTGTGG - Intronic
1110846448 13:80195345-80195367 AAAGGAATAAAAGGTGTTCGTGG - Intergenic
1111653055 13:91116786-91116808 GAGGGTGGGAAAGATGTTTGGGG - Intergenic
1112767538 13:102761991-102762013 GAAGATATTACAGGGGTTTGAGG + Intergenic
1113069746 13:106409132-106409154 AAAGGTAAGAAAGGTTTCTGGGG + Intergenic
1114062580 14:19032558-19032580 GAAGGAATAAAGGGTGGTTGGGG - Intergenic
1114099681 14:19367439-19367461 GAAGGAATAAAGGGTGGTTGGGG + Intergenic
1114788712 14:25630859-25630881 GCAGGTAAGAAAGTTGCTTGAGG - Intergenic
1120003985 14:79336069-79336091 GAATGTATTAAAAGTCTTTGGGG + Intronic
1124658055 15:31524570-31524592 GAAGGTATGGGTGGTGTTGGGGG - Intronic
1125581601 15:40789519-40789541 GAAGGTAGGAAAGGCTTTTGGGG - Intronic
1128092182 15:64926587-64926609 GAAGGTCTGATGGGTGGTTGGGG + Intronic
1128549441 15:68588785-68588807 GATGGAAAGAAAGGTGTTGGTGG + Intronic
1128861887 15:71081086-71081108 GAAGGAATGCAAAGTTTTTGGGG + Intergenic
1130076913 15:80696721-80696743 GAAGGACTGAAAAGTGTTTAGGG + Intronic
1131653482 15:94428618-94428640 GAAGGTCTGATAGGTGTCTGGGG - Intronic
1134390940 16:13819457-13819479 CTAAGTATGAAAGGTGTATGTGG - Intergenic
1135586260 16:23673662-23673684 TAAAATATGAAAGGTGTTAGTGG + Exonic
1139908629 16:70382934-70382956 GAAGGGATGACAGGTATATGAGG + Intronic
1140992980 16:80232183-80232205 GATTGTATGAAAGGCATTTGGGG - Intergenic
1141429982 16:83966401-83966423 GAAGGGAGGAAAGGGGATTGTGG + Intergenic
1142842296 17:2642964-2642986 CAAGGGATGAAAGGAGTTGGGGG - Intronic
1143625644 17:8109028-8109050 GAGGGTATGAATTGAGTTTGGGG - Intronic
1143676046 17:8433917-8433939 GAAGGGATTAATGGGGTTTGTGG - Intronic
1144169537 17:12646618-12646640 AAAGGTATGAATGATGTTTCTGG - Intergenic
1144492469 17:15725645-15725667 GAAGGTATAAAAGGGATGTGTGG - Intergenic
1144716298 17:17438131-17438153 AAAGGAATGATATGTGTTTGAGG + Intergenic
1144864573 17:18326892-18326914 GAAGGTGTGCAAGGCCTTTGGGG + Intergenic
1146166565 17:30594246-30594268 AAAAGTATGAAAGGTATATGGGG + Intergenic
1146632902 17:34483601-34483623 GGAGGGATGAAAGATGTTTCTGG - Intergenic
1147170608 17:38616754-38616776 GAAGTTAAGAAACTTGTTTGAGG + Intergenic
1147938062 17:44024904-44024926 GAAGGAATGAGAGGTGGTTAAGG - Intergenic
1148724171 17:49776798-49776820 GAAAGTAGGAAAGCTCTTTGTGG + Intronic
1149037412 17:52150322-52150344 AAAGGTATAGAAAGTGTTTGAGG - Intronic
1152454496 17:80405679-80405701 GTAGGGATGACAGGTTTTTGGGG - Intergenic
1153699701 18:7680239-7680261 GAAGGGATGAAATGTGATGGAGG + Intronic
1154451742 18:14483366-14483388 GAAGGAATAAAGGGTGGTTGGGG + Intergenic
1155290084 18:24331716-24331738 GAAGCTATAAAAGGTGTCTTGGG - Intronic
1157196336 18:45623100-45623122 GAAGGGAAGACAGGTGGTTGTGG + Intronic
1157909183 18:51599039-51599061 GCAGGAATCAAAGATGTTTGGGG + Intergenic
