ID: 1101705971

View in Genome Browser
Species Human (GRCh38)
Location 12:107221610-107221632
Sequence GATTTGGGAGGCGGGCGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101705961_1101705971 -2 Left 1101705961 12:107221589-107221611 CCAGGCGCCGTGGGGGTTGGGGA No data
Right 1101705971 12:107221610-107221632 GATTTGGGAGGCGGGCGGCGGGG No data
1101705964_1101705971 -9 Left 1101705964 12:107221596-107221618 CCGTGGGGGTTGGGGATTTGGGA No data
Right 1101705971 12:107221610-107221632 GATTTGGGAGGCGGGCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101705971 Original CRISPR GATTTGGGAGGCGGGCGGCG GGG Intergenic
No off target data available for this crispr