ID: 1101687197

View in Genome Browser
Species Human (GRCh38)
Location 12:107036750-107036772
Sequence CTGTGCAAAGGTACTGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 1, 2: 6, 3: 90, 4: 507}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101687197_1101687202 22 Left 1101687197 12:107036750-107036772 CCTACTTCAGTACCTTTGCACAG 0: 1
1: 1
2: 6
3: 90
4: 507
Right 1101687202 12:107036795-107036817 CATTTCCCTCATACATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 142
1101687197_1101687203 23 Left 1101687197 12:107036750-107036772 CCTACTTCAGTACCTTTGCACAG 0: 1
1: 1
2: 6
3: 90
4: 507
Right 1101687203 12:107036796-107036818 ATTTCCCTCATACATCCACAGGG 0: 1
1: 0
2: 2
3: 21
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101687197 Original CRISPR CTGTGCAAAGGTACTGAAGT AGG (reversed) Intronic
900630932 1:3634789-3634811 CTGCCCAAAGGGTCTGAAGTGGG - Intronic
901115381 1:6839760-6839782 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
901116254 1:6847389-6847411 CTGTGCAAAGGAACGGAAGAAGG + Intronic
901145419 1:7061650-7061672 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
901336841 1:8456739-8456761 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
901369478 1:8784150-8784172 CAGTGGAAAGGTCCTGAAGTGGG - Intronic
901898956 1:12341665-12341687 TTGTGCAAAGGGGCTGAAGGTGG - Intronic
902055475 1:13597050-13597072 TTGGGCAAAGGAACAGAAGTCGG + Intronic
902149321 1:14430039-14430061 CTCTGCAAAGGCCCTGGAGTTGG - Intergenic
902361946 1:15946718-15946740 GTGTGCAAAGGCACTGAACCAGG + Intronic
902703168 1:18186748-18186770 ATATGCAAAGCCACTGAAGTTGG - Intronic
902975759 1:20087045-20087067 ATGTGCAAAAGGACTAAAGTTGG + Intronic
903443035 1:23402507-23402529 CTGTGCAAAGGCCCGGCAGTGGG - Intronic
903765149 1:25729226-25729248 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
904455001 1:30642229-30642251 CTGTGCCAGGGTCCTGCAGTAGG + Intergenic
904538101 1:31214759-31214781 CTGTGCAAAGGTCCTGTGGAGGG + Intronic
905213446 1:36390294-36390316 CTGTGCAAAGGTCCTGGGATGGG - Intergenic
905785764 1:40756156-40756178 CTTTGCAAAGCTATTGAAGTAGG - Intronic
905967549 1:42112064-42112086 ATGTGCAAAGGTCCTGTGGTAGG + Intergenic
906013354 1:42550530-42550552 TAGTGCAAAGGTCCTGAAGCAGG - Intronic
906694764 1:47816510-47816532 ATGTGCAAAGGTCCTGAAGCAGG - Intronic
906742899 1:48199592-48199614 ATGTGCAGAGGTCCTGCAGTGGG + Intergenic
906770071 1:48475745-48475767 CTGTGCAAGGGCAGTGAAGAAGG + Intergenic
906930541 1:50165231-50165253 ATGTGCAAAGGCCCTGAAGCAGG - Intronic
907541422 1:55218536-55218558 ATGTGCAAAGGTCCTGTTGTGGG + Intergenic
907551479 1:55308690-55308712 ATGTGCAAGGGCACTGAAGCAGG - Intergenic
908373488 1:63507266-63507288 CTGTTGAAAGGTACAGAACTGGG + Intronic
908774412 1:67626290-67626312 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
908794723 1:67819789-67819811 CAGTGCAAAGGCACTGAGCTGGG - Intronic
909256067 1:73424032-73424054 AGGTGCAAAGGTAATGCAGTGGG + Intergenic
909566874 1:77062417-77062439 AAGTGCAAAGGCCCTGAAGTAGG + Intronic
910188981 1:84575296-84575318 CTGAGCAAAGATACTGACATCGG + Intergenic
910433852 1:87185286-87185308 GTGTGCAAAGGCCCTGAGGTGGG - Intergenic
910722440 1:90301604-90301626 CTGCACAAAGATTCTGAAGTGGG - Intergenic
911581833 1:99643221-99643243 CTGTGCAAATGTCCTGTGGTGGG - Intergenic
913118257 1:115716402-115716424 CTGTGCTTAGGAAATGAAGTAGG - Intronic
914882645 1:151559496-151559518 GGGAGCAAAGGCACTGAAGTTGG + Intronic
915447318 1:155981310-155981332 GTGTGCAATGCTACTCAAGTAGG + Intronic
915468106 1:156109503-156109525 CTGTGCAGAGGTGCTGAAGTGGG - Intronic
916271487 1:162947480-162947502 AAGTGCAAAGGTTCTGAAGTAGG - Intergenic
916499096 1:165371193-165371215 AAGTGCAAAGGCACTGAGGTGGG - Intergenic
917459733 1:175219550-175219572 CAGTGCAAAGACCCTGAAGTGGG - Intergenic
917477475 1:175381236-175381258 CTGGGCAAAGGGACTGGACTGGG + Intronic
918168041 1:181969527-181969549 CAGTGCAAAGGTCCTGAAGCAGG + Intergenic
922491674 1:226022082-226022104 ATGGGTAAAGGTACTGAGGTAGG + Intergenic
922621916 1:226995112-226995134 CAGGGCAAAGGTACTACAGTTGG - Intronic
923839214 1:237649909-237649931 CTGTGCAAAGGTACCGATTGAGG - Exonic
924606144 1:245537233-245537255 CTGTGCAAAGGCCCTGAGATGGG + Intronic
1063593745 10:7413843-7413865 AAGTGGAAAGGTATTGAAGTGGG - Intergenic
1063617257 10:7611190-7611212 CTTTGCAAAGGTAGATAAGTTGG - Intronic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1065915929 10:30355026-30355048 ATGTGCAAAGGTCCTGAAGTAGG + Intronic
1065992271 10:31023782-31023804 AGGAGCAAAGGTACTGAAGCGGG - Intronic
1066482385 10:35809479-35809501 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1067231878 10:44417857-44417879 TTGTGCAAAGGCCCTGAGGTAGG + Intergenic
1067752915 10:48983738-48983760 CTCTGCAAAGGCCCTGAAGGGGG + Intergenic
1067980560 10:51079546-51079568 CTGTGCTAAAGTACTGTAGTGGG + Intronic
1068886019 10:62097920-62097942 ATGTGCAAAGGCCCTGAAGCAGG + Intergenic
1069298283 10:66874449-66874471 CTTTGCATAGGTACTGCAGTAGG - Intronic
1069629920 10:69891396-69891418 ACGTGCAAAGGTCCTGAGGTAGG + Intronic
1070645306 10:78198043-78198065 ATGTGCAAAGGCCCTGAGGTAGG + Intergenic
1071730845 10:88247043-88247065 GTGTGCAAAGATCCTGAGGTGGG + Intergenic
1071987516 10:91067337-91067359 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1072156799 10:92731020-92731042 ATGTGCAAAGGTCCTGAGGCAGG - Intergenic
1072464939 10:95654634-95654656 CTGCACAAAGGCACTGAAATGGG + Intronic
1073107031 10:101038168-101038190 CAGTGCAAGGGCACTGCAGTAGG + Intronic
1073559789 10:104486982-104487004 ATGTGCAAAGGTCCTGTGGTAGG + Intergenic
