ID: 1101719782

View in Genome Browser
Species Human (GRCh38)
Location 12:107341382-107341404
Sequence ATTTCCTGGACAGCCTCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101719782_1101719786 10 Left 1101719782 12:107341382-107341404 CCCCGTGAGGCTGTCCAGGAAAT 0: 1
1: 0
2: 3
3: 9
4: 100
Right 1101719786 12:107341415-107341437 ACCAAGTCAGTGCAAGACTGAGG 0: 1
1: 0
2: 1
3: 7
4: 134
1101719782_1101719791 14 Left 1101719782 12:107341382-107341404 CCCCGTGAGGCTGTCCAGGAAAT 0: 1
1: 0
2: 3
3: 9
4: 100
Right 1101719791 12:107341419-107341441 AGTCAGTGCAAGACTGAGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 184
1101719782_1101719790 13 Left 1101719782 12:107341382-107341404 CCCCGTGAGGCTGTCCAGGAAAT 0: 1
1: 0
2: 3
3: 9
4: 100
Right 1101719790 12:107341418-107341440 AAGTCAGTGCAAGACTGAGGGGG 0: 1
1: 0
2: 2
3: 25
4: 180
1101719782_1101719788 11 Left 1101719782 12:107341382-107341404 CCCCGTGAGGCTGTCCAGGAAAT 0: 1
1: 0
2: 3
3: 9
4: 100
Right 1101719788 12:107341416-107341438 CCAAGTCAGTGCAAGACTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 151
1101719782_1101719789 12 Left 1101719782 12:107341382-107341404 CCCCGTGAGGCTGTCCAGGAAAT 0: 1
1: 0
2: 3
3: 9
4: 100
Right 1101719789 12:107341417-107341439 CAAGTCAGTGCAAGACTGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101719782 Original CRISPR ATTTCCTGGACAGCCTCACG GGG (reversed) Intronic