ID: 1101717307

View in Genome Browser
Species Human (GRCh38)
Location 12:107321705-107321727
Sequence GGGGATTCACCTGCAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101717307 Original CRISPR GGGGATTCACCTGCAAAACC TGG Intronic
908767207 1:67564906-67564928 GGTGCTTTTCCTGCAAAACCAGG - Intergenic
909693469 1:78436903-78436925 GGAGATTCACAAGCAAAGCCTGG + Intronic
916654659 1:166863873-166863895 GGGGGTTCCGCAGCAAAACCTGG - Exonic
918084255 1:181231751-181231773 GGGGTTTCACCATCAAAACCAGG - Intergenic
920243896 1:204573694-204573716 GGGAAATCACATGCAGAACCTGG - Intergenic
920746639 1:208635302-208635324 GGTGATACACCTGCAAGCCCAGG + Intergenic
921963259 1:221058719-221058741 GGGGAATTACCTTCAAAATCAGG + Intergenic
924626341 1:245699072-245699094 GTGGGTTCACCTGCTCAACCGGG + Intronic
1066417263 10:35232919-35232941 GGGGATTCAGTTCCAACACCTGG - Intergenic
1069591301 10:69644001-69644023 GGGGCTTCACCTGCAGAAAATGG + Intergenic
1071605263 10:86981469-86981491 GGGTAATCACCTGCAGCACCTGG - Intronic
1074679940 10:115895297-115895319 GGGGATACAGCTGAATAACCTGG + Intronic
1075969778 10:126642614-126642636 GAGGATGGAGCTGCAAAACCAGG - Intronic
1076520233 10:131076607-131076629 TGGGATTGATCTGCAGAACCAGG + Intergenic
1078822632 11:14897371-14897393 GGGCATTGACCTGTAAAACCAGG - Intergenic
1080805856 11:35652896-35652918 GAAGATGCACCTGCAAAACAGGG - Intergenic
1083316495 11:61817607-61817629 GGTGTTTCACCTGAAAAGCCTGG + Intronic
1084696097 11:70756431-70756453 GGGGCTTCACCTGCTAACCTGGG - Intronic
1090363937 11:126190902-126190924 GGGCATGCACCTGGAAAGCCAGG - Intergenic
1091729067 12:2866383-2866405 GGGCATTCACCTTAAACACCTGG + Exonic
1094303719 12:28994762-28994784 GGAGCTTCAGTTGCAAAACCTGG + Intergenic
1094748204 12:33371562-33371584 TTGGATTCACCTGCAAAATATGG - Intergenic
1101173212 12:102120791-102120813 GTTTCTTCACCTGCAAAACCAGG - Intronic
1101519098 12:105465174-105465196 TGGGATTCTCCTAGAAAACCTGG - Intergenic
1101717307 12:107321705-107321727 GGGGATTCACCTGCAAAACCTGG + Intronic
1102558392 12:113744465-113744487 GAGGTTTCACCTGCAAAATGGGG + Intergenic
1107276758 13:38687626-38687648 CGGGCTGCACCTGCAACACCAGG - Exonic
1110396409 13:75034513-75034535 GGGTATTGCCCTCCAAAACCTGG + Intergenic
1111274146 13:85925948-85925970 GGAAATTCACCTGCAGTACCTGG + Intergenic
1113600382 13:111564031-111564053 GGGAATTCACCTGCATCCCCCGG - Intergenic
1113929580 13:113959428-113959450 GGGGAAGCACCTGCTCAACCTGG - Intergenic
1114449959 14:22818896-22818918 GGGGTTTCTCATGTAAAACCTGG - Intronic
1115398970 14:32938089-32938111 GGGGATTCACCTGTGAACCCTGG + Intronic
1121301903 14:92878372-92878394 CGGGCTTCACCTGCTGAACCTGG + Intergenic
1122980390 14:105189371-105189393 GGGTATTCACATGCAAAAGGAGG + Intergenic
1129353195 15:74969599-74969621 GGGAATTCACCTGGAAATGCAGG + Intronic
1132353369 15:101154387-101154409 GGGGAAACAACTGCTAAACCCGG - Intergenic
1132398484 15:101490375-101490397 GGGGGTTCACCTGCACGGCCTGG - Intronic
1132398498 15:101490417-101490439 GGGGGTTCACCTGCACGGCCTGG - Intronic
1133492229 16:6281425-6281447 AGGGATTCACCAGCAAAACGTGG - Intronic
1134099868 16:11444457-11444479 AGGGCTTCACTTGCAAAAACAGG - Intronic
1139191898 16:64873873-64873895 GGTCACTCACCTGGAAAACCAGG - Intergenic
1141974664 16:87507608-87507630 GGGGATTCATCTGGCAGACCTGG - Intergenic
1141990584 16:87607126-87607148 GGGCATTCACCTGCAATTCTGGG - Intronic
1142339025 16:89508588-89508610 GGGGATTTACCTGCAGAGCTCGG - Exonic
1146176566 17:30669132-30669154 AGGGCTTCAAATGCAAAACCGGG - Intergenic
1146350028 17:32085247-32085269 AGGGCTTCAAATGCAAAACCGGG - Intergenic
1146890894 17:36505909-36505931 GAGGAGGCACCTGGAAAACCAGG - Intronic
1147170923 17:38618362-38618384 GGGGATTCACCTGGAAAGGCTGG + Intergenic
1151181979 17:72335965-72335987 GGAGAGTCTCCTGCAAACCCTGG + Intergenic
1152292090 17:79445792-79445814 GGGGACTGTCCTGCAAACCCCGG - Intronic