1074124169 10:110515095-110515117 ATGTGCAAAGGTCCTGAGGCAGG - Intergenic
1074783822 10:116821317-116821339 CTGTGCTAAGGTCCTGAGGTAGG - Intergenic
1075074411 10:119341280-119341302 CAGTGGAAAGCTACTGAAGCAGG - Intronic
1075220654 10:120581639-120581661 CTGTGGAAAGGCTCTGAGGTGGG - Intronic
1075566583 10:123509426-123509448 CTGGGCCCAGGTACTGAGGTGGG - Intergenic
1077797343 11:5506425-5506447 ATGTACAAAGGCACTGAGGTAGG - Intronic
1078075800 11:8159258-8159280 AAATGCAAAGGCACTGAAGTGGG + Intronic
1078361913 11:10675677-10675699 ATGTGCAAAAGCACTGAGGTAGG - Intronic
1079153141 11:17919728-17919750 CAGTGCAAAGGCCCTAAAGTGGG - Intronic
1079256359 11:18834642-18834664 CTGTGCAGAGGTCCTGCTGTGGG - Intergenic
1079341820 11:19617880-19617902 AAGTGCAAAGGCCCTGAAGTGGG - Intronic
1079361696 11:19775796-19775818 ACGTGCAAAGGTCCTGAGGTAGG + Intronic
1080172864 11:29327279-29327301 GTGTTCAAAGATTCTGAAGTTGG + Intergenic
1080371855 11:31657197-31657219 CTGTGCAAAGGCACTGAGGCAGG - Intronic
1080616645 11:33950194-33950216 CAATGCAAAGGCATTGAAGTAGG + Intergenic
1081691699 11:45082699-45082721 ATGTGCAAAGGTCCAGAGGTGGG - Intergenic
1081719515 11:45277640-45277662 CTGTGCAAAGGTCCTGTGGCAGG - Intronic
1082259209 11:50064589-50064611 ATGTGCAAAAGTCCTGAAGAGGG + Intergenic
1083339619 11:61950560-61950582 CTGTGCAAATGCCCTGAGGTGGG + Intronic
1083993293 11:66259434-66259456 ATGTGCAAAGGTCCTGGGGTAGG + Intronic
1084107299 11:66988452-66988474 AAGTGCAAAGGTCCTGAGGTGGG - Intergenic
1084315176 11:68341677-68341699 CTGGGCAAAGGTCCTGGGGTGGG - Intronic
1084767889 11:71324313-71324335 CTGTGCAAAGGCCCTGAGGCTGG + Intergenic
1085034219 11:73290609-73290631 GTGGGCAAAGGCACAGAAGTGGG - Intronic
1085663586 11:78392634-78392656 GTGGGCAAAGGTAATGAAGATGG + Intronic
1085831712 11:79908306-79908328 CTGGCCAAAGGTACTGTAGAAGG - Intergenic
1087218466 11:95520101-95520123 CTGTGCAAAGGCCCTGTGGTGGG - Intergenic
1088057331 11:105601005-105601027 CTATGAAAAGGCACTGAAGCGGG - Intergenic
1088511309 11:110578602-110578624 CTTTGAAAGGGTACTGAAATGGG + Exonic
1088798037 11:113281180-113281202 ATGTGCAAAGGTCCTGAGGTAGG + Intergenic
1088810861 11:113391163-113391185 AGGTGCAAAGGTCCTGAGGTGGG + Intronic
1089732670 11:120528985-120529007 ATGTGCAAAGGTCCTGAGGCAGG - Intronic
1090848684 11:130551479-130551501 CTGTGCACGGTTGCTGAAGTTGG - Intergenic
1091978300 12:4844526-4844548 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
1092056991 12:5515711-5515733 CAGTGCAAAGGCACTAAGGTAGG - Intronic
1092269641 12:7013212-7013234 GTGTGCAAAGGCTCTGAGGTAGG + Intronic
1093423144 12:18998112-18998134 CTGTGTACAGGTACAGAAGTTGG - Intergenic
1093576401 12:20735616-20735638 GTGTGAAAGGGTACTGAACTAGG - Intronic
1095602177 12:44026361-44026383 ATGTGCAAAGGTCTTGAAGTGGG - Intronic
1097411811 12:59263822-59263844 CTCTGGAAAGGTACTAAAATAGG + Intergenic
1097626211 12:62003406-62003428 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
1098575366 12:72035907-72035929 CTGTGGAAAGGGAGTGTAGTGGG + Intronic
1099256785 12:80324346-80324368 CAGTGCAAAGGTCTTGGAGTGGG + Intronic
1099768455 12:87021159-87021181 CTGTGCAGTGGTTCTGATGTAGG + Intergenic
1099885705 12:88527432-88527454 CTGAGGAAGGGTACTGAAGAGGG + Intronic
1100181300 12:92088963-92088985 CTGTGCAATGGTACAAAGGTGGG + Intronic
1100959354 12:99945303-99945325 AGGTGCAAAGGCCCTGAAGTAGG + Intronic
1101411711 12:104474153-104474175 CTATGCAAAGGTATTGGAATGGG + Intronic
1101612683 12:106305415-106305437 CCTTGCAAATGCACTGAAGTAGG + Intronic
1101687197 12:107036750-107036772 CTGTGCAAAGGTACTGAAGTAGG - Intronic
1101721974 12:107358375-107358397 ATGTGCAAAAGCACTGAAGTAGG + Intronic
1101815793 12:108145152-108145174 ATGTGCAAAGGTCCTGAGGTGGG - Intronic
1102149236 12:110677354-110677376 GTGTGCAAAGGTCCTGTGGTTGG - Intronic
1102199553 12:111047978-111048000 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1102253618 12:111404252-111404274 ATGTGCAAAGGTGCTGAGGTGGG - Intergenic
1102380927 12:112466311-112466333 AAGTGCAAAGGCCCTGAAGTGGG + Intronic
1102396365 12:112589460-112589482 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1102516074 12:113447781-113447803 ATGTGCAAATGTCCTGAGGTGGG + Intergenic
1102528307 12:113527748-113527770 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1102553924 12:113713333-113713355 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1102636787 12:114331567-114331589 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1102807456 12:115794470-115794492 CAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1102928655 12:116845865-116845887 CTGTGCAAAGCTCCTGAGATAGG - Intronic
1103015986 12:117494904-117494926 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1103041818 12:117702096-117702118 ATGTGCAAAGGCCCTGGAGTGGG - Intronic
1103197394 12:119056638-119056660 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103361034 12:120353777-120353799 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103367061 12:120390978-120391000 AGGTGCAAAGGTCCTGAGGTAGG - Intergenic
1103499210 12:121387964-121387986 CTGTGCAAAGGCCCAGAGGTAGG + Intronic
1103697767 12:122830964-122830986 ATGTGCAAAGGCTCTGAGGTGGG + Intergenic
1103799599 12:123529080-123529102 TAGTGCAAAGGTCCTGAGGTAGG - Intronic
1103938666 12:124490097-124490119 ATGTGCAAAGGTCCTGAGGTGGG - Intronic
1103943745 12:124514848-124514870 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1103994309 12:124819273-124819295 CTGTGCAAAGGCCCTGTGGTAGG + Intronic
1104174338 12:126315295-126315317 CACTGGAAAGGCACTGAAGTTGG - Intergenic