1158217242 18:55112820-55112842 GAAGGGAGGACAGGTGTTTTGGG - Intergenic
1158511259 18:58092534-58092556 GGAGGTACGAAAGTTGTATGAGG + Intronic
1158624317 18:59058325-59058347 GGAGGAAGGGAAGGTGTTTGAGG - Intergenic
1159957724 18:74531592-74531614 AAAGGTATGGAAGGTGCTAGGGG + Intergenic
1164866137 19:31605907-31605929 TAAGGTTGGAAAGGTGTTTGAGG + Intergenic
1166104139 19:40589359-40589381 AAAGGTGTGACAGGTGTTGGTGG + Intronic
1167192800 19:48003441-48003463 GAAGATAAGAAATGAGTTTGAGG + Intronic
1168083592 19:54028565-54028587 GAAGGTAAGAAAGGAGTGTTGGG + Intergenic
927835197 2:26391476-26391498 CAAAGTATGAAAGGTCTTTCAGG + Exonic
928185708 2:29108703-29108725 GTACGTATGAAAAATGTTTGAGG - Intronic
928768995 2:34683088-34683110 GATGGTCTTAAAGGTGATTGGGG + Intergenic
928911247 2:36423900-36423922 GAAGCTAGGAAAGGTGACTGAGG + Intronic
929162567 2:38847316-38847338 GAGGGTATGAAAGGTGTAACAGG - Intronic
930794338 2:55372002-55372024 GAATTTATGAAAAGTGTTTTAGG - Intronic
930937377 2:56970315-56970337 GACAGTATGCAAGGTGCTTGAGG - Intergenic
931937423 2:67214446-67214468 GTATGTATGTAAGGTGTATGTGG - Intergenic
934916922 2:98307906-98307928 GAAGGAAGGAAAGGAGGTTGGGG - Intronic
935301100 2:101694704-101694726 GAAGGTAAGAGATTTGTTTGTGG - Intergenic
935532066 2:104245888-104245910 GAAGGAATGATAAATGTTTGAGG + Intergenic
937085547 2:119169376-119169398 GAAGATGAGAAAGGTGTGTGAGG - Intergenic
937971207 2:127550745-127550767 GAGGGTATGAAAGCTGGATGGGG + Intronic
938479947 2:131652764-131652786 GAAGGAATAAAGGGTGGTTGGGG - Intergenic
938621581 2:133060269-133060291 GCAGGTGTGAAATGTGTTTTGGG + Intronic
938902281 2:135808433-135808455 GAGGCTTTGAAAGGTGTGTGAGG - Exonic
939887109 2:147693080-147693102 GAAACTAGGAAAGGTTTTTGGGG + Intergenic
941483113 2:166043080-166043102 AAAGGTATGTTATGTGTTTGTGG - Intronic
942334135 2:174862788-174862810 CAAGATATGAAAGGTATTTCTGG + Intronic
942486875 2:176449303-176449325 GAAGGGATGAATGTTGTCTGGGG - Intergenic
942600276 2:177634149-177634171 AAAGGGAAGAAAGCTGTTTGGGG - Intronic
944530869 2:200666921-200666943 GAAGGAAATAAAGGTGTTTTAGG + Intronic
946221745 2:218233412-218233434 GAAGGTATAAAAGGGGTTCTTGG + Intronic
946710365 2:222499270-222499292 GAAGGTTTGAGAGGTGTTGATGG + Intronic
947326574 2:228985444-228985466 CAAGCTATGAAAGCTCTTTGAGG + Intronic
947730774 2:232429709-232429731 TAAGTCATGAAAGGTGTGTGCGG + Intergenic
948852052 2:240713296-240713318 CAAGGTATGGCAGGAGTTTGTGG - Intergenic
1169894614 20:10489585-10489607 GAAGGTATAAAAGGGTTCTGGGG - Intronic
1170401713 20:15992477-15992499 GAAGGGATGAGAGGTGGTGGTGG - Intronic
1170675082 20:18471497-18471519 GGTGTTATGATAGGTGTTTGGGG - Intronic
1171127313 20:22613789-22613811 GAGGGGATGAGAGGTGTTTGAGG - Intergenic
