ID: 1101733265

View in Genome Browser
Species Human (GRCh38)
Location 12:107443949-107443971
Sequence CAGGGTCACCTAGATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101733262_1101733265 -9 Left 1101733262 12:107443935-107443957 CCTTGCCTTACAGACAGGGTCAC 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG 0: 1
1: 0
2: 0
3: 26
4: 228
1101733257_1101733265 1 Left 1101733257 12:107443925-107443947 CCCTGTGAACCCTTGCCTTACAG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG 0: 1
1: 0
2: 0
3: 26
4: 228
1101733256_1101733265 8 Left 1101733256 12:107443918-107443940 CCAAAGGCCCTGTGAACCCTTGC 0: 1
1: 0
2: 3
3: 13
4: 172
Right 1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG 0: 1
1: 0
2: 0
3: 26
4: 228
1101733261_1101733265 -8 Left 1101733261 12:107443934-107443956 CCCTTGCCTTACAGACAGGGTCA 0: 1
1: 0
2: 1
3: 16
4: 248
Right 1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG 0: 1
1: 0
2: 0
3: 26
4: 228
1101733258_1101733265 0 Left 1101733258 12:107443926-107443948 CCTGTGAACCCTTGCCTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG 0: 1
1: 0
2: 0
3: 26
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101733265 Original CRISPR CAGGGTCACCTAGATGAGGA TGG Intronic
900595515 1:3478537-3478559 CAGGGTCACCTGGAAGGGGTGGG - Exonic
900599110 1:3495603-3495625 CACGGCCACCTCTATGAGGATGG + Intronic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
901600445 1:10419526-10419548 CAGGCTTACCTGGATGAGGCTGG - Exonic
901943636 1:12683473-12683495 AAGGGTCACTTTGATGAGGCAGG - Intergenic
902162227 1:14540314-14540336 CAGGCTCACCTAAGAGAGGAAGG - Intergenic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
902669348 1:17961822-17961844 CATGATCACCAAGATGAGGTTGG + Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903375310 1:22862109-22862131 CAGGGCCAGCAAGAAGAGGAAGG + Intronic
904604809 1:31692502-31692524 GAGGGTCCCTGAGATGAGGAAGG + Exonic
905523823 1:38621734-38621756 CAGGGACACCTAGAGGGGGGTGG - Intergenic
906315745 1:44785439-44785461 CAGGGTCACCTTGTTGGGGGTGG + Intronic
909736291 1:78966647-78966669 CAGGCCCACCTGGAAGAGGAGGG - Intronic
914912824 1:151801058-151801080 GAGGGTCACTGAGGTGAGGAAGG + Exonic
914971227 1:152309414-152309436 CAGGGTCAAGCAGAGGAGGAAGG - Exonic
915976869 1:160397079-160397101 CAAGGTTTCATAGATGAGGAAGG + Intergenic
918372675 1:183877014-183877036 CAGTGTCAGGTAGATGAAGAAGG + Intronic
919798163 1:201333786-201333808 CAGGGCCACCTGGATGGGGAAGG + Intergenic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920535406 1:206733736-206733758 CAGGCTCACCTACATGAGCTGGG - Exonic
922590744 1:226774002-226774024 CAGGTCCACCAAGATGTGGATGG + Intergenic
922911493 1:229221496-229221518 CACACTCACCTAGAGGAGGAAGG + Intergenic
924289126 1:242520258-242520280 CAAGGCAACCAAGATGAGGATGG + Intronic
1067046519 10:42988377-42988399 CAGGGTCACCCAGATGCTGGGGG + Intergenic
1067427214 10:46219482-46219504 CTGGTTCCCCTGGATGAGGACGG + Intergenic
1067779712 10:49190852-49190874 CCAGGTCATCTAGGTGAGGAAGG + Intergenic
1070906313 10:80076514-80076536 CAGGGTAGCCTTGGTGAGGATGG + Intergenic