1104386508 12:128355741-128355763 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1104657177 12:130581976-130581998 AGGTGCAAAGGTCCTGAGGTCGG - Intronic
1105211216 13:18258240-18258262 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
1107409180 13:40142538-40142560 AAGTGCAAAGGTCCTGAGGTAGG - Intergenic
1107495308 13:40920496-40920518 CAGTGCAGAGATCCTGAAGTAGG - Intergenic
1107804456 13:44141365-44141387 CTCTGTAAAGGTATTTAAGTTGG + Intergenic
1110411147 13:75204894-75204916 CTCTGCTAAGGCACTGAAGAGGG - Intergenic
1113788836 13:113016693-113016715 CTGTGCAAAGGCCCCGAGGTTGG - Intronic
1113867310 13:113535542-113535564 CAGTCCAAAGGTACTTCAGTGGG + Intronic
1114310193 14:21459781-21459803 ATGTGCAAAGGTATGGAACTAGG + Exonic
1114734830 14:25033572-25033594 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1115044096 14:28968626-28968648 AGGTGCAAAGGCACTGAGGTAGG + Intergenic
1115688627 14:35822872-35822894 ATGTGCAAAGACACTGAAATGGG + Intergenic
1117064072 14:51991432-51991454 CTTTGAAAAGGTAATGAATTAGG + Exonic
1117610059 14:57473909-57473931 ATGTGCAAAAGTCCTGCAGTGGG - Intronic
1118936289 14:70291768-70291790 CAGTGCAAATGTCCTGAAATGGG - Intergenic
1118978017 14:70694017-70694039 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1119557586 14:75565549-75565571 ATGTGCAAAGGCTCTGAGGTAGG - Intergenic
1119935112 14:78585268-78585290 CAGTGCAAAGGACCTGAGGTGGG + Intronic
1121008775 14:90507666-90507688 CTGAGCAGAGGCACTGAGGTGGG - Intergenic
1121241941 14:92437264-92437286 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1121598086 14:95181121-95181143 CAGTGCAAAGGCACTGAGGCAGG - Intergenic
1121613325 14:95295774-95295796 AAGTGCAAAGGTCCTGAGGTAGG - Intronic
1121740970 14:96252194-96252216 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
1124893411 15:33754442-33754464 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1125406020 15:39353305-39353327 CTGAGCAAAGGTTCTAACGTGGG + Intergenic
1125682531 15:41541112-41541134 CTGGGCAAAGGTATAGAAGCAGG + Intronic
1126170439 15:45691167-45691189 CTGTTCAAAGGTACTGAAAAGGG - Exonic
1127381023 15:58430597-58430619 CTGTGCAAAGGCCCTGAGGTAGG - Intronic
1128368580 15:67022778-67022800 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1129319620 15:74767317-74767339 CTGTGCAAAGGTCCTGAGGCAGG + Intergenic
1129479413 15:75811122-75811144 ATGTGCAAAGGTCCTGAGGTAGG - Intergenic
1129587136 15:76879175-76879197 CTGTGTAAATGTCCTGAATTAGG - Intronic
1129938816 15:79476151-79476173 CAGTGAAAAGGTCCTGAGGTGGG + Intergenic
1130012332 15:80161329-80161351 CTGTGCAATGGGACTGAAGATGG + Intronic
1130059285 15:80558054-80558076 ATGTGCAAAGGCCCTGAGGTTGG - Intronic
1133231242 16:4367695-4367717 CTGTGCAAAGGTCCTGTGGCAGG + Intronic
1133319569 16:4904595-4904617 CTGTGCAAAGGTCCTGAGGCAGG + Intronic
1133431901 16:5744518-5744540 CAGTGCAAAGCCACTGAAGGTGG - Intergenic
1133467928 16:6045897-6045919 CAGGGCAAAGGCCCTGAAGTAGG + Intronic
1133568982 16:7023087-7023109 CAGTGCAAAGGCACTGAGGTAGG + Intronic
1133690740 16:8212163-8212185 CTGTGAAAAGGAGCTGAAGGTGG + Intergenic
1134123323 16:11599794-11599816 CCGTGCAAAGGTCCTGAGGCAGG - Intronic
1134282224 16:12827254-12827276 ATGTGCCAAGGAACTGAAGGTGG - Intergenic
1134678886 16:16110037-16110059 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1134739364 16:16529122-16529144 CAGTGCAAAGGTCCTGAGGTGGG + Intergenic
1134928136 16:18183029-18183051 CAGTGCAAAGGTCCTGAGGTGGG - Intergenic
1135830835 16:25771449-25771471 CTGTGCAAAGGCCCTGGGGTAGG - Intronic
1136015738 16:27399633-27399655 AAGTGCAAAGGCACTGAGGTAGG - Intergenic
1137271291 16:46904015-46904037 GTGTGCAAAGGCCCTAAAGTTGG + Intronic
1137804312 16:51288930-51288952 AGGTGCAAAGGCCCTGAAGTGGG - Intergenic
1137920995 16:52488280-52488302 CTGAGCAAAGTTCCTGCAGTAGG - Intronic
1137960527 16:52877584-52877606 CTCTGCAAAGGCAGTGAAGATGG + Intergenic
1138182991 16:54955447-54955469 CAGTACAAAGGGACTGAGGTGGG + Intergenic
1138457885 16:57131797-57131819 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1138513150 16:57520256-57520278 CGGTGCAAAGGTCCTGAGGCAGG - Intronic
1138646000 16:58425418-58425440 ATGTGCAAAGGTCCTGAGGCAGG + Intergenic
1138679154 16:58672483-58672505 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1139343403 16:66286658-66286680 CTGAGTAAAGGTGCTGAGGTGGG + Intergenic
1139416427 16:66814944-66814966 ATGTGCAAAGGCCCAGAAGTGGG - Intronic
1140128132 16:72134682-72134704 AAGTGCAAAGGCACTGAGGTGGG - Intronic
1140140539 16:72252464-72252486 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1140250499 16:73290426-73290448 CTGTGCAAAGGCCCTGGGGTGGG + Intergenic
1140408423 16:74726259-74726281 CTGGGCAAAGGTTCGGTAGTAGG + Exonic
1141315885 16:82962111-82962133 CTTTGCAGAGGTAATTAAGTTGG + Intronic
1141478319 16:84288766-84288788 CTGTGCAAAGGCCCTGGGGTGGG + Intergenic
1141687515 16:85578745-85578767 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1142378401 16:89718423-89718445 GTGTGCAAAGGCCCTGAAATAGG - Intronic
1142987525 17:3705413-3705435 CTGGGCAAAGGTAGGGAAGCTGG - Intergenic
1143332768 17:6149571-6149593 CTGTGAAAAGGCCCTGAGGTTGG - Intergenic
1143356127 17:6330189-6330211 TTGTGCAAAGGCCCTGTAGTGGG - Intergenic
1143413114 17:6724249-6724271 ATTTGCAAAGGTCCTGAGGTGGG - Intergenic
1143777708 17:9210188-9210210 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1144219462 17:13086874-13086896 CTGAGCAGAGGTACTGCAGTGGG - Intergenic
1144643405 17:16952225-16952247 ATGTGCAAAGGAACTGAGGCAGG + Intronic
1144761028 17:17707492-17707514 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1144785097 17:17827116-17827138 GTGTGCAAAGGCCCTGCAGTGGG + Intronic
