ID: 1101732130

View in Genome Browser
Species Human (GRCh38)
Location 12:107435543-107435565
Sequence TGTCTCATGCAGTTGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101732127_1101732130 -9 Left 1101732127 12:107435529-107435551 CCTTGTTTGGCATCTGTCTCATG 0: 1
1: 0
2: 3
3: 23
4: 234
Right 1101732130 12:107435543-107435565 TGTCTCATGCAGTTGGTGCAGGG 0: 1
1: 1
2: 0
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101732130 Original CRISPR TGTCTCATGCAGTTGGTGCA GGG Intronic
900945212 1:5827426-5827448 TGGCACCTGCAGTTGGTGCTGGG - Intergenic
902972502 1:20064114-20064136 TGACTCATTTAGTTGGAGCAGGG + Intronic
903227318 1:21901332-21901354 AGTATCATGCAGAGGGTGCATGG + Intronic
905777865 1:40681594-40681616 TGTCTCATTGAGTTGGTTTAAGG + Intergenic
907403233 1:54238531-54238553 AGTCCCATCCAGTGGGTGCAGGG + Intronic
907809796 1:57857524-57857546 TGTCTCATAGAGTTGTTACAAGG - Intronic
907874123 1:58469328-58469350 TATCTCATGCAGTTGTTATAGGG + Intronic
908077836 1:60540389-60540411 TGTCTCCTGAAGCAGGTGCACGG + Intergenic
908708040 1:66981839-66981861 TGTTTGATGCAGTTGGGGGAGGG - Exonic
909262860 1:73516542-73516564 TATTTCATACAGTTGTTGCAAGG + Intergenic
911069053 1:93817722-93817744 TGTCATATGTAGTTTGTGCATGG - Intronic
917611173 1:176690403-176690425 TAGCTCATGTAGTTGGTGAACGG - Exonic
918574339 1:186038207-186038229 TGTTTCATGCAGTTAGTTAAAGG - Intronic
1062953839 10:1526810-1526832 TGACTCACGCACTTGGTGCGTGG + Intronic
1068125019 10:52828305-52828327 TGTTTCCTGCAGTTGGAGGAGGG - Intergenic
1071455570 10:85849071-85849093 TGGCTCCAGCAGTTGGTGCTAGG - Intronic
1072240429 10:93490473-93490495 TGTGTCCTGCAGTTTGTTCAAGG - Intergenic
1072541145 10:96398754-96398776 TGACTCATGCAATAGGTGCTTGG - Intronic
1075788108 10:125063882-125063904 TGCCTGATGGAGTTGCTGCAGGG - Intronic
1078757525 11:14224897-14224919 TGTCTGATGGACTGGGTGCAGGG + Intronic
1083403674 11:62442017-62442039 TGTCTGATGGAGATGTTGCAGGG - Intronic
1087805507 11:102551370-102551392 TGTCTCAGGCATGTGGTGCTTGG + Intergenic
1093562122 12:20553526-20553548 TGTCTGTTGAAGTTGTTGCAAGG + Intronic
1096815247 12:54197712-54197734 GGCCTCAGGCAGTGGGTGCAGGG + Intergenic
1098104168 12:67052241-67052263 TGTCTCATGAAGATGGTTGAGGG - Intergenic
1098845026 12:75524362-75524384 TGTTTCATGTAGTTGGTGCCTGG + Intergenic
1099479353 12:83146785-83146807 TCTCTGATGCATTAGGTGCAGGG + Intergenic
1100057194 12:90526175-90526197 TATGTAATGCAGTTGTTGCATGG - Intergenic
1100128764 12:91463590-91463612 TTTCTCATGAAATTGTTGCAGGG - Intergenic
1100963281 12:99985988-99986010 TATCTCATGCGATTGTTGCAAGG - Intergenic
1101364394 12:104058277-104058299 ATTTTCATGCAGTTGGTGCCTGG + Intronic
1101732130 12:107435543-107435565 TGTCTCATGCAGTTGGTGCAGGG + Intronic
1103730368 12:123023188-123023210 TGTCTCCTGGACTTGGTGTATGG + Intronic
1109725332 13:66333288-66333310 TGTCTCATGCAGTTAATGTCTGG - Intronic
1110306310 13:73991348-73991370 TCTAACATGCACTTGGTGCATGG - Intronic
1110452036 13:75647617-75647639 TGTGTCCTGCAGTTTGAGCATGG + Intronic
1110507067 13:76299307-76299329 TTTCTCAGGCAGATGGTCCAAGG - Intergenic
1119232576 14:72992464-72992486 TAACTCATGGAGTTGGTGTAAGG + Intronic
