ID: 1101733641

View in Genome Browser
Species Human (GRCh38)
Location 12:107446572-107446594
Sequence CTATGTGACCAAAAGGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101733637_1101733641 3 Left 1101733637 12:107446546-107446568 CCTCATGTAGAGCAAGGAAGCAA 0: 1
1: 0
2: 1
3: 21
4: 218
Right 1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 119
1101733631_1101733641 28 Left 1101733631 12:107446521-107446543 CCAGGGTCACTTTCTCCCCTGTG 0: 1
1: 0
2: 2
3: 35
4: 317
Right 1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 119
1101733636_1101733641 4 Left 1101733636 12:107446545-107446567 CCCTCATGTAGAGCAAGGAAGCA 0: 1
1: 0
2: 3
3: 11
4: 149
Right 1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 119
1101733632_1101733641 13 Left 1101733632 12:107446536-107446558 CCCCTGTGTCCCTCATGTAGAGC 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 119
1101733633_1101733641 12 Left 1101733633 12:107446537-107446559 CCCTGTGTCCCTCATGTAGAGCA 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 119
1101733634_1101733641 11 Left 1101733634 12:107446538-107446560 CCTGTGTCCCTCATGTAGAGCAA 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101733641 Original CRISPR CTATGTGACCAAAAGGAGCT CGG Intronic
901288024 1:8097601-8097623 CTATGAGTTCAACAGGAGCTTGG - Intergenic
902318657 1:15643647-15643669 CTAGGTGAGCAAAAGGCACTGGG + Exonic
902771425 1:18647369-18647391 CTCTGTGACCCCAGGGAGCTGGG + Intronic
904165306 1:28550799-28550821 CTAGGAGTCCAAAATGAGCTTGG + Intergenic
908742530 1:67343246-67343268 CTCTGTGACAAAAATTAGCTGGG - Intronic
909555988 1:76954799-76954821 CTCTGTGGTCAAATGGAGCTGGG + Intronic
910851079 1:91650541-91650563 CTATGAGACCAAATACAGCTGGG - Intergenic
913586099 1:120277367-120277389 CTATAAGACCAAAAGGAGTGTGG - Intergenic
913622087 1:120621002-120621024 CTATAAGACCAAAAGGAGTGTGG + Intergenic
914568108 1:148889225-148889247 CTATAAGACCAAAAGGAGTGTGG - Intronic
914604716 1:149241024-149241046 CTATAAGACCAAAAGGAGTGTGG + Intergenic
918257552 1:182763185-182763207 CTATGTAATCAAAATGAGCAAGG - Intergenic
923017020 1:230134712-230134734 CTGTGTGACTGAGAGGAGCTGGG + Intronic
923849289 1:237775985-237776007 CTAGGTGACCAAAAGTTGTTTGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924837892 1:247672733-247672755 CCATGTGAACAAGAAGAGCTGGG + Exonic
1074366690 10:112863192-112863214 CTATGTTTCTAAAAGGGGCTTGG - Intergenic
1074434021 10:113418473-113418495 CAATTTGTCCAAAAGGACCTGGG + Intergenic
1075526982 10:123195236-123195258 GTAAGTGAGCAAGAGGAGCTAGG - Intergenic
1076059219 10:127400488-127400510 CTATGTGGCCATCAGGAGCAAGG + Intronic
1077511534 11:2967106-2967128 ATATTTGACCAAAATGAGCTGGG + Intronic
1078146953 11:8728597-8728619 CTAGGTGACCAAAGGGAGTGGGG - Intronic
1078924263 11:15859731-15859753 CTATTTGAGAAACAGGAGCTGGG + Intergenic
1079007841 11:16804593-16804615 CTGTGTGACCAAAGGGATCGTGG - Intronic
1085320739 11:75572412-75572434 CTGTGAGACCAAATTGAGCTAGG + Exonic
1088314480 11:108493904-108493926 CTATGTAGACAAAAGGAGGTTGG + Intronic
1088400072 11:109413856-109413878 CTACCTGAGGAAAAGGAGCTGGG - Intergenic
1089088387 11:115843967-115843989 CCATGTGACCAAGAGGTGATAGG - Intergenic
1089810714 11:121129220-121129242 CTATGTGCCCTCGAGGAGCTGGG + Intronic
1090723903 11:129504450-129504472 CTTTGTAACCAAAAGGTGGTAGG - Intergenic
1093109277 12:15129795-15129817 CTATGTCACACTAAGGAGCTTGG + Intronic