1172067847 20:32234243-32234265 GAAGGTGTGAATGGTGTGTTTGG + Intronic
1172659537 20:36558190-36558212 GAAGGCATGAAGGGTCTCTGCGG - Intergenic
1175477588 20:59287974-59287996 GAAGGCCTCAAAGGTGGTTGAGG - Intergenic
1176444402 21:6806854-6806876 GAAGGAATAAAGGGTGGTTGGGG - Intergenic
1176822567 21:13671892-13671914 GAAGGAATAAAGGGTGGTTGGGG - Intergenic
1178609440 21:34068127-34068149 GAAGGTCTGAAAGGTGGGTGAGG + Intergenic
1178964711 21:37105256-37105278 GCAGCTTTTAAAGGTGTTTGGGG + Intronic
1179000043 21:37449095-37449117 GAAGTTAAGAAATGTGTTTTCGG - Intronic
1179145567 21:38764703-38764725 GACGGGATGAAAGTTGTTTGGGG - Intergenic
1179225444 21:39448899-39448921 GTAGGTCTGCAAGGCGTTTGGGG - Intronic
1180169048 21:46048239-46048261 GATGGTATGAAAGATCTTTTTGG + Intergenic
1180481072 22:15755185-15755207 GAAGGAATAAAGGGTGGTTGGGG - Intergenic
1180575756 22:16772466-16772488 GAAATAAAGAAAGGTGTTTGTGG - Intergenic
1180748013 22:18104944-18104966 GAATGTATGTAAGGTACTTGGGG + Exonic
1182497847 22:30723086-30723108 TAATGTATGAAAGTTATTTGAGG - Intronic
1184517600 22:44972263-44972285 GAAAATATGAAAGGTGATTAAGG + Intronic
951477950 3:23128735-23128757 GAAGGTCTGAAAGGGGTCTGAGG - Intergenic
951743769 3:25953902-25953924 AAAGATAGGAAAGGTGTTGGAGG - Intergenic
952198342 3:31099176-31099198 GAAGCTATGAAAGGAGTTAGAGG + Intergenic
953122341 3:40057121-40057143 GAAGGTGTGGAAGGTGGTGGGGG - Intronic
954111795 3:48437767-48437789 GAAGGTATGGTGGGAGTTTGTGG - Intronic
954856274 3:53646599-53646621 GAAGGAATGGAAGGTGTCAGTGG + Intronic
956716673 3:72085758-72085780 GAAGGTGGGAAAGGTCCTTGGGG + Intergenic
956871193 3:73419981-73420003 GAAAGTATGAAAGCTCTGTGTGG - Intronic
957481444 3:80802329-80802351 GAGGCTATGCAAGGTGTGTGGGG + Intergenic
958731347 3:97963657-97963679 GATGGTATGAGAGGTCTTTCAGG + Intronic
959119358 3:102213976-102213998 GCAGATATGAAAGGTTTTAGAGG + Intronic
959803771 3:110526909-110526931 GAATGTCTGGGAGGTGTTTGAGG - Intergenic
964796862 3:160507666-160507688 AAAGGGATGAAAGGTGTTCCAGG - Intronic
965732105 3:171783108-171783130 GAAGGGATGTTAGGGGTTTGAGG + Intronic
965969353 3:174534622-174534644 GATGGTAGGAAAGGTGTTCTTGG - Intronic
966081962 3:176016103-176016125 GAATGTATGAAAAGTTTTTAAGG + Intergenic
966483008 3:180432453-180432475 AAAGGAATTAAAGGTGTTTTAGG + Intergenic
966577449 3:181518591-181518613 GGAGGCATGAAAGGTTTCTGAGG - Intergenic
967369035 3:188721947-188721969 CAATATATGAAAAGTGTTTGAGG - Intronic
967494284 3:190125518-190125540 AAAGGAATCAAAGATGTTTGGGG - Intergenic
969281049 4:6170910-6170932 GATGGTAAGAAAGGTGGTGGCGG - Intronic
970613266 4:17745005-17745027 GAAGGGCTGTAAGGTCTTTGAGG - Intronic
970914525 4:21317365-21317387 GAAATTATTAAAGGTGTTTTTGG - Intronic
971576289 4:28279653-28279675 GCAGGTATCCAAGGTGATTGGGG - Intergenic
