ID: 1101710983

View in Genome Browser
Species Human (GRCh38)
Location 12:107265994-107266016
Sequence GTCTGTATTCTGCAGTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101710983_1101710986 24 Left 1101710983 12:107265994-107266016 CCTGACAACTGCAGAATACAGAC No data
Right 1101710986 12:107266041-107266063 TACCAAAATTGACCATGTACTGG No data
1101710983_1101710987 25 Left 1101710983 12:107265994-107266016 CCTGACAACTGCAGAATACAGAC No data
Right 1101710987 12:107266042-107266064 ACCAAAATTGACCATGTACTGGG No data
1101710983_1101710984 -4 Left 1101710983 12:107265994-107266016 CCTGACAACTGCAGAATACAGAC No data
Right 1101710984 12:107266013-107266035 AGACTGTTTCCAAGTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101710983 Original CRISPR GTCTGTATTCTGCAGTTGTC AGG (reversed) Intergenic
No off target data available for this crispr