1122036598 14:98953684-98953706 AGTGTCCTGCAGTTGGGGCAGGG - Intergenic
1122105327 14:99448934-99448956 TGTCTTGTGCAGTTTTTGCATGG - Intronic
1124074119 15:26426669-26426691 TATGTAATGCAGTTGCTGCATGG - Intergenic
1124624440 15:31300047-31300069 TTTCTCTTGCAGTTGATGCATGG - Intergenic
1126101502 15:45120777-45120799 GGTCTCATTCAGCTGCTGCACGG + Exonic
1127102384 15:55580538-55580560 TATCTCATGGAGTTGTTGGAAGG - Intronic
1130274135 15:82467786-82467808 TGCCTCACGCAGTTGTTGGAAGG + Intergenic
1130466481 15:84195160-84195182 TGCCTCACGCAGTTGTTGGAAGG + Intergenic
1130497783 15:84478376-84478398 TGCCTCACGCAGTTGTTGGAAGG - Intergenic
1130588777 15:85199753-85199775 TGCCTCACGCAGTTGTTGGAAGG + Intergenic
1135951211 16:26916151-26916173 TGTCCCATGCAGTTCATGCCTGG - Intergenic
1137648126 16:50093704-50093726 CGTGTCTGGCAGTTGGTGCAGGG + Intronic
1138212796 16:55177268-55177290 TGTCTTCTGGAGTTGTTGCAAGG + Intergenic
1140382611 16:74504101-74504123 TGTCTCCTGCATTTTTTGCATGG - Intronic
1140796854 16:78446415-78446437 TGCCTCAGGCGGTTGTTGCAAGG + Intronic
1141150867 16:81563925-81563947 TGTCTCCAGCAGCTGGTGCCTGG + Intronic
1144642066 17:16943104-16943126 TCTGTCATGCAGATGGTGCTGGG - Intronic
1146462485 17:33057186-33057208 AGTCCCATGCAGTTGGTGTGGGG + Intronic
1146745725 17:35327607-35327629 TGTATTCTGCAGTTGTTGCATGG + Intergenic
1148855403 17:50576294-50576316 TGTCTCCAGCAGCTTGTGCATGG - Exonic
1149614839 17:57988505-57988527 TGGCTCAGGCAGCTGGAGCAGGG + Intergenic
1150097805 17:62393848-62393870 TGTCTCTTGCAGTAGGTGTTTGG - Intronic
1150606702 17:66697741-66697763 TGTCTCAAGCAGCTCGTGGATGG - Intronic
1151898916 17:76998815-76998837 TGTCTCAGGCTGTTAGAGCAGGG - Intergenic
1156021679 18:32606568-32606590 TGTGTCATGGAGTTGCTGCTAGG + Intergenic
1158361738 18:56681788-56681810 TTGCTCATGCAGTTGGTCCTTGG + Intronic
1160380107 18:78448172-78448194 TGTCTCCAGCAGCAGGTGCAGGG - Intergenic
1161559122 19:4961316-4961338 TGTCTGTTGAAGTTGTTGCAAGG + Exonic
1166320725 19:42017116-42017138 TTGCTAATGCAGCTGGTGCAAGG - Intronic
925613617 2:5724579-5724601 TGCTGCATGAAGTTGGTGCATGG + Intergenic
926528967 2:14017912-14017934 GGACTCATGCAGTTGTGGCAAGG + Intergenic
929542272 2:42831444-42831466 TACCTCATGTAGTTGTTGCAAGG + Intergenic
929542460 2:42832902-42832924 TGTCTCATGCAGTTGTTGCAAGG - Intergenic
930891556 2:56394500-56394522 TGTGTCTTGCTGTTGGTGAATGG - Intergenic
931314669 2:61117195-61117217 TGTCTCATTTGGTTGGTGCAAGG + Intronic
933566316 2:83954708-83954730 TGTCTTCTGAAGTTGGTGTAAGG - Intergenic
942512039 2:176712987-176713009 TGTTTCATGGAGTTGTTGTAAGG + Intergenic
942582294 2:177431537-177431559 TGTCTCATGCAGTTGAGATAAGG - Intronic
944080928 2:195787763-195787785 TGTCCCCTGCAGCTGGGGCAGGG + Intronic
945205152 2:207323595-207323617 TCAATCATGCAGTTTGTGCATGG - Intergenic
945843037 2:214910931-214910953 TCTCTCATGCAATTGGGGCAGGG - Intergenic
946125795 2:217561589-217561611 TGTCTTATGCAGTTGAGGTAAGG + Intronic
947071354 2:226291455-226291477 TGTCTTATGCAGTTGGGATAAGG + Intergenic
947279600 2:228435552-228435574 TGTCTTATGCAGTATTTGCATGG - Intergenic