1093242301 12:16692150-16692172 CTAAGTGACAAAAAGGATGTTGG - Intergenic
1094292949 12:28872667-28872689 CAATGTGAGCAAAAGCAACTTGG + Intergenic
1098052524 12:66469803-66469825 CTAAGTGACAGATAGGAGCTTGG - Intronic
1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG + Intronic
1102855993 12:116294251-116294273 CTCTGTGGCCAGCAGGAGCTTGG + Intergenic
1107272247 13:38633792-38633814 CTATGTGACCAAATTTAGGTTGG - Intergenic
1110087734 13:71403635-71403657 TTATGTGACCAATAGGATATAGG - Intergenic
1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG + Intronic
1113143931 13:107186099-107186121 CTAAGTGACTAACAGGAGGTTGG - Intronic
1117755125 14:58966908-58966930 CTTTGGGAACAAAAGGAGATAGG + Intergenic
1125077693 15:35638731-35638753 GTGGGTGACCAAAAGGAGCTTGG + Intergenic
1132239583 15:100247780-100247802 CCATGAAACCAAGAGGAGCTGGG - Intronic
1135115594 16:19720618-19720640 CTATTTGACCAAAATAAACTCGG - Intronic
1135611316 16:23870113-23870135 CTATGTTCCAAAAAGGAGTTTGG + Intronic
1137582999 16:49645614-49645636 CTCTGTGACCAACAGGATTTTGG - Intronic
1137793908 16:51198715-51198737 CTATGTTCCAAAAAGGAACTCGG - Intergenic
1139465655 16:67152720-67152742 CTTTGTGACCAAAAAGAGTAAGG - Intergenic
1140449946 16:75062915-75062937 CCAGGTGAGCAAAAGGAGCTGGG - Intronic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1147330848 17:39698575-39698597 CTCTGGGACCAAGAGGACCTGGG - Intronic
1147953970 17:44122365-44122387 TTATGGGAACAAAAGGAGGTGGG - Intronic
1150340423 17:64362266-64362288 GTATTTGACCACCAGGAGCTGGG - Intronic
1151999475 17:77636505-77636527 CTATCTGTCCTAGAGGAGCTGGG - Intergenic
1167734233 19:51282109-51282131 CAACGTGACCAGAAGTAGCTTGG + Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
928265488 2:29807962-29807984 CTTTGTTAAAAAAAGGAGCTTGG - Intronic
931441548 2:62293871-62293893 CTAGGTGACTGAACGGAGCTGGG - Intergenic
932356222 2:71070516-71070538 CTCTGAGACTAAAAGGACCTCGG - Exonic
933136717 2:78745328-78745350 ATATGTTACCAATAAGAGCTGGG - Intergenic
933337311 2:80974963-80974985 CTCTGTGAGGAAAATGAGCTTGG - Intergenic
933858988 2:86445410-86445432 TTATGTGAACAAAATCAGCTAGG - Intronic
934020035 2:87939480-87939502 CTGTGTGACCAGATGGTGCTAGG - Intergenic
935363611 2:102267892-102267914 ATCTGTGACCAAAAGCAGCAGGG - Intergenic
935570346 2:104653745-104653767 ATATGTGGCCAGAAGGAGCAGGG - Intergenic
936666894 2:114607376-114607398 CTATGTGACAAAAGGGACCTTGG + Intronic
940883243 2:158968311-158968333 CTCTGGGACCAAAATGAGATGGG - Intergenic
944037164 2:195308968-195308990 CTCTGTGACCAACAGGGACTGGG + Intergenic
944204744 2:197145602-197145624 CCATGTGACCATCAGGAGCGTGG + Intronic
945420473 2:209630006-209630028 CTGTTTGACCAAATGGAGATAGG + Intronic
1170485611 20:16812957-16812979 CTATGTGAGCAAAATGAGAAAGG + Intergenic
1171105801 20:22431119-22431141 CTCTGCCACCAAAAGGAGCCAGG - Intergenic
1173330395 20:42071374-42071396 ATATGAGCCCAAAAGGAACTGGG - Intergenic
1175604320 20:60299734-60299756 CTATGTGACCCCAGGGAGGTTGG + Intergenic
1176194077 20:63829130-63829152 CTCTGTGACCACCAGGGGCTGGG + Intronic
1179827183 21:43972670-43972692 CTATGTGAGCCAGAGAAGCTTGG - Intronic
1179921948 21:44512281-44512303 CTCTGAGACCCACAGGAGCTAGG + Intronic
1179995041 21:44970372-44970394 CAATGGGGCCAAAGGGAGCTGGG - Intronic
1183707531 22:39483653-39483675 CTGGGTGAGCAAAAGGGGCTAGG - Intronic
1184561996 22:45268823-45268845 CTTTGAGAGGAAAAGGAGCTCGG + Intergenic