972324376 4:38001285-38001307 CAAGGTATGGAAGGGGTTTTGGG + Intronic
973205974 4:47560531-47560553 AAAGGTATGAAAGGTGCTGCTGG + Intronic
974566086 4:63579558-63579580 CAAGGGAGGAAAGGTGCTTGGGG + Intergenic
978995415 4:115144688-115144710 AATGGTGAGAAAGGTGTTTGAGG + Intergenic
979143566 4:117210758-117210780 GAATGTAGGAAACTTGTTTGAGG + Intergenic
979305676 4:119140354-119140376 GGAGGTATGAAAGGCCTTTTTGG - Intronic
979481510 4:121223699-121223721 GAAGCTAAGAAAGGTGTTCAAGG - Intronic
983642182 4:169953314-169953336 GCAGATAGGAAAGATGTTTGGGG + Intergenic
984837500 4:184035267-184035289 GAAGGAATTATAGGCGTTTGGGG + Intergenic
985168079 4:187118465-187118487 GAAGGTATGTAAGTTATTAGAGG - Intergenic
986420690 5:7578436-7578458 GAAGGTGTGAAAGATATTTCAGG - Intronic
988371363 5:30371951-30371973 GAAGGAATGAGTGGTGTGTGGGG + Intergenic
990465615 5:56068519-56068541 GATGCTCTGAAAGGCGTTTGGGG + Intergenic
990533251 5:56694810-56694832 GAAGATATCAGAGGTGTTTACGG + Intergenic
990564742 5:57017822-57017844 GAAGGGATGACAAGTTTTTGGGG + Intergenic
991722844 5:69509816-69509838 GGAGGTATGAGTGGTGTTTTGGG + Exonic
994704825 5:103190325-103190347 GAATGAATGAATGTTGTTTGGGG + Intronic
996097077 5:119410375-119410397 GAAGGGCTGAAAAGTGATTGAGG + Intergenic
996191900 5:120554812-120554834 GAAATTATGAGAGGTGTTTCTGG - Intronic
996579690 5:125017755-125017777 GAGGGTAAGAAAGGAGTTTTTGG - Intergenic
998964686 5:147526537-147526559 GCAAGTATAAAAGGTATTTGGGG + Intergenic
1001962687 5:175889644-175889666 GAAGGTATGGTATGTGTCTGAGG - Intergenic
1002095565 5:176828827-176828849 GGAGGTATGAAAGATGGATGGGG + Intronic
1002823735 6:753937-753959 GATGGCATGGAAGGGGTTTGGGG - Intergenic
1006325267 6:33348922-33348944 GAAGGGATGACAAGTTTTTGGGG - Intergenic
1009749819 6:67869109-67869131 GAAGGGATGACAAGTTTTTGGGG + Intergenic
1011894983 6:92214803-92214825 AAAAGTAGGAAAGGTGTTTGAGG - Intergenic
1013337664 6:109181366-109181388 GAAGGTAAGAAAAGTGGTGGTGG - Intergenic
1014900584 6:126959366-126959388 GAAGGTGTGAAAGAGGTATGAGG + Intergenic
1015358945 6:132314164-132314186 GATGGTGTGAATGGTGTTAGGGG - Intronic
1015441001 6:133246002-133246024 GGAGGTGTGAAAGGGGTTAGGGG - Intronic
1015712674 6:136159296-136159318 TACAGTATGAAAGGTGTTTTTGG + Intronic
1018883195 6:167905592-167905614 GAAAGCAAGAAAGGTGTGTGTGG - Intronic
1020430980 7:8115935-8115957 CAAGGTATGAAAGGCCTCTGAGG - Intronic
1022048149 7:26639515-26639537 CATGGTGGGAAAGGTGTTTGAGG + Intronic
1023344793 7:39260363-39260385 CAAGGTATGGAATGTGTGTGTGG - Intronic
1024731000 7:52253742-52253764 AAAGGTAGCAAAGGTGTTTCTGG + Intergenic
1025293379 7:57752361-57752383 GAAGGTATGAAAGGACATTTCGG - Intergenic
1025871438 7:65438100-65438122 TAAGTCCTGAAAGGTGTTTGGGG - Intergenic