1169475398 20:5926554-5926576 TGTCTCATTGAGTTGTTACAAGG + Intergenic
1174136419 20:48383070-48383092 TGTCTCTTGCAGTTGGCAGAGGG - Intergenic
1174522423 20:51141931-51141953 TGCCTCATAGAGTTGCTGCAAGG + Intergenic
1175355842 20:58367109-58367131 TGTGTCATGCAGTAAGTCCAAGG - Exonic
1177593919 21:23211117-23211139 TTTCTGATGCAGTTGTTGCATGG + Intergenic
1177846923 21:26300277-26300299 TGTCTTATGCTATTGGTGGAGGG - Intergenic
1179820377 21:43933790-43933812 TGGCTCTTGCAGCTGGTGCTTGG - Intronic
1180240354 21:46499326-46499348 TGGTGCATGCAGTAGGTGCAGGG + Intronic
1181866834 22:25864744-25864766 TGTGTAAAGCAGTTGGAGCAGGG + Intronic
1182500504 22:30743342-30743364 TGTCTCACTCATTTGGAGCATGG + Intronic
1183297926 22:37043133-37043155 TGTCCCATGGAGGAGGTGCATGG + Intergenic
1183515682 22:38264494-38264516 TGTCCCCTGCAGCTTGTGCAGGG - Intronic
1184950988 22:47842488-47842510 AGTCTCATGCAGAAGGGGCAGGG - Intergenic
949216688 3:1578293-1578315 TGTCTCACCCAGTTGCTGTAGGG - Intergenic
949826558 3:8171583-8171605 TCTCTTAGGCAGTAGGTGCAAGG - Intergenic
950471552 3:13189568-13189590 TGTCACTTGTAGTGGGTGCAGGG - Intergenic
957463654 3:80556845-80556867 TCTCTCATGAAGTTGTTTCAAGG + Intergenic
958417305 3:93890111-93890133 TGTCTTATGCAGTTGGGATAAGG + Intronic
958550178 3:95602150-95602172 GGTGTCATGCAGCAGGTGCAAGG - Intergenic
960517605 3:118619283-118619305 CTTCACATGCAGTTGCTGCAGGG - Intergenic
961765336 3:129205969-129205991 TGTCAGATGCAGTGGGCGCAGGG - Intergenic
962883182 3:139598518-139598540 TGTGTCTGGCAGTTGGTGCTGGG - Intronic
963876118 3:150476940-150476962 TGTGGCATGCAGTTAGTGCAGGG - Intergenic
968809686 4:2794268-2794290 AGGCTCATGGAGTTGGTGCAGGG - Intronic
969581929 4:8070885-8070907 TGCCTCGTGCAGTCTGTGCAGGG - Intronic
973261800 4:48172664-48172686 TGTCTTATGCAGTTCCAGCAAGG - Intronic
973327548 4:48878632-48878654 TGTGCCATGCAGATGGTTCAGGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976264271 4:83175314-83175336 TGTCTCAGGCAGGTGGTGGTTGG - Intergenic
978082960 4:104616828-104616850 TGTGCCATGCAGTTGCTGCCAGG + Intergenic
981730219 4:147889267-147889289 TTTCTGATGCAGTTTGTACAAGG + Intronic
982758748 4:159254889-159254911 AGTCTCATGCTGGTGGGGCATGG - Intronic
985574928 5:669629-669651 TGACTCATGCTGGTGGTGCCTGG - Intronic
989486106 5:41994374-41994396 TGTGTTCTGCAGTTGGTACATGG + Intergenic
990887341 5:60609573-60609595 TGTCACCTGCAGCTGGAGCATGG + Intronic
991507629 5:67342099-67342121 AGCCCCAAGCAGTTGGTGCACGG + Intergenic
992256583 5:74927409-74927431 TGACTCTTTCAGGTGGTGCAGGG - Intergenic
992726264 5:79610853-79610875 TGTTTTTTGCAGTTGTTGCATGG - Intergenic
993910390 5:93675778-93675800 TTTCTCATGCAGCAGGTGCCAGG - Intronic
994897998 5:105730102-105730124 TTACTCTTGCAGTTGGTGGAGGG - Intergenic
995487782 5:112656630-112656652 TGTCTCATGCAGCTGTTGTCTGG + Intergenic
997662321 5:135599098-135599120 TGACTCATTCAGTTGGTTCGGGG + Intergenic
999194556 5:149773353-149773375 TGTTTTGTGCAGCTGGTGCATGG + Intronic
1001444935 5:171775692-171775714 TATCTCATGGAGTTGCTGCGAGG + Intergenic
1003092248 6:3114110-3114132 TTTCCCAGGCAGTTGTTGCAAGG + Exonic
1003535400 6:6971425-6971447 TGTCACCTGCAGCTGGGGCATGG - Intergenic
1006635868 6:35460734-35460756 TGTCTCAGGCAGCTGCTGTAGGG - Intronic
1007425951 6:41746238-41746260 TGTCACATCCAGCTGGTGCCAGG - Intronic
1008534888 6:52500152-52500174 TTTCTCCTGCTCTTGGTGCATGG + Exonic
1009373636 6:62939422-62939444 TGTGTCATGCAGTTACTGCCAGG + Intergenic
1012538659 6:100331756-100331778 TGTCTCACACAGTTGCTGTAAGG + Intergenic
1013146688 6:107400841-107400863 TCTCTAAGGCAGTTGGGGCAGGG - Intronic
1013272098 6:108554925-108554947 TTTCTAATTCAGTTGGTCCAAGG + Intergenic
1016193670 6:141303674-141303696 TATCTCATGCATTTGGGGAAGGG + Intergenic
1016951171 6:149581575-149581597 TATCTCATGAAGTTGTTACAAGG + Intronic
1017400272 6:154053336-154053358 GGTCACATGCAGTGGGTGCAGGG - Intronic
1017707864 6:157140561-157140583 TGTCTCATGTGGTTGCTGCAGGG - Intronic
1020052226 7:5089247-5089269 TCTTGCATGCAGTTGGTGGAAGG - Intergenic
1021176807 7:17459062-17459084 TGTCTTATGCAGTTGGGATAAGG - Intergenic
1022608561 7:31843167-31843189 TGTATATTGCAGTTGTTGCATGG + Intronic
1026896072 7:74010745-74010767 TTTCCCAGGCAGGTGGTGCAGGG - Intergenic
1027328757 7:77069150-77069172 TGTATCCTGCAGTTGTTGGATGG + Intergenic
1028235600 7:88357698-88357720 TATCTCATGCAGTTGTTGAGAGG + Intergenic
1029695927 7:102213202-102213224 TGTCCCTTGCAGATGGTGCAGGG + Intronic
1029787014 7:102802215-102802237 TGTATCCTGCAGTTGTTGGATGG - Intronic
1032539815 7:132693696-132693718 TGTCTGATGCGGTTGGTCCCTGG + Intronic
1032885727 7:136136160-136136182 TGTCCCATGCAATTGGTTCCAGG - Intergenic
1033156875 7:138964456-138964478 TACCTCATGCAATTGTTGCACGG + Intronic
1033418969 7:141189287-141189309 TTTCCCATGCAGTGGCTGCAGGG + Intronic
1035377458 7:158414821-158414843 TGGCTCATTCAGTTGGTGTGAGG - Intronic
1041246763 8:55895756-55895778 TATCTCATCCAGTTGTTGCAAGG + Intronic
1044142293 8:88670927-88670949 TGCCTCATGCAGTTGTTGATAGG - Intergenic
1046648690 8:116813341-116813363 TGTCACATGCTGATGCTGCAGGG + Intronic
1046781538 8:118220889-118220911 TCTCTCAGGCAGTTGGCACAAGG - Intronic
1048752872 8:137699613-137699635 TGTGTCTTGCACTTGGTACATGG + Intergenic
1050759826 9:9054088-9054110 TGTCTGAGACATTTGGTGCATGG - Intronic
1050792016 9:9484637-9484659 TTTCTCATAGAGTTGTTGCAAGG - Intronic
1051161039 9:14207566-14207588 TGTCACATGCAGTCCCTGCACGG - Intronic
1051953732 9:22664096-22664118 TGTTTCATTCAGCTAGTGCATGG - Intergenic
1052008340 9:23377199-23377221 TGCCCCATGCAATTGGTGCCGGG + Intergenic
1053283767 9:36837873-36837895 TGCCTCAGGCAGCTGGTTCAGGG + Exonic
1056292561 9:85158466-85158488 TGTCTCATCCAGGTTGTACAGGG - Intergenic
1058429796 9:104907908-104907930 TGTTTCATACAGTTTGGGCATGG + Intronic
1058576970 9:106414211-106414233 TTTTTCATGCAGATGATGCACGG - Intergenic
1060017585 9:120099910-120099932 TGTCTCAGGCAGTTAGTGGCAGG - Intergenic
1060558671 9:124524603-124524625 TCTTTCATGCAGTTGGTGATGGG + Intronic
1061676275 9:132217711-132217733 TGCCTCATGGAGTTGTTGGAAGG - Intronic
1187202994 X:17154040-17154062 TTCCTGATTCAGTTGGTGCAGGG - Intergenic
1187378593 X:18779856-18779878 TGTCTCATGCTTTTGGTCCTGGG + Intronic
1190335248 X:49258137-49258159 TGACTTATGCAGATGTTGCAGGG - Intronic