ID: 1101733663

View in Genome Browser
Species Human (GRCh38)
Location 12:107446719-107446741
Sequence GTGGATTATCTGGTAGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101733660_1101733663 -1 Left 1101733660 12:107446697-107446719 CCTGGAGAAAAGAATCATTACAG 0: 1
1: 0
2: 1
3: 30
4: 275
Right 1101733663 12:107446719-107446741 GTGGATTATCTGGTAGACACAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1101733658_1101733663 16 Left 1101733658 12:107446680-107446702 CCAGCAAAGTCCTTAATCCTGGA 0: 1
1: 0
2: 1
3: 17
4: 163
Right 1101733663 12:107446719-107446741 GTGGATTATCTGGTAGACACAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1101733659_1101733663 6 Left 1101733659 12:107446690-107446712 CCTTAATCCTGGAGAAAAGAATC 0: 1
1: 0
2: 2
3: 24
4: 232
Right 1101733663 12:107446719-107446741 GTGGATTATCTGGTAGACACAGG 0: 1
1: 0
2: 0
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101733663 Original CRISPR GTGGATTATCTGGTAGACAC AGG Intronic
904600912 1:31672261-31672283 GTGGCTTCTCTGGGATACACAGG - Intronic
905530327 1:38673419-38673441 GTGGTTTATCTGGGAGACGAAGG + Intergenic
908049375 1:60211106-60211128 TTGTATTTTTTGGTAGACACAGG + Intergenic
909109528 1:71457146-71457168 GTGGAGAATGTGGTAGACAAAGG - Intronic
911147157 1:94563369-94563391 GTGGAATATCTGGGAGATATTGG - Intergenic
912538506 1:110394963-110394985 GGGGGATATGTGGTAGACACAGG + Intergenic
918191675 1:182181505-182181527 GTGGGTTTGCTGGTTGACACTGG + Intergenic
919576925 1:199321865-199321887 TTGTATTTTTTGGTAGACACAGG + Intergenic
921986099 1:221314334-221314356 CTGGATTATCTGGTGCATACAGG - Intergenic
923000193 1:230000707-230000729 GTGGATTAGCTGGAAGGCAGCGG + Intergenic
923707310 1:236354565-236354587 GTGGTTTTTCTTGTAGCCACAGG - Intronic
924041160 1:239985227-239985249 TTGGATTTTCTGGTTGATACTGG - Intergenic
1064790689 10:18954832-18954854 GTAGTTTATCTGAGAGACACAGG - Intergenic
1066084980 10:31967459-31967481 TTGTATTTTCTGGTAGAGACAGG + Intergenic
1066409895 10:35157458-35157480 GTATATTTTCTGGTAGAGACAGG - Intronic
1066687017 10:37991170-37991192 TTGTATTATTTGGTAGAGACCGG + Intergenic
1070816094 10:79324494-79324516 GGGGATTATGTGGCAGAGACTGG - Intergenic
1071057369 10:81527428-81527450 CTGGATTTTCTGATTGACACTGG + Intergenic
1071279565 10:84087759-84087781 TTGTATTTTTTGGTAGACACAGG + Intergenic
1073454588 10:103628873-103628895 GTGGGCAATCTGGGAGACACAGG - Intronic
1077798013 11:5511276-5511298 GTTGATTTCATGGTAGACACAGG + Intronic
1078698814 11:13661330-13661352 GTGGCTTACCTGTTAGACATTGG - Intergenic
1078791618 11:14548324-14548346 GTGGATTTCAAGGTAGACACTGG + Intronic
1080188769 11:29521595-29521617 GTGGACTTTATGGTAGACTCTGG + Intergenic
1082071788 11:47945286-47945308 TTGGATTGTTTGGTAGAGACAGG + Intergenic
1087441465 11:98188814-98188836 GTGTATTTTTTGGTAGAGACAGG - Intergenic
1087644603 11:100793443-100793465 ATGGATTACCTGGGAGACTCAGG - Intronic
