ID: 1101680009

View in Genome Browser
Species Human (GRCh38)
Location 12:106955784-106955806
Sequence GCGCGCGTGCGCGTCGGAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101680003_1101680009 10 Left 1101680003 12:106955751-106955773 CCGGTGGGCGCGGGAGGGGCCCG 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG 0: 1
1: 0
2: 0
3: 2
4: 39
1101680007_1101680009 -10 Left 1101680007 12:106955771-106955793 CCGGGCTGCACGAGCGCGCGTGC 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG 0: 1
1: 0
2: 0
3: 2
4: 39
1101680002_1101680009 11 Left 1101680002 12:106955750-106955772 CCCGGTGGGCGCGGGAGGGGCCC 0: 1
1: 0
2: 2
3: 29
4: 352
Right 1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG 0: 1
1: 0
2: 0
3: 2
4: 39
1101680006_1101680009 -9 Left 1101680006 12:106955770-106955792 CCCGGGCTGCACGAGCGCGCGTG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG 0: 1
1: 0
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101680009 Original CRISPR GCGCGCGTGCGCGTCGGAAC TGG Exonic
900237594 1:1600123-1600145 GCGCGGGGGCGGGTCGGAGCGGG - Intergenic
900284129 1:1891153-1891175 GTGCGCGTGCCCGTCGGGCCTGG - Intergenic
900620133 1:3582966-3582988 GTGCACCTGCGTGTCGGAACTGG - Intronic
917565383 1:176207275-176207297 GCGCGCGCGAGCGGCGGAAGAGG + Exonic
1077201508 11:1309691-1309713 GCGCGCGTGCGCGCGAGAGCCGG - Intergenic
1083768513 11:64853735-64853757 GCGGGGTTGCGCGTCGGAGCCGG + Exonic
1089102570 11:115975878-115975900 GCGCGCGCGCGCGCATGAACTGG + Intergenic
1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG + Exonic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1130086228 15:80780060-80780082 GCGGGCGTGCGCCTAGCAACAGG + Intronic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1133732651 16:8590023-8590045 GGGCGCGTGCAGGTCGGAGCCGG - Intergenic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1137300252 16:47142980-47143002 GCGCGCGGGCGCCGCGGACCCGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG + Exonic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1175841311 20:62029463-62029485 GCGCGCGCGCACGTGGGCACTGG - Intronic
1180235808 21:46458866-46458888 GAGCGCGTGCGCGGCGGGAAGGG - Intergenic
954575002 3:51671140-51671162 GGGCGCGTGCGCGCGGGACCCGG - Intronic
955246196 3:57227586-57227608 GCGAGCGCGGGCGTCGGAAGCGG - Intergenic
955380366 3:58433601-58433623 GCGCGGGTGCTCGTCGGACGAGG - Intronic
959398438 3:105869353-105869375 GTGGGCGTGAGCGTCGGGACCGG + Intronic
960465936 3:117996887-117996909 GTGCGCGCGCGCGTGTGAACGGG - Intergenic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
974047129 4:56907836-56907858 GCGCGCGCGGGCGTCGGAGGGGG + Intergenic
979077826 4:116297117-116297139 ACGGGCGTGAGCGTCGGTACAGG - Intergenic
979077828 4:116297135-116297157 ACGGGCGTGAGCGTCGGTACGGG - Intergenic
979077831 4:116297153-116297175 ACGGGCGTGAGCGTCGGTACGGG - Intergenic
979077834 4:116297171-116297193 ACGGGCGTGAGCGTCGGTACGGG - Intergenic
979077837 4:116297189-116297211 ACGGGCGTGAGCGTCGGTACGGG - Intergenic
979077840 4:116297207-116297229 ACGGGCGTGAGCGTCGGTACGGG - Intergenic
979077843 4:116297225-116297247 ACGGGCGTGAGCGTCGGTACGGG - Intergenic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1006787944 6:36680284-36680306 GCGCGCGTGCGTGTCTGCGCGGG + Intronic
1020418158 7:7969273-7969295 GCGCGCGAGCGTGTGGGAGCCGG - Exonic
1025899364 7:65731629-65731651 GCTCGCCTGAGCGTCGGAGCCGG - Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1062341311 9:136094997-136095019 CCGGGCGTGCGCGCGGGAACCGG - Intronic