949289036 3:2442185-2442207 CAATGTGACCAAAATGACATAGG - Intronic
952478868 3:33739234-33739256 CTCTGTGACCAACCGGGGCTGGG + Intergenic
953356573 3:42261369-42261391 CTATGTGACAAACATGAACTAGG - Intronic
953505553 3:43482681-43482703 CTGTGTGACCAAAAAGGCCTTGG + Intronic
953607715 3:44422673-44422695 CTGTGTCAACAAAATGAGCTTGG + Intergenic
957934162 3:86920967-86920989 CTCTGTGACCAGAATGAGATTGG + Intergenic
961771728 3:129254964-129254986 CTCTGTGGGCAAAAGGAGCAGGG - Exonic
964451681 3:156818498-156818520 TTTTGTCACCAAAAGGAACTGGG - Intergenic
965473518 3:169125139-169125161 CTCTGTGAACAAAAGGTACTAGG + Intronic
969242842 4:5912427-5912449 CTTTATGAAGAAAAGGAGCTGGG + Intronic
970465944 4:16323221-16323243 CTCTGTGACCCAGAGGAGCCTGG + Intergenic
973687955 4:53393237-53393259 CTATGGGACTAAAATGAACTAGG + Intronic
975970693 4:80032345-80032367 ATATGTAATCAAAAGGAGCTAGG + Intronic
978066779 4:104414461-104414483 ATATTTGAACAAAAGGAGCAAGG + Intergenic
981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG + Intronic
983463620 4:168058087-168058109 CTAACAGACCAAAAGGAGGTAGG - Intergenic
983862672 4:172727180-172727202 CTATGGGCACACAAGGAGCTTGG - Intronic
988128777 5:27076699-27076721 CTATTTCACAAAAAGGAGTTGGG + Intronic
991994563 5:72374524-72374546 CTATGTGACCAATAAGATATTGG + Intergenic
992399490 5:76398924-76398946 CTAAGTGACCTACAAGAGCTTGG - Intergenic
993717655 5:91291501-91291523 CTAAGGGACCCAAAGGAGTTTGG - Intergenic
994763371 5:103884694-103884716 CTATGTGACCAGAGGCATCTCGG + Intergenic
998688768 5:144562241-144562263 CTATATCAACAAAAGGAGCATGG - Intergenic
1002583188 5:180223001-180223023 CTATGAGACCAGAAAGAGCATGG + Intergenic
1008409411 6:51155861-51155883 CTATGTCACTAAAAGGACTTGGG - Intergenic
1017541916 6:155412003-155412025 GCATGTGACAAAAAGTAGCTTGG + Intronic
1029868087 7:103658001-103658023 CAATGTGAGCTAAAAGAGCTGGG + Intronic
1031112175 7:117624310-117624332 CTATGTGACCTAGAGGGGCATGG + Intronic
1031943178 7:127811175-127811197 CTAAGTGCCTAAAAAGAGCTGGG - Intronic
1034174151 7:149087568-149087590 CTATGTGAACAAACAGAACTGGG + Intronic
1035172530 7:157026086-157026108 CTATGTGATAAAAATGAGCATGG - Intergenic
1036030832 8:4970441-4970463 TTATGTGACCAAAATGACATCGG + Intronic
1045406341 8:101870391-101870413 TTATGTGAACAAAGGGATCTTGG - Intronic
1046408648 8:113809949-113809971 CTTTTTGACCAAAATGAGCCTGG + Intergenic
1048848072 8:138618319-138618341 CTATGTCAGCCAGAGGAGCTTGG + Intronic
1049146768 8:141006318-141006340 CTATGTGAGCAGGAGGGGCTGGG - Intergenic
1051565383 9:18491014-18491036 CTATGTGATAAAAGGGAGCTTGG + Intronic
1052963463 9:34319981-34320003 CTGTGAGACCAAATGGAGCTAGG + Intronic
1054840417 9:69732285-69732307 CTTTGTGACCAAAGGAAACTTGG - Exonic
1056394510 9:86169174-86169196 CAATAAGCCCAAAAGGAGCTAGG + Intergenic
1056973951 9:91233408-91233430 CCATGGGCCCAAAAGGACCTGGG + Intronic
1057496334 9:95564275-95564297 TAGTGTGGCCAAAAGGAGCTGGG - Intergenic
1060330095 9:122660327-122660349 CTTTTTCACCAAAAGGAGTTAGG + Intergenic
1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG + Intergenic
1199882423 X:151985090-151985112 GTGTGTGACCAGAAGTAGCTAGG + Intergenic
1200795484 Y:7337598-7337620 CCAGGTGAGCAAAAGGAGATAGG + Intergenic
1200822064 Y:7596437-7596459 CTATGTGAGCAAAGGGAGACAGG + Intergenic
1202238237 Y:22737580-22737602 CTATGTGAACAAAGGGAGACAGG - Intergenic