ID: 1101696605

View in Genome Browser
Species Human (GRCh38)
Location 12:107133028-107133050
Sequence AGTTATAAATCTGAGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101696605_1101696610 10 Left 1101696605 12:107133028-107133050 CCCCAACACTCAGATTTATAACT No data
Right 1101696610 12:107133061-107133083 GTTGTCTAGTCCCTTTAGTATGG No data
1101696605_1101696613 27 Left 1101696605 12:107133028-107133050 CCCCAACACTCAGATTTATAACT No data
Right 1101696613 12:107133078-107133100 GTATGGATTCCCTGTGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101696605 Original CRISPR AGTTATAAATCTGAGTGTTG GGG (reversed) Intergenic
No off target data available for this crispr