1072911794 10:99508662-99508684 CAGGGGCTCCTGGATGAGAAGGG + Intergenic
1074851819 10:117445222-117445244 CAGGGTCCCCTAGATAACCAGGG + Intergenic
1075394922 10:122120298-122120320 CAGGGTCTCCTGGCTGAGAAAGG - Intronic
1076042321 10:127260795-127260817 CAGGGACACACAGATGAGCACGG - Intronic
1076566538 10:131403174-131403196 CGGGGCCACAGAGATGAGGACGG + Intergenic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1077585222 11:3446390-3446412 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
1077797787 11:5509481-5509503 CACTGTCACCTTGATGAGGTGGG + Exonic
1077874303 11:6291060-6291082 CAGCGTCACCTGGCTAAGGAAGG - Intergenic
1077913598 11:6595984-6596006 CAAGGTTACCTTGAAGAGGAAGG + Exonic
1077918166 11:6624383-6624405 CAGGGTCCCTGAGATGAGAACGG + Exonic
1078455279 11:11470090-11470112 CAGGGACACTTGGATGAGGATGG + Intronic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1081598339 11:44474682-44474704 CAGGGTCACCTTGCTGATGAGGG - Intergenic
1082782073 11:57295633-57295655 CAGGGTCACCAAGTTGTGGCAGG - Intergenic
1083121044 11:60512056-60512078 CCTGGTCACCTAGGTGAGGCTGG - Intergenic
1083635907 11:64120929-64120951 CAGGGGGACCTAGGTGAGGTGGG - Intronic
1084242126 11:67828953-67828975 CATGGTCACCCAGCTGAGGAAGG + Intergenic
1084569905 11:69953118-69953140 GAGGGTCTCCCAGATGGGGAAGG + Intergenic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1089554422 11:119308221-119308243 CAGGCTCACCGCCATGAGGAAGG - Intergenic
1089676213 11:120091700-120091722 AAGGGCCACCTAGATTAGGGAGG - Intergenic
1089792385 11:120954217-120954239 CAAGGTCCCCAAGATCAGGAAGG + Intronic
1091991594 12:4960324-4960346 CAGGGGCACCTTGCTGAGTATGG + Intergenic
1092412374 12:8263652-8263674 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
1096263245 12:50105693-50105715 CAGGGACACCTTCATGTGGATGG + Intronic
1096957939 12:55546071-55546093 CAGGGTCCCCAAGAGTAGGAAGG - Intergenic
1097054697 12:56242609-56242631 CAGGGGCAGCTAGAGGATGAGGG - Exonic
1097264623 12:57738184-57738206 CAGGGTCAGCGAGATGAGGTAGG + Exonic
1097757689 12:63425405-63425427 CGGGGTCACTCAGATGGGGATGG + Intergenic
1099389052 12:82055841-82055863 CTGGGTCACCAGGATAAGGAGGG + Intergenic
1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG + Intronic
1102214061 12:111147709-111147731 CAAGGTCACCTGGCAGAGGAGGG + Intronic
1103327331 12:120130288-120130310 CTGGGCCAACTAGAAGAGGAAGG + Intronic
1104714592 12:131008013-131008035 CAGGGTCACACAGATAAGGAGGG - Intronic
1105202223 13:18190556-18190578 CTGGGACACCTGGATGATGAAGG - Intergenic
1105445516 13:20452121-20452143 CAGGGACTACTAGAAGAGGAAGG + Intronic
1105892614 13:24692415-24692437 CAGGGTCACCTAGCAGGAGAGGG - Exonic
1105990398 13:25615040-25615062 TAGGGTCACCTGGATAAGTATGG + Intronic
1106782572 13:33074375-33074397 CAGGGTCACCTGGGAGAGGCTGG - Intergenic
1107038702 13:35926828-35926850 CAGGGTCACACAGGTGAGAAGGG + Intronic
1115463323 14:33686109-33686131 CAGGCTGGCCTTGATGAGGAGGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119779238 14:77267079-77267101 CAAGGTCACCCAGCTGATGAAGG - Intronic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG + Intergenic
