ID: 1101682986

View in Genome Browser
Species Human (GRCh38)
Location 12:106987212-106987234
Sequence ACTGGCTGCGTTGGGACGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101682986_1101682994 21 Left 1101682986 12:106987212-106987234 CCCCGCGTCCCAACGCAGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1101682994 12:106987256-106987278 GCGTCCCTCCCCGCACCACGAGG 0: 1
1: 0
2: 1
3: 9
4: 115
1101682986_1101683000 30 Left 1101682986 12:106987212-106987234 CCCCGCGTCCCAACGCAGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1101683000 12:106987265-106987287 CCCGCACCACGAGGGCGAGTCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1101682986_1101682995 22 Left 1101682986 12:106987212-106987234 CCCCGCGTCCCAACGCAGCCAGT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1101682995 12:106987257-106987279 CGTCCCTCCCCGCACCACGAGGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101682986 Original CRISPR ACTGGCTGCGTTGGGACGCG GGG (reversed) Intergenic