1144998685 17:19288554-19288576 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1145266399 17:21381533-21381555 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1145764936 17:27452089-27452111 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1146173801 17:30652001-30652023 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1146347257 17:32068022-32068044 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1146423801 17:32716153-32716175 ATGTGCAAAGACCCTGAAGTAGG - Intronic
1147572093 17:41577609-41577631 ATGTGCAAATGTCCTGAGGTGGG + Intergenic
1148848543 17:50542858-50542880 CTGTGCAATCGCACTGCAGTGGG - Exonic
1149604918 17:57917716-57917738 CTGTTCACAGGCTCTGAAGTTGG - Intronic
1150828659 17:68498903-68498925 CTAAGCAAAGCTACTGAACTTGG - Intergenic
1151523232 17:74646021-74646043 CTGTGCAAAAGTCCTGGGGTGGG + Intergenic
1151893145 17:76963037-76963059 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1152696835 17:81801885-81801907 CTGTGAGAAGGTTCTGAAGCCGG + Intergenic
1153030173 18:706469-706491 CTGGGAAAAGGCACTGAAGTTGG - Exonic
1153627858 18:7038673-7038695 CTATGCAATGATACTGACGTGGG - Intronic
1154271878 18:12927197-12927219 GTGTGCAAAGGTGCTGGACTTGG + Intronic
1155232050 18:23783494-23783516 CTGAGCAGAGGTCCTGAGGTGGG + Intronic
1155757042 18:29512661-29512683 CGGTGCAAAGGTACTGAGGCAGG + Intergenic
1156525464 18:37763616-37763638 CTCTGCAAAGGTACCTATGTAGG - Intergenic
1156538542 18:37887339-37887361 TTGTGCAAAGGCCCTGCAGTAGG - Intergenic
1156665833 18:39405978-39406000 CAGTGTAATGGTTCTGAAGTAGG - Intergenic
1156866070 18:41890184-41890206 CTGTGGAAATGGACTGGAGTGGG - Intergenic
1159045277 18:63364070-63364092 ATGTGCCAAGGTACTGTGGTTGG - Intronic
1160718429 19:586930-586952 CTGTGCGAGGGTCCTGAGGTGGG - Intergenic
1160728564 19:629977-629999 CTGGGCAAAGATACTGGAGAAGG - Exonic
1160752040 19:738917-738939 CTGTGCAAAGGCCCTGAGGCTGG + Intronic
1161213312 19:3079706-3079728 CTGTGCAAAGGCCCTGGGGTAGG + Intergenic
1161243348 19:3235136-3235158 CCATGCAAAGGTCCTGGAGTAGG - Intronic
1161496716 19:4590624-4590646 CTGTGCAAAGGTCCTGGGGCAGG + Intergenic
1161533842 19:4806587-4806609 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161536360 19:4821477-4821499 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1161621443 19:5299347-5299369 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1161634203 19:5377106-5377128 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161650345 19:5480482-5480504 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161658830 19:5533446-5533468 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161664234 19:5565216-5565238 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1161858151 19:6777601-6777623 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1161873818 19:6891903-6891925 GGGTGCAAAGGTCCTGAGGTTGG + Intronic
1162156370 19:8680860-8680882 CTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1162330589 19:10026845-10026867 AAGTGCAAAGGTATTGAGGTTGG - Intergenic
1162400657 19:10444635-10444657 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1162446233 19:10724570-10724592 CAGTGCAAAGGTCCTGATGTGGG + Intronic
1162466783 19:10846968-10846990 GTGTGCAAAGGCCCTGAGGTTGG + Intronic
1162490517 19:10988581-10988603 CTGTGCAAAGGTCCTGGGGCAGG - Intronic
1162839584 19:13346311-13346333 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1162850983 19:13430954-13430976 CTGTGCAAAGGCCCTGAGGCTGG + Intronic
1162857399 19:13479415-13479437 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1162988615 19:14288039-14288061 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1163105800 19:15122528-15122550 ATGTGCAAAGGTCCTGAGGCAGG - Intronic
1163205838 19:15802133-15802155 ATGTGCAAAGGTCCTGAGGTAGG + Intergenic
1163255746 19:16154770-16154792 TTGTGCAAAGGACCTGAGGTGGG - Intronic
1163484105 19:17576406-17576428 ATGTGCAAAGGCCCTGAGGTAGG + Intronic
1163536234 19:17878186-17878208 CTGTGCAAAGGCCAAGAAGTAGG + Intronic
1163549470 19:17957572-17957594 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
1163568873 19:18068570-18068592 CAGTGCAAAGGTGCAGAGGTGGG - Intronic
1163844508 19:19630641-19630663 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1163844867 19:19632855-19632877 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164223614 19:23221430-23221452 CTCTGCAAAGGTAGTAAATTTGG - Intergenic
1164678106 19:30115871-30115893 ATGTGCAAAGGCCTTGAAGTGGG + Intergenic
1165323888 19:35102868-35102890 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1165476612 19:36034304-36034326 CAGTGCAAAGGTCCTGGGGTAGG - Intergenic
1165764543 19:38342674-38342696 CTGTGCACAGGTGCTGAATCTGG + Intronic
1165807277 19:38588160-38588182 CTGTGCAAAGGATTTGAGGTGGG + Intronic
1165958737 19:39517633-39517655 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1166220292 19:41359954-41359976 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1166879891 19:45922334-45922356 CAGTGCAAAGGCCCTGAGGTTGG + Intergenic
1166886089 19:45961864-45961886 GAGTGCAAAGGCCCTGAAGTGGG + Intronic
1167090337 19:47339715-47339737 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1167408106 19:49327498-49327520 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1167417287 19:49381629-49381651 AAGTGCAAAGGTCCTGAGGTTGG + Intergenic
1167487891 19:49773836-49773858 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1167555547 19:50192989-50193011 CCGTGCAAAGGCCCTGAGGTGGG + Intronic
1167562228 19:50232788-50232810 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1167603774 19:50469219-50469241 CTGTGCAAAGGTGCTAGGGTCGG - Intronic