1157618479 18:49001814-49001836 GGTGTTTCACCTGCAAAATGGGG + Intergenic
1158076151 18:53532045-53532067 GGCGATTCAGCTGCATAAACAGG - Exonic
1162232184 19:9276693-9276715 GTGAATTCACCTGCAAAATTAGG + Intergenic
1162911643 19:13850932-13850954 GGAGATTCACGTGCAGAATCTGG - Intergenic
1167906479 19:52664858-52664880 TGGGTTTCGCCTTCAAAACCTGG - Intronic
924980848 2:219712-219734 GGAGATTCAACTTTAAAACCTGG + Intronic
933671426 2:85011182-85011204 GGGGTTTCACCAGCCAAACCTGG - Intronic
936762788 2:115805944-115805966 GGGTTCTCACCTGCAAAAACGGG - Intronic
943631493 2:190257820-190257842 GGGAACTAACCTGCAAAAACTGG + Intronic
946387210 2:219391158-219391180 GTGGATTACCCTGCAAACCCAGG - Intronic
1170760236 20:19242293-19242315 GGTGAAACACCTACAAAACCTGG - Intronic
1176446306 21:6824389-6824411 GTGGATTCACATGGAAAAGCTGG + Intergenic
1176824475 21:13689419-13689441 GTGGATTCACATGGAAAAGCTGG + Intergenic
1178046753 21:28703405-28703427 TGGCCTTAACCTGCAAAACCAGG - Intergenic
1178172115 21:30052876-30052898 GGGGGATGACCTGCAAAAACAGG + Intergenic
1181323385 22:22025796-22025818 GGGGTTTCAACTGGGAAACCAGG + Intergenic
1182159139 22:28104330-28104352 GGTGATTCAACTGCAAAAATGGG + Intronic
1182736307 22:32533963-32533985 GTGGATTCACATGGAAAAACAGG + Intronic
1183532933 22:38373955-38373977 GGGGATGCAGCTGCTCAACCAGG + Intronic
1184669531 22:46005524-46005546 CGGGCTTCACCTGCAAGCCCAGG - Intergenic
950705254 3:14775450-14775472 GGGGGTTCACCTGCAGATCAAGG - Intergenic
954994377 3:54867989-54868011 GGTGATTAACCTGGAAAACATGG + Intronic
956152367 3:66257399-66257421 GGGAATTCACTTGCAGAACTGGG + Intronic
961027453 3:123571510-123571532 GGGGAGTCACGTGCAAGGCCTGG + Intronic
961648873 3:128407626-128407648 GGGGCTTCCACTGCTAAACCTGG + Intronic
963079687 3:141379331-141379353 GGGGACTCCTCTGCAGAACCTGG - Intronic
965214525 3:165844950-165844972 GGGGTCTCACCTTCAAAACCAGG + Intergenic
967022834 3:185537644-185537666 GGGGAGTCAGTTGCACAACCAGG - Intronic
967269790 3:187724078-187724100 GGAGGTTAACCTGCAAAACATGG - Intronic
972378137 4:38492589-38492611 GGTGATTCTCCTGCACACCCAGG - Intergenic
978369717 4:108018086-108018108 GGCCATTCACCTGCAAAAAGGGG - Intronic
978599273 4:110411176-110411198 ACGGATTCACCTGGAAAATCGGG - Intronic
978719797 4:111895050-111895072 ACGGATTCACCTGGAAAATCGGG + Intergenic
981663309 4:147192861-147192883 GAGCAGTCAACTGCAAAACCAGG + Intergenic
997719155 5:136064302-136064324 GGGGATGGGCCTGGAAAACCTGG - Intergenic
1003270512 6:4603575-4603597 GGGACTTCCCCTGCAAAAACTGG - Intergenic
1006930945 6:37688109-37688131 GGGCAGTAACCTGGAAAACCAGG + Intronic
1008739002 6:54582216-54582238 GGGAATTCCACTGGAAAACCTGG - Intergenic
1011945049 6:92890570-92890592 GGGGCTACCCCTGCAGAACCAGG - Intergenic
1019634470 7:2068151-2068173 TGGGGTGCACCTGCAAAGCCAGG + Intronic
1023411788 7:39895111-39895133 GGGGATTCCCCAGCAAGAGCAGG - Intergenic
1035442398 7:158912572-158912594 AGTGAATCAGCTGCAAAACCAGG - Intronic
1036106749 8:5848954-5848976 GGGGGTTCTGCAGCAAAACCTGG + Intergenic
1036636235 8:10551607-10551629 GGGGCTTCACCTCCTAACCCTGG + Intronic
1040850920 8:51899454-51899476 GGGGGTTCGCCTCCAAATCCAGG - Intergenic
1047348527 8:124051476-124051498 TGGGTTTCACCTGCAAAATGGGG + Intronic
1049499806 8:142955778-142955800 GGGGTGCCACCTGCAAAACTAGG + Intergenic
1050954574 9:11638637-11638659 GGGTATTCAACTGGAAAAACAGG - Intergenic
1052899414 9:33778778-33778800 GGGGAATCACCTCCAATCCCTGG - Intronic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1203522884 Un_GL000213v1:60141-60163 GTGGATTCACATGGAAAAGCTGG - Intergenic
1189253914 X:39622639-39622661 TGGGACTCACCTGCAGGACCGGG + Intergenic
1190879224 X:54480959-54480981 GGGACTTCACATGAAAAACCTGG - Intronic
1191894671 X:65979435-65979457 GGGGAAACACCTGAAAAACTGGG + Intergenic
1197304715 X:124827463-124827485 GGGGCTTCTCATGCTAAACCTGG + Intronic