ID: 1101705208

View in Genome Browser
Species Human (GRCh38)
Location 12:107214982-107215004
Sequence GGGTGCCCAAAATTTAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101705208_1101705211 -7 Left 1101705208 12:107214982-107215004 CCCAAATTAAATTTTGGGCACCC No data
Right 1101705211 12:107214998-107215020 GGCACCCCCTGAGGAACCTGTGG No data
1101705208_1101705217 8 Left 1101705208 12:107214982-107215004 CCCAAATTAAATTTTGGGCACCC No data
Right 1101705217 12:107215013-107215035 ACCTGTGGGACTGTCAGCTCAGG No data
1101705208_1101705219 18 Left 1101705208 12:107214982-107215004 CCCAAATTAAATTTTGGGCACCC No data
Right 1101705219 12:107215023-107215045 CTGTCAGCTCAGGAGTCCCAAGG No data
1101705208_1101705212 -6 Left 1101705208 12:107214982-107215004 CCCAAATTAAATTTTGGGCACCC No data
Right 1101705212 12:107214999-107215021 GCACCCCCTGAGGAACCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101705208 Original CRISPR GGGTGCCCAAAATTTAATTT GGG (reversed) Intergenic
No off target data available for this crispr