1167639127 19:50670697-50670719 CTCTGCAAAGGTCCTGAGGTCGG - Intronic
1167654788 19:50756458-50756480 TTGTGCAAAGGTCCTGAGGCAGG - Intergenic
1167687269 19:50964159-50964181 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1168415443 19:56164777-56164799 CTGTGCAAAAGTCCTGTAGTGGG - Intergenic
925196215 2:1928268-1928290 CTGTGCAGAGGAAATGAAGTTGG + Intronic
925227590 2:2199116-2199138 CTTTGGAAAGGTTCAGAAGTGGG + Intronic
926765385 2:16319170-16319192 CTTTGCACAGGTAACGAAGTGGG - Intergenic
926848635 2:17170094-17170116 AAGTGCAAAGGTCCTGAAATAGG - Intergenic
927074519 2:19564535-19564557 CTGGCCAATGGAACTGAAGTGGG - Intergenic
928666240 2:33553182-33553204 GTGAGCAAAGGCACTGAGGTGGG - Intronic
929005923 2:37392647-37392669 CTGTGCAAAGGTCCTGAGGTAGG - Intergenic
929593880 2:43163583-43163605 CTGTGCAGAGTTGTTGAAGTTGG - Intergenic
929607077 2:43241838-43241860 CTGTGAAATGGTACTGAAGAAGG + Intronic
929988934 2:46767903-46767925 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
930816562 2:55604625-55604647 CTAAGCTAAGGTACTGAACTGGG - Intronic
931020066 2:58034303-58034325 ATATGCAAAGGTCCTGAGGTGGG - Intronic
932195512 2:69779864-69779886 CTGAGCAAAGGTACAGAGGTGGG - Intronic
932746054 2:74334384-74334406 AAGTGCAAAGGTCCTGAGGTGGG - Intronic
932962854 2:76435363-76435385 CTCTGCAAATGTTCAGAAGTAGG + Intergenic
933692675 2:85191442-85191464 CTATGCAATGGTATAGAAGTGGG + Intronic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
933992403 2:87643184-87643206 CTGTTCAAAGGTACTCAGGCAGG - Intergenic
935012082 2:99144828-99144850 AAGTGCAAAGGTCCTGAAGCAGG + Intronic
935186089 2:100734201-100734223 CTCTGCAAAGGTACAGAGATAGG - Intergenic
935190080 2:100770429-100770451 CTGAGAAAAGATGCTGAAGTGGG + Intergenic
936301449 2:111307657-111307679 CTGTTCAAAGGTACTCAGGCAGG + Intergenic
936376975 2:111949033-111949055 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
936628542 2:114175024-114175046 TTGTGCAAAGGCTCTGAAGTGGG + Intergenic
937017412 2:118618725-118618747 CTGTGCAAAGGTAAGAAAGGAGG - Intergenic
938113090 2:128582079-128582101 CTGTGCAAGGTTACTGCAGAGGG + Intergenic
939179149 2:138783702-138783724 CTGTGAACAGGAACTGAACTTGG + Intergenic
939914763 2:148025057-148025079 GTTTGCAAAGGTACATAAGTTGG - Intronic
941047708 2:160695349-160695371 CAATGCAAAGGCCCTGAAGTAGG + Intergenic
941858319 2:170252831-170252853 AAGTGCAAAGGTCCTGAGGTGGG + Intronic
942087173 2:172454401-172454423 CTGTGCAAAGGTCCTGAGCCAGG + Intronic
943075113 2:183185439-183185461 GTGTGCTCAGGTACTGGAGTCGG + Intergenic
943290497 2:186065115-186065137 CAGTGCAAAGGTCCTGAGGGAGG + Intergenic
944522762 2:200588253-200588275 AGGTGCAAAGGTCCTGAGGTAGG + Intronic
945639588 2:212406923-212406945 ATGTGCAAAGAGACTGAAGTAGG - Intronic
946041560 2:216787027-216787049 CTGGGCAAAGGCACAGAAGCAGG - Intergenic
946698098 2:222382103-222382125 TAGTGAAAAGGTACTGAATTGGG - Intergenic
946879358 2:224161733-224161755 CTGTGTAAAGCCAGTGAAGTGGG + Intergenic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
947929563 2:233952493-233952515 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
948023662 2:234758302-234758324 CAGTGCAAAGGTACTGAGGCAGG - Intergenic
1168964000 20:1887940-1887962 CCGTGCAAAGGCCCTGAGGTAGG + Intergenic
1169935865 20:10882637-10882659 CTGTGCAAAAATACTGAAATAGG - Intergenic
1170426741 20:16242702-16242724 CAGTGCAAAGGTCCTGGGGTAGG + Intergenic
1170564889 20:17593660-17593682 ATGAGCAAAGGCCCTGAAGTGGG + Intronic
1170723022 20:18900882-18900904 CAGTGCAAGGGCATTGAAGTGGG + Intergenic
1171256112 20:23690192-23690214 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171263462 20:23752102-23752124 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171272515 20:23827874-23827896 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171284058 20:23923422-23923444 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171966818 20:31536725-31536747 AGGTGCAAAGGTCCTGAGGTGGG - Intronic
1172120857 20:32597923-32597945 TTGTGCAAAGGTCCTGGGGTGGG - Intronic
1172811423 20:37650860-37650882 CTGTGCAAAGGCACTAGAGCAGG + Intergenic
1173844797 20:46181389-46181411 GTATGCAAAGGTCCTGAGGTTGG + Intronic
1173984597 20:47251285-47251307 ATGTGCAAATTTACTGCAGTGGG + Intronic
1174189645 20:48731165-48731187 GTGTGCAAAGGCCCTGAGGTAGG - Intronic
1174297671 20:49560711-49560733 AAGTGCAAAGGTACTGGGGTGGG + Intronic
1174302920 20:49595160-49595182 GTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1174390780 20:50217172-50217194 ATATGCAAAGGTTCTGAGGTGGG - Intergenic
1174426131 20:50432721-50432743 AAGTGCAAAGGTCCTGAAGCAGG - Intergenic
1174586031 20:51609075-51609097 CAGTGCAAAGGCACTGAGGCGGG + Intronic
1174670730 20:52305458-52305480 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1174703988 20:52637147-52637169 CTGGGCAAAGGTGTTGAGGTGGG + Intergenic
1174753957 20:53140050-53140072 CTATGCAAAGGTACTGTTCTAGG + Intronic
1175101185 20:56579952-56579974 CCGTGCCAAGGTTCTGAAGCAGG - Intergenic
1175110829 20:56646776-56646798 ATGTGCAAAGGCCCTGAGGTGGG + Intergenic
1175298555 20:57926797-57926819 ATGTGCAAAGATCCTGAGGTTGG + Intergenic
1175388200 20:58610646-58610668 CTGTGCTAAGGTCCTGAGGCGGG - Intergenic
1175464005 20:59177420-59177442 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1175553661 20:59832768-59832790 ATGTGCAAAGGTCCTGAGGTGGG - Intronic
1175603656 20:60295360-60295382 ATGTGCAAAGGTCCTGAGGCAGG + Intergenic
1175743347 20:61436005-61436027 ATGTGCAAAGGTCCTGTGGTGGG - Intronic
1177822795 21:26049908-26049930 CTGTGTTCAGGTACTGAAATGGG + Intronic