1092801102 12:12167730-12167752 GTGCACTATCTGGTAAACACTGG + Intronic
1093103371 12:15055042-15055064 GTGGTTTTTCTGGTAGCCATAGG + Intergenic
1094602072 12:31917791-31917813 GTGGAAGGTCTGGCAGACACTGG + Intergenic
1094616617 12:32042042-32042064 TTGGTTTATTTGGTAGAGACAGG + Intergenic
1096099209 12:48958755-48958777 TTGTATTTTCTGGTAGAGACAGG - Intergenic
1097226844 12:57481994-57482016 GTGGATTTTCTGGTGGACAGTGG - Intronic
1098445835 12:70564658-70564680 TTGTATTTTCTTGTAGACACAGG - Intronic
1101733663 12:107446719-107446741 GTGGATTATCTGGTAGACACAGG + Intronic
1102385061 12:112501852-112501874 GTGAATTCTCTTGTAGAAACAGG + Intronic
1105682827 13:22746644-22746666 GTGGATTCTCTGAAAGACAATGG + Intergenic
1107553994 13:41501661-41501683 TTGTATTTTCTGGTAGAGACAGG - Intergenic
1109960240 13:69619845-69619867 GTGGCTAATCTGGAAGACTCTGG - Intergenic
1112117882 13:96377191-96377213 TTGTATTTTTTGGTAGACACAGG - Intronic
1113582504 13:111439048-111439070 GTGGAAGAGCTGGTAGAAACAGG - Intergenic
1115020942 14:28681286-28681308 GTGTATTTTTTGGTAGAGACAGG + Intergenic
1115319179 14:32060149-32060171 GTGGATATTCAGGTAGCCACAGG - Intergenic
1116005564 14:39286895-39286917 GTGTATTTTTTGGTAGAGACAGG + Intronic
1118783782 14:69028496-69028518 TTGTATTTTTTGGTAGACACGGG - Intergenic
1120016278 14:79477477-79477499 GTGAATTATCTGGTACATAGTGG + Intronic
1120989348 14:90361574-90361596 TTGTATTTTTTGGTAGACACTGG + Intergenic
1121360799 14:93257016-93257038 CTGTATTATGTGGAAGACACAGG + Intronic
1122962097 14:105099120-105099142 GTGGATTATCTGTTCCCCACAGG + Intergenic
1123219448 14:106842645-106842667 GTGGACTTTATGGTAGATACTGG - Intergenic
1125143338 15:36436244-36436266 GTAGATTGTCAGATAGACACAGG + Intergenic
1126458367 15:48889317-48889339 GTGGATTCTCTAGGTGACACTGG + Intronic
1128388458 15:67166818-67166840 GTGGTTCATCTGGTGGTCACTGG - Exonic
1128697857 15:69781787-69781809 GTGGATTATTTGTGAGTCACCGG - Intergenic
1129292428 15:74578536-74578558 GTGGAGTGTCTGGGGGACACAGG + Intronic
1132043523 15:98545803-98545825 GTGTATTTTTTGGTAGAGACAGG - Intergenic
1133933086 16:10248264-10248286 TTGTATTTTCTAGTAGACACAGG + Intergenic
1139412087 16:66771020-66771042 GTGTATTTTTTTGTAGACACAGG + Intronic
1142211346 16:88810072-88810094 GTGGATGATCTGCTGGCCACTGG - Exonic
1142681329 17:1550699-1550721 TTGTATTTTCTGGTAGAGACAGG + Intronic
1145781489 17:27566562-27566584 GAGGATTATGAGGTAGGCACGGG + Intronic
1150154012 17:62835416-62835438 TTGTATTTTCTGGTAGAGACGGG - Intergenic
1150466463 17:65397104-65397126 GTGGAGTATCTGGAAGAAAGAGG + Intergenic
1154109075 18:11550529-11550551 ATGGATTTTATGGTAGATACCGG - Intergenic
1156386278 18:36608003-36608025 GAGCATTATCTGGTTGACTCTGG - Intronic
1156592673 18:38509307-38509329 AAGGATTATTTGGTAGACAGGGG + Intergenic
1158268081 18:55682118-55682140 GTGTATTTTTTGGTAGAGACAGG - Intergenic
