ID: 1101676085

View in Genome Browser
Species Human (GRCh38)
Location 12:106917846-106917868
Sequence CTGGGCAGTGCGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101676075_1101676085 22 Left 1101676075 12:106917801-106917823 CCCTAGACTGTGCTATTCCAGAT No data
Right 1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG No data
1101676076_1101676085 21 Left 1101676076 12:106917802-106917824 CCTAGACTGTGCTATTCCAGATT No data
Right 1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG No data
1101676078_1101676085 5 Left 1101676078 12:106917818-106917840 CCAGATTGGAAGCAGAATTTGCA No data
Right 1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101676085 Original CRISPR CTGGGCAGTGCGGAGGAGGA GGG Intergenic
No off target data available for this crispr