ID: 1101709174

View in Genome Browser
Species Human (GRCh38)
Location 12:107248980-107249002
Sequence AAGAGTGGTAAAGGCTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101709174_1101709179 -8 Left 1101709174 12:107248980-107249002 CCCTCCAAGCCTTTACCACTCTT No data
Right 1101709179 12:107248995-107249017 CCACTCTTCTACTGTCATCATGG No data
1101709174_1101709180 14 Left 1101709174 12:107248980-107249002 CCCTCCAAGCCTTTACCACTCTT No data
Right 1101709180 12:107249017-107249039 GTTCATGCCATGATCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101709174 Original CRISPR AAGAGTGGTAAAGGCTTGGA GGG (reversed) Intergenic
No off target data available for this crispr