1158933344 18:62342227-62342249 TTGTATTTTTTGGTAGACACGGG - Intronic
1160265264 18:77336408-77336430 CTGGATTATCTGGGGGACCCTGG + Intergenic
1162338323 19:10075506-10075528 TTGTATTTTTTGGTAGACACAGG - Intergenic
1162624078 19:11869828-11869850 GTGTATTATTTAGTAGAGACGGG + Intronic
1164988358 19:32665937-32665959 GTGTATTTTTTGGTAGAGACGGG + Intronic
1166636881 19:44458422-44458444 GGGGAGTAGCTGGGAGACACGGG + Intergenic
1167559383 19:50216301-50216323 GTGTATTTTTTTGTAGACACAGG - Intronic
1168368922 19:55814782-55814804 CTGGATTATCTAGGACACACGGG + Intronic
927277172 2:21272044-21272066 ATGGCTTTTCTGGTAGCCACAGG - Intergenic
928152964 2:28848869-28848891 GTGGATTTTTTGGTAGAGACGGG - Intronic
928968297 2:36999504-36999526 GTGTATTTTTTGGTAGAGACGGG - Intronic
931826411 2:66004943-66004965 TTTGATTAACTGGGAGACACCGG - Intergenic
932096401 2:68853461-68853483 TTGGAATATCTGGTACACACAGG + Intergenic
932407794 2:71525394-71525416 TTGTATTATTTGGTAGAGACAGG + Intronic
935113496 2:100113291-100113313 GTGCATTATCTTCTAGACAGTGG - Intronic
938781861 2:134591710-134591732 GAGCTTTATTTGGTAGACACTGG - Intronic
940811846 2:158252680-158252702 TTGGATTATAGGGTAGACACAGG - Intronic
940922274 2:159321901-159321923 GTGGATTATCTGTAACACAAAGG + Intronic
941314825 2:163979363-163979385 TTGTATTTTCTGGTAGAGACGGG + Intergenic
1168759127 20:336828-336850 TTGTATTATTTGGTAGAGACGGG + Intergenic
1172662689 20:36578238-36578260 CTGTATTTTTTGGTAGACACAGG - Intronic
1172713561 20:36946237-36946259 TTGTATTTTTTGGTAGACACAGG - Intronic
1182170753 22:28226597-28226619 GTGTATTTTTTGGTAGAGACAGG + Intronic
1183273381 22:36875888-36875910 GTGGCTCATCTGGGAGCCACTGG - Exonic
1184637089 22:45841481-45841503 GTGGAGGAGCTGGGAGACACAGG + Intronic
952929407 3:38347505-38347527 TTGTATTTTCTGGTAGAGACCGG - Intronic
955018090 3:55091137-55091159 GAGCTTTATTTGGTAGACACAGG - Intergenic
956083009 3:65579411-65579433 GTGGTGTATCTGGTAGTCATAGG - Intronic
966469636 3:180274656-180274678 GTGTATTGTCTGGTGGCCACAGG + Intergenic
966603410 3:181797732-181797754 GTGGATTATTTGAAAGACACAGG + Intergenic
971455885 4:26843369-26843391 ATGGGTTATCTGTAAGACACTGG - Intergenic
972479847 4:39486762-39486784 ATGGACTTTATGGTAGACACTGG + Intergenic
975978476 4:80127001-80127023 GTGGTTGGTCTGGTAGACTCTGG + Intergenic
978438372 4:108709591-108709613 GTGGATTATCTGGCTGTCCCAGG - Intergenic
980081735 4:128351313-128351335 GGGATTTATCTGGTAGTCACTGG + Intergenic
980878011 4:138681563-138681585 GTGGAATGTCTGTTAGACCCAGG - Intergenic
984137146 4:175954992-175955014 TTGGATTCTCAAGTAGACACAGG - Intronic
987958215 5:24767937-24767959 GTGTATTTTTTGGTAGAGACGGG - Intergenic
988092943 5:26566904-26566926 TGGCATTTTCTGGTAGACACTGG - Intergenic
990287016 5:54310421-54310443 ATGGATTATCTGGTAGGTGCAGG - Exonic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