1124247946 15:28086408-28086430 CAGGTTCCCCAAGATGGGGAAGG - Intronic
1124998978 15:34752381-34752403 GAGGGTCACATAAATGAGGGTGG + Exonic
1125034318 15:35106495-35106517 CAGGGTCACTCAGAGGATGATGG + Intergenic
1125134615 15:36327344-36327366 CAAGGTCACCTAAATGAAAAGGG + Intergenic
1126544043 15:49853245-49853267 AAGAGTAACCTAGATGGGGAAGG + Intergenic
1127461549 15:59203755-59203777 CAGGGACACTAAGATGAGTAAGG - Intronic
1129161727 15:73751620-73751642 CAGGGTCTTCCAGATGTGGAAGG + Exonic
1129312133 15:74720251-74720273 CAGGGCCACATAGATGCTGATGG - Exonic
1131422945 15:92322383-92322405 CAGGCTCATCTGAATGAGGAAGG - Intergenic
1133100537 16:3476483-3476505 CAGGGGTCCCTAGATGAGGTGGG - Intronic
1133287192 16:4696051-4696073 CAGGGCCACCAGGATCAGGAAGG - Intergenic
1133330933 16:4973444-4973466 CAGTGTCACCCAGCTGATGAAGG - Intronic
1133353638 16:5119888-5119910 CACGGTCACCCAGCTGAGGAAGG + Intergenic
1134812458 16:17179223-17179245 CAGGGTCTCCTTGAGGAGGCAGG + Intronic
1136414628 16:30095887-30095909 GAGGGTCACCTAGGAGGGGAGGG + Exonic
1137420503 16:48329306-48329328 CAGGGTCACACAGAGCAGGATGG - Intronic
1137622127 16:49883060-49883082 CAAGGTTACCTCTATGAGGATGG + Intergenic
1137720510 16:50625020-50625042 CAGGGTCACACAGCTGTGGAGGG + Intronic
1142896646 17:2983890-2983912 GAGGGTCATATAGATGATGATGG + Intronic
1144331427 17:14227588-14227610 CAGGTTCACCTGGATCAGGTAGG + Intergenic
1145797799 17:27666094-27666116 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1146464621 17:33076353-33076375 CAGGCTCACATAAAGGAGGAGGG - Intronic
1146737132 17:35248097-35248119 CAGTTTCTCCTAGATGAGGAGGG - Intronic
1146789901 17:35745342-35745364 CAAGGGCACCCACATGAGGAAGG - Exonic
1146842279 17:36164319-36164341 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1146854589 17:36252278-36252300 CAGGCCCACCCAGCTGAGGATGG + Intronic
1146866031 17:36336098-36336120 CAGGCCCACCCAGCTGAGGATGG - Intronic
1146870489 17:36376170-36376192 CAGGCCCACCCAGCTGAGGATGG + Intronic
1146877847 17:36427251-36427273 CAGGCCCACCCAGCTGAGGATGG + Intronic
1147068900 17:37936710-37936732 CAGGCCCACCCAGCTGAGGATGG - Intergenic
1147073372 17:37976794-37976816 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1147080424 17:38016247-38016269 CAGGCCCACCCAGCTGAGGATGG - Intronic
1147084894 17:38056332-38056354 CAGGCCCACCCAGCTGAGGATGG + Intronic
1147096371 17:38140207-38140229 CAGGCCCACCCAGCTGAGGATGG - Intergenic
1147100841 17:38180298-38180320 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1147741524 17:42673312-42673334 GAGGGTCACCTTGATGGGGAAGG + Intronic
1148875530 17:50684713-50684735 CAGGGTCCCCGAGAACAGGATGG - Exonic
1149845434 17:60006762-60006784 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1149992307 17:61389979-61390001 CAGGGCCACCAGGATGGGGAAGG - Intronic
1150083782 17:62263345-62263367 CAGGCCCACCCAGCTGAGGATGG + Intergenic
1153044367 18:842349-842371 CAAGGACACCTAGCTGAGGTGGG + Intergenic
1155354820 18:24942054-24942076 CAGACTAACCTAGAAGAGGATGG + Intergenic
1155933381 18:31729241-31729263 CATGGTCACATAGATGGGTAGGG - Intergenic