1179437964 21:41375034-41375056 ATGTGCAAAGGTCCTGAGGTCGG - Intronic
1180609653 22:17086806-17086828 CTGAGCCAAGGTCCTTAAGTGGG + Intronic
1180765020 22:18341197-18341219 ATGTGCAAAGGACCTGAGGTAGG - Intergenic
1180814009 22:18778487-18778509 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
1181200194 22:21212822-21212844 ATGTGCAAAGGACCTGAGGTAGG + Intronic
1181508155 22:23375673-23375695 CTGTGCAAAGGTTAGGAAGTTGG - Intergenic
1181701543 22:24624137-24624159 ATGTGCAAAGGACCTGAGGTAGG - Intronic
1181928128 22:26376809-26376831 ATGTGCAAAGGTCCTGAGGCAGG + Intronic
1181970204 22:26684120-26684142 AGGGGCAAAGGTACTGAGGTGGG + Intergenic
1182062011 22:27405128-27405150 CTGCGCAAAGGTCCTGTAGTAGG - Intergenic
1182404894 22:30118298-30118320 CAATGCAAAGGCTCTGAAGTGGG - Intronic
1182983891 22:34698540-34698562 ATGTGCAAAGGTCCTGTGGTGGG - Intergenic
1183086035 22:35487812-35487834 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1184263249 22:43331913-43331935 GTGTGCAAAGGTCCAGAGGTAGG + Intronic
1184346689 22:43917954-43917976 CTGAGCAAAGCTGCTAAAGTGGG + Intergenic
1184421761 22:44386309-44386331 ATGTGCAAAGGCCCTGGAGTGGG - Intergenic
1203226643 22_KI270731v1_random:82102-82124 ATGTGCAAAGGACCTGAGGTAGG - Intergenic
1203264108 22_KI270734v1_random:4174-4196 ATGTGCAAAGGACCTGAGGTAGG + Intergenic
949337134 3:2987132-2987154 AAGTGCAAAGGCCCTGAAGTGGG + Intronic
949991243 3:9581004-9581026 CTGTCCAACAGTACTGTAGTTGG + Intergenic
950205320 3:11075786-11075808 ATGTGCAAAGGCACAGAGGTGGG - Intergenic
950774267 3:15336212-15336234 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
951188940 3:19746995-19747017 ATGTACAAAGGTCCTGAGGTGGG + Intergenic
951678441 3:25268640-25268662 CAGTGCAAAGGTGCTGAGGCAGG - Intronic
952145666 3:30529300-30529322 ATGTGCAAAGGCACTGAAGTGGG - Intergenic
952240823 3:31530225-31530247 ACGTGCAAAGGCACTGCAGTGGG - Intergenic
953447047 3:42977268-42977290 AAGTGCAAAGGTCCTGAGGTGGG + Intronic
953691145 3:45120763-45120785 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
954289406 3:49641880-49641902 ATGTGCAAATGGCCTGAAGTGGG + Intronic
954652680 3:52174988-52175010 CTGTGCAAAGGCCCTGAGGAGGG - Intergenic
956030313 3:65030202-65030224 CTGTGCAAAGGCCCTGTGGTAGG + Intergenic
956376293 3:68616844-68616866 CAGTGCAAAGTTCCTGAATTGGG + Intergenic
956444114 3:69308786-69308808 CAGTGCAAAAGTCCTGAGGTGGG - Intronic
956840539 3:73135819-73135841 CTGTGGAAAGGGAATGTAGTGGG + Intergenic
956870767 3:73415284-73415306 ATGTGCAAAGGTCCTGTGGTAGG + Intronic
958255659 3:91321817-91321839 AAGTGCAAAGGTCCTGAAGTGGG - Intergenic
959631068 3:108507561-108507583 GTGTACAAAGGAGCTGAAGTTGG + Intronic
959983035 3:112539401-112539423 GAGTGCAAAGGTACTGAGGTGGG - Intronic
960250040 3:115441569-115441591 CTGTGCAAAAGCCCTGCAGTGGG - Intergenic
960298896 3:115977523-115977545 CTGAGCAAAGGAATTGAATTGGG - Intronic
960622579 3:119651187-119651209 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
960700390 3:120433796-120433818 AAGTGCAAAGGTTCTGAAGCAGG + Intronic
961370371 3:126424912-126424934 AGGTGCAAAGGCACTGAGGTGGG + Intronic
961552331 3:127676559-127676581 CTGTGTACAGGTACTGCAGCAGG - Exonic
961801917 3:129457464-129457486 ATGTGCAAAGGCCCTGAAGCAGG - Intronic
962076760 3:132090324-132090346 TGGTGCAAAGGTCCTGAGGTGGG - Intronic
962238772 3:133732514-133732536 CTGTGAAAAGGAACCGGAGTGGG - Intergenic
962263416 3:133928882-133928904 GTGTGCAAAGGTAAGGAAGCAGG - Exonic
962302372 3:134253658-134253680 CAGTGCAAAGGCCCTGAGGTAGG - Intergenic
962408900 3:135124158-135124180 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
962476832 3:135762456-135762478 CTGTGCCAAGATATTGAAGAGGG + Intergenic
962647083 3:137451038-137451060 ATGTGCAAAGGTCCTGAGGTGGG + Intergenic
962835699 3:139186491-139186513 ATGTGCAGATGTACTGATGTGGG + Intronic
963225169 3:142855023-142855045 CTGTGCAAAGGCCCTTAGGTGGG - Intronic
963645680 3:147911266-147911288 ATGTGCAAAGGTCCTGAGGTGGG - Intergenic
963796888 3:149639691-149639713 CTTTGAAAAAGTACAGAAGTTGG + Intronic
964093969 3:152910216-152910238 CAGTGCAAATGGACTGAGGTGGG - Intergenic
964849271 3:161077416-161077438 CTGTGCAAGGGTGCAGCAGTAGG + Exonic
965083427 3:164064780-164064802 CTGTGCTAAGGCAGTGAAGAAGG + Intergenic
965412284 3:168347012-168347034 GTGTGCAAAGACACTGAGGTAGG + Intergenic
965859123 3:173125559-173125581 CAGTGCAAAGGTTCTGAGTTGGG - Intronic
965899123 3:173617055-173617077 ATGTGCAAGGGTCCTGAGGTAGG - Intronic
968016385 3:195337974-195337996 CAGTGCAAAGGCATTGAGGTGGG - Intronic
969454043 4:7291096-7291118 ATGTGCAAAGGTCCTGAGGTGGG + Intronic
969838454 4:9862614-9862636 ATGTGCAAAGGTCCTGAGGCAGG - Intronic
970087010 4:12360691-12360713 ATTTGCAAATGTACTGTAGTAGG + Intergenic
970289254 4:14553533-14553555 ATGTGCAAAGGTCCTGTGGTTGG - Intergenic
970369647 4:15394140-15394162 CCATGCAAAGGCCCTGAAGTGGG + Intronic
972557557 4:40195992-40196014 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
972633243 4:40859845-40859867 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
973161375 4:47020949-47020971 AAGTGCAAAGATACTGAAGTAGG - Intronic
973609594 4:52622832-52622854 ATGTGCAAAGGACCTGAAGCAGG + Intronic
974015903 4:56648951-56648973 ATGTGCAAAGGTCCTGAGGCAGG - Intronic
974207497 4:58724761-58724783 CTGTGGAACGGCACTCAAGTGGG - Intergenic
974433280 4:61826287-61826309 GTGTTCAAAGGCCCTGAAGTAGG + Intronic
975594172 4:76032033-76032055 ATGTGCAAAGGTACCAAGGTGGG + Intronic
976149201 4:82076580-82076602 CTCTGCAAATGTACTGGAGAAGG + Intergenic
976269197 4:83213787-83213809 ATGTGCAAAGGTCCTGAGGTGGG + Intergenic
976512274 4:85925059-85925081 CTCTGCTAAGGTACTGGAGTGGG - Intronic
976771095 4:88653436-88653458 GTGTGCAAAGGTGCTCATGTGGG + Intronic
976809209 4:89082391-89082413 ATGAACAAAGGTTCTGAAGTGGG - Intronic
976825561 4:89256629-89256651 CAGTGCAGTGGTTCTGAAGTGGG - Intronic
977165600 4:93692340-93692362 AAGTGCAAAAGTACTGAGGTGGG + Intronic
977294797 4:95198613-95198635 CTGTGCAAAGGAACTGAAGTGGG + Intronic
979496287 4:121386601-121386623 CTCTCCAAAGGCACAGAAGTAGG + Intergenic
979505580 4:121491905-121491927 CTGTAGAAAGATACTGAATTAGG - Intergenic
979828625 4:125272029-125272051 AAGTGCAAAGGTCCTGCAGTTGG - Intergenic
980962490 4:139489816-139489838 ATGTGCAAAGGTCCTGAGGCAGG + Intergenic
981673217 4:147311353-147311375 ATGTGCAAAGGTCCTGAGGCAGG - Intergenic
982091225 4:151881594-151881616 CAGTGCAAAGGCCCTGAGGTAGG + Intergenic
982238415 4:153273907-153273929 ATGTGCAAAGGTGCTATAGTGGG + Intronic
982445786 4:155489405-155489427 CAGTGCAAAGGCCCTGAAGTGGG + Intergenic
983713961 4:170754631-170754653 CTTTGCTAAGGTAGTGAAGAAGG + Intergenic
985937612 5:3108770-3108792 CAGTGCAAAGGTCCTGGGGTGGG - Intergenic
986351650 5:6885661-6885683 CTGTGCAAAGGCCCTGATGGGGG + Intergenic
987783875 5:22473104-22473126 CAGTGCAAAGGCACAGATGTGGG - Intronic
989397748 5:40976629-40976651 CTGTGCAAATGCATTGCAGTTGG + Intronic
990155921 5:52877348-52877370 CTGAGCTAAGGTAATGAGGTAGG + Intronic
990275541 5:54192081-54192103 AAGTGCAAAGGTCCTGAAGTTGG - Intronic
990598447 5:57333752-57333774 CTATGCAAAGGGACTGAGGAGGG + Intergenic
990599653 5:57344881-57344903 ATGTGCAAAGGCCCTGAAGCAGG - Intergenic
991212382 5:64120659-64120681 CTGTGCAAAGGTCCTGTGCTGGG - Intergenic
991655156 5:68896616-68896638 ATGTGCAAAGGTCCTGAGGCGGG - Intergenic
991915016 5:71597180-71597202 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
992388649 5:76310401-76310423 AGGTGCAAAGGTCCTGAGGTGGG + Intronic
993150808 5:84160120-84160142 CAGTACAAAGGTTCTGAAGAAGG - Intronic
993744410 5:91578792-91578814 ATGTGCTAAGATACTGAATTTGG + Intergenic
994676896 5:102834687-102834709 AAGTGCAAAGATGCTGAAGTAGG + Intronic
994739773 5:103603370-103603392 CAGTTCAAAGGTCCTGATGTGGG - Intergenic
995112689 5:108445295-108445317 ATGGGCAAAGGCCCTGAAGTAGG + Intergenic
996087777 5:119322004-119322026 GTGTGCAAAGGCTCTGAAGTAGG - Intronic
998389017 5:141774957-141774979 AAGTGCAAAGGTTCTGAGGTGGG - Intergenic
998391792 5:141791809-141791831 CAGTGCAAAGGCTCTGAGGTGGG + Intergenic
998879593 5:146632810-146632832 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
999294863 5:150452885-150452907 ATATGCAAAGGCCCTGAAGTGGG + Intergenic
999483019 5:151966237-151966259 ATGTGCAAAGGTCCTGAGGAAGG + Intergenic
999695821 5:154188350-154188372 AGGTGCAAAGGTACTGAGGCAGG + Intronic
999988948 5:157031963-157031985 GAGTGCAAAGGCACTGAGGTAGG - Intronic
1000168954 5:158682729-158682751 ATGTACGAAGGTCCTGAAGTGGG + Intergenic
1001288020 5:170437819-170437841 CTGTGCAAAGGCCCAGAGGTAGG - Intronic
1001956040 5:175848847-175848869 ATGTGCAAAGGTCCTGAGGCAGG + Intronic
1001995545 5:176154571-176154593 CTGTGCAAGGTTCCTGAAGATGG - Intergenic
1002068714 5:176665696-176665718 CAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1002137730 5:177118265-177118287 CTTCACAAAGATACTGAAGTAGG - Intergenic
1002207049 5:177570091-177570113 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1004827272 6:19436654-19436676 AAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1006397731 6:33797983-33798005 CAGTGCCAAGGTCCTGAAGCAGG - Intronic
1006451186 6:34106615-34106637 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1007416068 6:41691940-41691962 AAGTGCAAAGGTCCTGAGGTGGG - Intronic
1007591583 6:43024287-43024309 ATGTGCAGAGGAACTGAGGTGGG + Intronic
1008278142 6:49564680-49564702 CTATGAAAAAGTACTGAAGGAGG - Intergenic
1008808065 6:55455877-55455899 CTATGAATACGTACTGAAGTTGG + Intronic
1008999689 6:57699349-57699371 AAGTGCAAAGGTCCTGAAGTGGG + Intergenic
1009188172 6:60598771-60598793 AAGTGCAAAGGTCCTGAAGTGGG + Intergenic
1010643274 6:78356699-78356721 ATATGCAAAGGTACTGAGGTTGG + Intergenic
1011131145 6:84052845-84052867 ATGTGCAAAAGTCCTGAAGGTGG - Intronic
1012163243 6:95915041-95915063 ATGAGCAAAGGTTTTGAAGTAGG - Intergenic
1012828624 6:104179222-104179244 AAATGCAAAGGTACTGAAGTAGG - Intergenic
1013787783 6:113801068-113801090 CTGTGCTAGGGTACTAAAGCTGG + Intergenic
1014051086 6:116955147-116955169 CTTTGCATAGCTACTGCAGTAGG + Intergenic
1015209948 6:130685676-130685698 TTGTGCAAAGGTCCTGGGGTAGG + Intergenic
1015932584 6:138376164-138376186 CAGTGCAAAGGCCCTGAAGCAGG - Intergenic
1016302284 6:142645871-142645893 ATGTGCAAAGGTCCTGTGGTGGG + Intergenic
1016869617 6:148803823-148803845 ATGTGCAAAGGTCCTGCAGCAGG - Intronic
1019651156 7:2159323-2159345 CTGTGCAGAGGACCTGAGGTGGG - Intronic
1019714222 7:2530915-2530937 CTGGGCAAAGGTGCAGAGGTGGG + Intergenic
1019949907 7:4362960-4362982 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1023391528 7:39715741-39715763 ATGTGCAAAGGCTCTGAATTGGG - Intergenic
1024005494 7:45222437-45222459 CTGTGCAAAGGCCCTGGGGTTGG - Intergenic
1024583212 7:50817752-50817774 CTGTGCAAAGACACTGGACTTGG - Intergenic
1025826334 7:65013863-65013885 ATGTGCAAAGGTCCTGAAGAGGG - Intergenic
1025913892 7:65850328-65850350 ATGTGCAAAGGTCCTGAAGAGGG - Intergenic
1025975672 7:66367720-66367742 ATGTGCAAAGGTCTTGAAGAGGG + Intronic
1028686368 7:93592794-93592816 ATGAGCAAAGGCACAGAAGTAGG - Intronic
1029153406 7:98497894-98497916 CCGTGCAAAGGTCCTGAGGCAGG - Intergenic
1029238142 7:99140714-99140736 CAGTGCAAAGATAGTGAAGATGG - Intronic