1026567530 7:71501777-71501799 GAAGGAAGGACAGATGTTTGGGG - Intronic
1028521103 7:91731702-91731724 GAGGGAATGAATGTTGTTTGGGG + Intronic
1028539992 7:91932373-91932395 GAAGGTATGAAAGGTAATTCTGG - Intergenic
1031371834 7:120977612-120977634 GAAGGTATTATATGTGTGTGTGG + Intergenic
1031449850 7:121901826-121901848 AAAGGAATGAAAAGTGTTTGAGG - Intronic
1031672205 7:124563641-124563663 GGAGTTAGGAAGGGTGTTTGTGG - Intergenic
1031724115 7:125215747-125215769 GAAGGGATGAATGGTGTATTGGG + Intergenic
1031895899 7:127347710-127347732 CAAGGGGTGAAAGGGGTTTGAGG + Intronic
1032228569 7:130054049-130054071 GGAAGTATTGAAGGTGTTTGAGG - Intergenic
1032648176 7:133848638-133848660 GAAAGTATGAAAGATATTTCAGG - Intronic
1035443284 7:158921679-158921701 GAGGGGCTGATAGGTGTTTGTGG + Intronic
1036765292 8:11546100-11546122 GAAGGTAAGAAGGGTGGTTTGGG + Exonic
1037073551 8:14683291-14683313 GAAAGTATGACAGATGTTTAAGG + Intronic
1041111130 8:54483818-54483840 GAAGGAAGGAAAGGTGGTGGGGG - Intergenic
1041520052 8:58745997-58746019 GAAGTTATGAAAGATTTCTGGGG + Intergenic
1041701393 8:60792967-60792989 GAATGTTTGAAAGCTGATTGAGG + Intronic
1042031264 8:64478443-64478465 GAAGGGAAGAAAGGAGTCTGGGG + Intergenic
1042061099 8:64818898-64818920 ACAGGTATGGAAGGTGCTTGTGG - Intergenic
1042164551 8:65933145-65933167 GAAGGAAGGTAAGGCGTTTGAGG + Intergenic
1042734512 8:71972882-71972904 GAAGGCATGATATGAGTTTGAGG + Intronic
1043237800 8:77890864-77890886 GAAGCCAGGAGAGGTGTTTGAGG + Intergenic
1045116428 8:98987851-98987873 GAAGGCAGGAAGGGTTTTTGGGG - Intergenic
1045246203 8:100443626-100443648 GAAGATTTGAAATGTGTTGGGGG + Intergenic
1045778058 8:105829602-105829624 GAAGTAATGAAAGTTGTTTTTGG + Intergenic
1050444917 9:5710688-5710710 GAAGGAATGAAAACAGTTTGAGG + Intronic
1051468170 9:17404415-17404437 GAAGGTAGGAAAGTTCTTTGAGG + Intronic
1052273359 9:26651238-26651260 CAAGGTAAGAAAGGAGTTCGGGG + Intergenic
1053146255 9:35714220-35714242 GAAGGTATGGAAGCTGGTTCTGG - Exonic
1056675297 9:88671796-88671818 GAATGTATGTATGGTGTATGTGG + Intergenic
1056781703 9:89555599-89555621 ACAGCTATGACAGGTGTTTGTGG + Intergenic
1057119776 9:92560658-92560680 GAAGGAATAAAAGCAGTTTGAGG - Intronic
1203524796 Un_GL000213v1:77673-77695 GAAGGAATAAAGGGTGGTTGGGG + Intergenic
1186023036 X:5278132-5278154 CAAGTTATGAAAGATGTTTGTGG - Intergenic
1187178487 X:16918768-16918790 GAGGGTAGGAAGGGTGTATGGGG + Intergenic
1187975872 X:24704300-24704322 GCAGGTATAAAAGGTTTTTTTGG + Intronic
1189482061 X:41399716-41399738 TAAGGAATGAATGGTGTTTCTGG - Intergenic
1192382604 X:70634232-70634254 GGAGGTATGTAAGTTGTTCGTGG + Intronic
1195516182 X:105778815-105778837 TAAGCTATGAAATGTGTATGGGG - Intergenic
1200219638 X:154384717-154384739 GGAGGTACGAAGGGTGTCTGCGG + Intergenic