1157592442 18:48843658-48843680 TACGGTCACCTAGATAAGGGAGG - Intronic
1161577948 19:5065126-5065148 CAGCGTCACCTAGCACAGGAGGG + Intronic
1162322817 19:9979873-9979895 CAGGGTCACCAAGGTAAAGATGG - Exonic
1162534158 19:11253347-11253369 CTGGACCACCTAGATGGGGATGG - Intronic
1163195491 19:15716772-15716794 CATGGTCACCTCTAGGAGGAAGG + Intergenic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1163717609 19:18881018-18881040 AGAGGTCACCAAGATGAGGAGGG - Intronic
1164143450 19:22494569-22494591 CAGGGTGGCCTGGATGAGCAGGG - Intronic
1165195612 19:34100477-34100499 CAGGAACACCTAGCTGAAGAAGG + Intergenic
1165355028 19:35299370-35299392 CGGGGTGACCAAGAGGAGGAAGG + Intronic
1168073428 19:53965095-53965117 CAAGGTCACCTAGCTGAGAAAGG + Intronic
1168131193 19:54320411-54320433 CATGCTCACCAGGATGAGGATGG + Intergenic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
926633011 2:15154699-15154721 CAGGGTCAGCTTGATGACTAGGG - Intergenic
926855374 2:17250810-17250832 CAGGGTGTGCTTGATGAGGAGGG - Intergenic
928410483 2:31050414-31050436 CAGTGTCACGTAGATGGGGGAGG + Intronic
930146743 2:48015056-48015078 CAGGGTCTCCCAGATGAAGAGGG + Intergenic
931200895 2:60096490-60096512 CGGTGGCACCTAGAAGAGGATGG - Intergenic
932212607 2:69945013-69945035 CACTATGACCTAGATGAGGAGGG + Intergenic
932964969 2:76462481-76462503 CATGATCAACTACATGAGGATGG - Intergenic
934158362 2:89224742-89224764 CATGGTCATCTGAATGAGGAAGG + Intergenic
934208906 2:89957683-89957705 CATGGTCATCTGAATGAGGAAGG - Intergenic
935708542 2:105877331-105877353 CAGGGTCATCTAGAACAGAAGGG - Intronic
936350269 2:111707089-111707111 CTGGGGCACCAAGGTGAGGAGGG + Intergenic
937589272 2:123593889-123593911 CTGGGTCACCTAGGAGAGGAAGG + Intergenic
938320563 2:130359594-130359616 CAGGATCACCTAGACAAGGAGGG - Exonic
939318672 2:140586574-140586596 CAGTGTCACCTAGAGGATGATGG - Intronic
941032914 2:160533338-160533360 AAAGGTGACCTTGATGAGGAAGG + Intergenic
943391014 2:187267787-187267809 CAAGGTCACCCAGAGGAGGGGGG + Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944890925 2:204116481-204116503 CAGCGACACATTGATGAGGATGG + Intergenic
945058019 2:205884973-205884995 CAAGGTGACCCAGATGAGGAGGG - Intergenic
947267059 2:228294476-228294498 TAGGGTGCCCTGGATGAGGAGGG + Intergenic
948637566 2:239349207-239349229 CAGGGCCAGCTAGCAGAGGACGG + Intronic
1170125869 20:12963531-12963553 GAGGGTCTCTTTGATGAGGAGGG - Intergenic
1170542165 20:17400374-17400396 CAAGGTCACACAGATGATGAAGG - Intronic
1171364274 20:24613198-24613220 CAGGGTCACATAGCTGGGAATGG - Intronic
1172218046 20:33250434-33250456 GTGGGTCACCTTGACGAGGAAGG + Intergenic
1173010951 20:39181500-39181522 CAGGGAGACCTGGATGAGGGTGG + Intergenic
1173244847 20:41329598-41329620 CAGGGACACCTCGATGAACAAGG + Intergenic
1173965606 20:47110183-47110205 CAAGGTCACCCAGCTTAGGAGGG + Intronic
1174496216 20:50945373-50945395 CAGGGTCACCAAGACTAGAATGG + Intronic
1175460011 20:59145559-59145581 AAGTGTCACCTAGATGTGAAAGG + Intergenic
1176715723 21:10347452-10347474 CTGGGACACCTGGATGATGAAGG + Intergenic
1179921556 21:44510275-44510297 CAGGCTGTCCTAGCTGAGGACGG + Intronic
1180588693 22:16917346-16917368 CATGGTCACCTGAATGAGGGAGG + Intergenic