1029572509 7:101379510-101379532 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1029666975 7:102001882-102001904 TTCCGCAAAGGTACTGAAATTGG + Intronic
1029880133 7:103799504-103799526 ATGTGCAAATGTTCTGAGGTAGG - Intronic
1030171300 7:106605598-106605620 CTGTGCAAAGGTAAAGGAGTGGG + Intergenic
1032474517 7:132203007-132203029 CTGAGCAGAGGGACTGAAATGGG + Intronic
1033473986 7:141673088-141673110 CTCTGCAAAGGCAATGAAGTGGG + Intronic
1038113429 8:24525481-24525503 TTGTGCAAAGATAATGAGGTAGG + Intronic
1038190476 8:25315247-25315269 CTGTGCAAAGGCCCAGAGGTAGG - Intronic
1038416673 8:27401577-27401599 ATGTGTAAAAGTCCTGAAGTGGG + Intronic
1038898108 8:31810525-31810547 CTGTGCAAAGGCCCTGAGGTGGG - Intronic
1039119109 8:34126048-34126070 AAGTGCAAAGGCACTGAGGTAGG - Intergenic
1039157848 8:34582039-34582061 CTGTCCAAAGGTAAAGAATTGGG + Intergenic
1039483441 8:37892848-37892870 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1039719478 8:40147178-40147200 CTGTGCAAAGGCCCTGTGGTAGG - Intergenic
1041559348 8:59197144-59197166 ATGTGCAAAGGCCCTGGAGTGGG - Intergenic
1041784010 8:61611198-61611220 CTGTTGCAAGGTGCTGAAGTTGG - Intronic
1041979846 8:63844980-63845002 ATGTGCAAAGGTCCTGCATTGGG - Intergenic
1042788569 8:72577805-72577827 CTGTGCAAATATCCTGAGGTTGG - Intronic
1044387889 8:91611693-91611715 TTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1044580751 8:93823638-93823660 ATGTGCAAAGGCCCTGATGTGGG + Intergenic
1044870328 8:96613842-96613864 CTGTGAAAAGATTCTGAAGAGGG + Intergenic
1045036579 8:98180881-98180903 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1046044544 8:108948169-108948191 ATGTGCAAAGATGCTGAAGAAGG + Intergenic
1046851119 8:118973983-118974005 CAGTGCAAAAGTCCTGAAATGGG - Intergenic
1046913394 8:119653525-119653547 AGGTGCAAAGGCCCTGAAGTAGG + Intronic
1047074349 8:121383022-121383044 CTGCACAAAGGCACAGAAGTAGG - Intergenic
1047566184 8:126046770-126046792 CTGTGCAAAGATTCTGGGGTGGG - Intergenic
1048488579 8:134870960-134870982 TTGTGCAAAGGTGCTGAGGTGGG + Intergenic
1051476630 9:17516042-17516064 CAGTGCAAAGGTACTGAGTTGGG - Intergenic
1051872586 9:21755888-21755910 ATGTGCAAAGGCACGTAAGTGGG - Intergenic
1051926627 9:22335393-22335415 CTGTGCAAAGGTTCAGAAGAAGG + Intergenic
1053202230 9:36160586-36160608 ATGTGCAAGGGTTCTGAGGTGGG + Intronic
1053416880 9:37952361-37952383 AAGTGCAAAGGTCCTGAGGTAGG + Intronic
1055069907 9:72155506-72155528 CTGTGCAAAGGTCCTGGGGTAGG + Intronic
1055270050 9:74547646-74547668 CTGTGCAAAGGCCCTGAGGTAGG + Intronic
1055488589 9:76781426-76781448 CAGTGCAAAGGCTCTGAAGTGGG - Intronic
1055493320 9:76828252-76828274 CTGTGCAAAGGCACTGAGGTGGG + Intronic
1055921860 9:81469285-81469307 CTGTGCAAAGGTTCTGAAATAGG + Intergenic
1057686538 9:97239643-97239665 CAGTGCAGAGATCCTGAAGTAGG + Intergenic
1057959857 9:99444734-99444756 ATGTGCAAAGGTTCTGAAATGGG - Intergenic
1058957548 9:109963179-109963201 CTGAGCAAAGGGCCTGAAATAGG + Intronic
1059286100 9:113172928-113172950 CTGGGCAAAGGCACTGAGATAGG - Intronic
1059408411 9:114116675-114116697 ATGTGCAAAGGTCCTGAGTTAGG - Intergenic
1059510394 9:114839716-114839738 CTCTGCAAAAGTACTCCAGTGGG - Intergenic
1060035568 9:120252724-120252746 TTGTGCAAAGGTCCTGAGGTAGG + Intergenic
1060044122 9:120326478-120326500 TTGTGCAAAGGTCCTGAGGCAGG - Intergenic
1060124826 9:121033501-121033523 ATGTGCAAAGGCACGGAGGTAGG + Intronic
1060758557 9:126229792-126229814 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1060765434 9:126292174-126292196 CTGTGCAAAGGCCCTGAGGCTGG - Intergenic
1060857460 9:126926444-126926466 TTGTACAAAGGTACAGAAGCAGG + Intronic
1060898586 9:127237504-127237526 CAGTGGAAGGGGACTGAAGTGGG + Intronic
1061191060 9:129083028-129083050 GTGTGCAAAGGTCCAGAAGTAGG + Intronic
1062393829 9:136344722-136344744 CTGTGCAAAGGGCCTGAGGCAGG + Intronic
1186363793 X:8870957-8870979 ATGTGCAAAGATACTGGAGAGGG + Intergenic
1186416234 X:9385182-9385204 CTGTGGAACGGGACTGAAGCAGG + Intergenic
1186890120 X:13951403-13951425 ATGTGCAAAGGTCCTGCATTTGG - Intergenic
1187056160 X:15743149-15743171 CTGGGCAAAGATCCTGAAGTGGG - Intronic
1187789789 X:22937715-22937737 ATGTGTAAAGGTCCTGAAGCAGG - Intergenic
1188589608 X:31817850-31817872 CTGAGCAACGATACTGAAGTAGG - Intronic
1188737571 X:33737816-33737838 AAGTGCAAAAGTTCTGAAGTCGG - Intergenic
1189088390 X:38051100-38051122 ATGTTCAAAGGCCCTGAAGTGGG + Intronic
1189200405 X:39190684-39190706 CAGTGCAAAGGCCATGAAGTAGG - Intergenic
1189624855 X:42886034-42886056 ATTTGCAAAGGTTCTGAAGCAGG + Intergenic
1189709415 X:43794222-43794244 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1190060069 X:47205157-47205179 CTGCGCAAAGATCCTGAGGTGGG + Intronic
1190216083 X:48480338-48480360 CCGTGCAAAGGTCCTGAGGCAGG + Intronic
1190336805 X:49267519-49267541 CAGGGCAAAGGTCCTGAGGTGGG + Intergenic
1191718604 X:64210313-64210335 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1192558898 X:72112110-72112132 CAGTTCAAAGGTCTTGAAGTAGG + Intergenic
1192626233 X:72731447-72731469 CTGAGCAAAGGTAATCAAGGTGG + Intergenic
1194765089 X:97840348-97840370 CTATTCAAAGGTACTGAAATAGG + Intergenic
1195005009 X:100677217-100677239 AATTGCAAAGGTTCTGAAGTGGG + Intronic
1195304154 X:103562652-103562674 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1196992149 X:121341842-121341864 GTGTGAAAAGGTCCAGAAGTGGG + Intergenic
1198110770 X:133501011-133501033 CTGTGAATAAGCACTGAAGTGGG - Intergenic
1198425568 X:136516378-136516400 ATGTGCAAAGGTCCTGAGGTAGG - Intergenic
1199855952 X:151758960-151758982 CTGAGCAAAGGTGCTGGACTTGG + Intergenic
1200046641 X:153406483-153406505 ATGTGCAAAGGTCCTGGAGCTGG + Intergenic