995927875 5:117397150-117397172 GTAGATTATCAGAAAGACACAGG - Intergenic
997261528 5:132469089-132469111 CTGGATTATTGGGTAGAAACTGG + Intronic
1003559484 6:7169178-7169200 CTGGCTTATCAGGTAGACCCAGG - Intronic
1004074617 6:12333602-12333624 ATGGAATATCTGGTAGAGATGGG - Intergenic
1005751987 6:28892008-28892030 TTGTATTTTCTGGTAGAGACAGG + Intergenic
1011571264 6:88738470-88738492 TTGTATTATTTGGTAGAGACAGG - Intronic
1012748943 6:103132543-103132565 GTGTATTTTTTAGTAGACACGGG + Intergenic
1013563816 6:111334813-111334835 GTTGATTATGTTATAGACACAGG + Intronic
1014506484 6:122265863-122265885 CTAGATTGTCTGGTGGACACTGG - Intergenic
1016287757 6:142492038-142492060 GTGTATTTTTTGGTAGAGACAGG - Intergenic
1018894940 6:168007771-168007793 GTGGTTTTTCTTGTAGCCACAGG + Intronic
1018908185 6:168087238-168087260 TTGTATTTTTTGGTAGACACAGG + Intergenic
1021051019 7:15985000-15985022 GTGCAGTATCTGCTACACACTGG + Intergenic
1021209565 7:17830534-17830556 GTAGATTATCTTGAAAACACTGG + Intronic
1021963846 7:25898435-25898457 TTGTATTATTTGGTAGAGACAGG + Intergenic
1022588521 7:31638946-31638968 TTGTATTTTTTGGTAGACACGGG + Intronic
1026192638 7:68143461-68143483 GTGGATAATTTGGCAGACAGGGG + Intergenic
1027690893 7:81343445-81343467 TTGTATTTTTTGGTAGACACGGG + Intergenic
1029262956 7:99315721-99315743 GTCGTCTATGTGGTAGACACTGG - Intergenic
1029347587 7:99989815-99989837 TTTGATTCTCTGGTAGGCACTGG - Intergenic
1030836101 7:114288088-114288110 GTGGAAGATCTGGAAGAAACAGG + Intronic
1034073977 7:148214137-148214159 GTGCAGGATCAGGTAGACACAGG - Intronic
1034088046 7:148338337-148338359 CTGGATTTTCTAATAGACACAGG - Intronic
1034485990 7:151362901-151362923 GTGGAGGATTTGGTAGTCACAGG + Intronic
1034577064 7:152009499-152009521 GTGGCTCATCTCTTAGACACAGG + Intronic
1036414725 8:8536450-8536472 GTGGATCTCCTTGTAGACACTGG + Intergenic
1037334440 8:17778634-17778656 TTGGATTTTTTGGTAGAGACAGG - Intronic
1038582884 8:28765300-28765322 GTGGCTTAGCTGGTCGACCCTGG - Intergenic
1039043718 8:33431373-33431395 TTGTATTTTTTGGTAGACACTGG - Intronic
1039553890 8:38463075-38463097 GTGTATTTTTTGGTAGACACAGG + Intronic
1042412911 8:68484655-68484677 GTGGATATTCTGCTAGACACTGG + Intronic
1045058387 8:98389801-98389823 TTGGATTATGTGTTAGAGACAGG + Intergenic
1046026400 8:108729413-108729435 CTGGATTATCTCTTATACACTGG - Intronic
1046262898 8:111793902-111793924 GTGGATTATATTTTGGACACAGG + Intergenic
1055011598 9:71572559-71572581 TTGTATTTTCTGGTAGAGACGGG - Intergenic
1055940910 9:81648429-81648451 GTGGGTTACCAGGTATACACAGG + Intronic
1057098012 9:92329741-92329763 GTGTATTTTTTGGTAGACATGGG + Intronic
1057230698 9:93319755-93319777 GTGGCTTTTCTGGTAGGCACAGG + Intronic
1189977741 X:46479253-46479275 GTGTATTTTTTGGTAGAGACAGG - Intronic
1196401675 X:115323513-115323535 GTGTATTTTTTGGTAGACACGGG - Intergenic
1201695875 Y:16825390-16825412 TTGTATTTTCTGGTAGATACCGG - Intergenic