1180602617 22:17032501-17032523 CTGGGACACCTGGATGATGAAGG - Intergenic
1181043724 22:20204861-20204883 CAGGGTCCCTGTGATGAGGAGGG - Intergenic
1181759995 22:25051696-25051718 CAGGGTGACCCAGCAGAGGAGGG + Intronic
1183433875 22:37782185-37782207 CAAGATCCCCTAGATGGGGATGG + Intergenic
1183676406 22:39301278-39301300 CAGGGTCACCCAGATGGTCAGGG - Intergenic
1184120364 22:42445966-42445988 CAAGGTCACTTAGTTGAGCAGGG - Intergenic
1185019165 22:48363623-48363645 CAGGGTCAGTGAGATGAGCAGGG + Intergenic
949506700 3:4735220-4735242 CAGTGTCACCTTGACAAGGAGGG + Exonic
950180791 3:10911793-10911815 CAGGGTCACACAGCTGAGGCCGG + Intronic
950291866 3:11791196-11791218 CAGGGCCACCTAGGTGAACAGGG - Intronic
950665935 3:14494981-14495003 CAGGGTCACCTGGAAGCAGAAGG + Exonic
952841668 3:37651855-37651877 CAGGGTGACAGAGGTGAGGAGGG + Intronic
953796045 3:45986704-45986726 CAGGGACACCAAACTGAGGATGG + Intronic
953830971 3:46297367-46297389 CAGGGTCAAATAGATGAAGATGG + Intergenic
954792108 3:53141206-53141228 CAGGGTCACATAGCTGTTGAGGG + Intergenic
955043651 3:55339590-55339612 CAGGGTCACGTAGTTGGGAAGGG - Intergenic
957057591 3:75455880-75455902 CACGGTCGCCCAGCTGAGGAGGG + Intergenic
958931939 3:100216558-100216580 CAGGGTCACCCTCATTAGGACGG + Intergenic
961889937 3:130122312-130122334 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
967645096 3:191913186-191913208 CAAGGTCACATAGCTAAGGACGG - Intergenic
968628404 4:1638135-1638157 CAGGGTCACCTGCCTGAGGCCGG - Intronic
969000417 4:3976290-3976312 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
969370943 4:6731310-6731332 TAGGGTTGCCTAGAGGAGGAAGG + Intergenic
969753605 4:9132375-9132397 CACGGTCGCCCAGCTGAGGAAGG - Intergenic
970557648 4:17250901-17250923 CATGGTCACCTAGCTCATGATGG - Intergenic
971384220 4:26128112-26128134 GAGCCTCACCTATATGAGGAGGG - Intergenic
971489815 4:27199683-27199705 CAGGGTCAACTAGATGCACATGG - Intergenic
976019141 4:80598733-80598755 CAATGTCACCTAGAGGAGGAAGG - Intronic
976496551 4:85736840-85736862 TAGTGTCACCCAAATGAGGATGG + Intronic
986447867 5:7838702-7838724 CAGGGTCAGCCAGGTCAGGAGGG - Intronic
986784894 5:11105172-11105194 CAGGTTTCCCTAGATGTGGATGG - Intronic
989564606 5:42889603-42889625 CATGATCTCCTAGAAGAGGAAGG - Intergenic
994179193 5:96745102-96745124 CAGGGTCACCTGTATTAAGACGG - Intronic
995498188 5:112772120-112772142 GGGGGTCACCTAGAAGAGCATGG - Intronic
997237076 5:132278818-132278840 CAGGGGCACCCAGAGGTGGAGGG - Intronic
1001640311 5:173239133-173239155 CAGGGTCACACAGATGGGAAAGG + Intergenic
1001928671 5:175657826-175657848 CAGAGTCGGCGAGATGAGGAGGG + Intergenic
1001966922 5:175916516-175916538 CAGGGTCACATACCTGAGGCAGG - Intergenic
1002250023 5:177922690-177922712 CAGGGTCACATAGCTGAGGCAGG + Intergenic
1004739457 6:18443779-18443801 CAAAGTCACCTAGCTGATGAAGG - Intronic
1005117122 6:22351342-22351364 CATGGTCACCCATCTGAGGAGGG + Intergenic
1006144305 6:31949148-31949170 CAGGGTGAGCAAGTTGAGGAAGG - Intronic
1006208077 6:32367475-32367497 CAAGTTCACCTAGCTGAGGAGGG - Intronic
1006297561 6:33176746-33176768 CAGGGTCACCCAGGGAAGGAAGG - Exonic
