ID: 1101693773

View in Genome Browser
Species Human (GRCh38)
Location 12:107105729-107105751
Sequence TGCCATGCCCCTAGTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101693772_1101693773 24 Left 1101693772 12:107105682-107105704 CCTGATGTTGAGAAAATTTATTT No data
Right 1101693773 12:107105729-107105751 TGCCATGCCCCTAGTCTGCCAGG No data
1101693771_1101693773 30 Left 1101693771 12:107105676-107105698 CCAAATCCTGATGTTGAGAAAAT No data
Right 1101693773 12:107105729-107105751 TGCCATGCCCCTAGTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101693773 Original CRISPR TGCCATGCCCCTAGTCTGCC AGG Intergenic
No off target data available for this crispr