ID: 1101701672

View in Genome Browser
Species Human (GRCh38)
Location 12:107179649-107179671
Sequence CAGGGTCCTCTGTGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101701672_1101701683 16 Left 1101701672 12:107179649-107179671 CCAGCATCCCACAGAGGACCCTG No data
Right 1101701683 12:107179688-107179710 AGAGCTAAGCTGGGCCATGGAGG No data
1101701672_1101701682 13 Left 1101701672 12:107179649-107179671 CCAGCATCCCACAGAGGACCCTG No data
Right 1101701682 12:107179685-107179707 CTGAGAGCTAAGCTGGGCCATGG No data
1101701672_1101701679 6 Left 1101701672 12:107179649-107179671 CCAGCATCCCACAGAGGACCCTG No data
Right 1101701679 12:107179678-107179700 TTCTGTCCTGAGAGCTAAGCTGG No data
1101701672_1101701680 7 Left 1101701672 12:107179649-107179671 CCAGCATCCCACAGAGGACCCTG No data
Right 1101701680 12:107179679-107179701 TCTGTCCTGAGAGCTAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101701672 Original CRISPR CAGGGTCCTCTGTGGGATGC TGG (reversed) Intergenic
No off target data available for this crispr