1008607512 6:53154539-53154561 TAGGCTTACCTAGATTAGGAGGG - Intergenic
1011191450 6:84733866-84733888 CAGTGTAACCTATATAAGGAAGG - Exonic
1012354938 6:98302450-98302472 CGGGGACTACTAGATGAGGAAGG - Intergenic
1014884179 6:126759497-126759519 CAGTGTCTTCTACATGAGGAAGG - Intergenic
1017818676 6:158033223-158033245 CTGTGTCACGTAGAGGAGGATGG - Intronic
1022020503 7:26395967-26395989 CAAGGTCAGCAAGCTGAGGATGG + Intergenic
1028911094 7:96208214-96208236 CAAGGTCACTTAGATCAGGAGGG - Intronic
1029202550 7:98848616-98848638 CAGGGTCATGTACATGATGAAGG + Exonic
1031566841 7:123309413-123309435 CAGGGTCATGTAGATGAGAAAGG - Intergenic
1032011462 7:128350718-128350740 CAGGGACCCCTGGATGGGGAAGG + Exonic
1032269295 7:130388949-130388971 CAGGATCACCAAGCTGAAGAAGG - Intergenic
1032565760 7:132941349-132941371 CAGTGTCATGTAGCTGAGGATGG - Intronic
1033368641 7:140689939-140689961 CAGCGACCCCTGGATGAGGAAGG - Intronic
1034887010 7:154805799-154805821 CAGGGCCACAGAGGTGAGGAGGG + Intronic
1035313011 7:157982151-157982173 CCGAGTCACAGAGATGAGGAGGG + Intronic
1035313025 7:157982204-157982226 CCGAGTCACAGAGATGAGGAGGG + Intronic
1035313191 7:157982832-157982854 CCGAGTCACAGAGATGAGGAGGG + Intronic
1035313206 7:157982886-157982908 CCGAGTCACAGAGATGAGGAGGG + Intronic
1036376818 8:8207707-8207729 CACGGTCGCCCAGCTGAGGAAGG - Intergenic
1036725572 8:11217839-11217861 CAGGGTCACCTAGGTGATGTGGG - Intergenic
1036852719 8:12215430-12215452 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
1036874090 8:12457952-12457974 CACGGTCGCCCAGCTGAGGAAGG + Intergenic
1037710360 8:21350650-21350672 CAGGTTCACCTACATGGGAAAGG + Intergenic
1038035444 8:23682785-23682807 CAGGATGTCCTGGATGAGGAAGG + Exonic
1040578164 8:48672596-48672618 CAGTGACACCAAGCTGAGGAGGG - Intergenic
1044224141 8:89700852-89700874 CAAAGTCACCTAGAGGAGCATGG + Intergenic
1045184478 8:99823177-99823199 CAAGGTCACAAAGATGAAGAGGG - Intronic
1045894035 8:107192774-107192796 CAGGGGCAGCAAGATGAGGTAGG + Intergenic
1047011148 8:120673716-120673738 CAGGGCCTCCTGGATGGGGAGGG + Intronic
1048550879 8:135432823-135432845 CAGGGTATCCTGGATGAGGCAGG + Intergenic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049745235 8:144260469-144260491 CACGGTCACCTAGCCGAGGTGGG - Intronic
1058626478 9:106938902-106938924 CATGCTCACCTGGAAGAGGATGG - Exonic
1060025246 9:120165334-120165356 CAGGGTCACCCAGCTCATGAGGG - Intergenic
1060983730 9:127808224-127808246 CAGGGACACCTTGCTGTGGAGGG - Exonic
1061256842 9:129458583-129458605 CAGGGTCACCCAGCTGTTGATGG - Intergenic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1062517185 9:136942604-136942626 CAGGTTCCCCGAGATGAGGCTGG + Exonic
1189037184 X:37505374-37505396 CAGGGTGACCTTGATGTTGATGG - Intronic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1190318484 X:49165806-49165828 CAGGGGCTCCTAGATGAGCGGGG + Intronic
1193291476 X:79777850-79777872 CAGAGCCACCTAGAGGAGCATGG + Intergenic
1194752698 X:97702479-97702501 AAGGGTCCCCTAGTTGAGGGTGG - Intergenic
1196337187 X:114551031-114551053 CAGAGTCTCCAAGATGTGGAGGG + Intergenic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic