ID: 1101734211

View in Genome Browser
Species Human (GRCh38)
Location 12:107450793-107450815
Sequence ACTGAGAGGCAGGAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1311
Summary {0: 1, 1: 1, 2: 8, 3: 132, 4: 1169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101734201_1101734211 0 Left 1101734201 12:107450770-107450792 CCCTGCTTTGGGAGAGGTGGAGG 0: 1
1: 0
2: 5
3: 30
4: 287
Right 1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG 0: 1
1: 1
2: 8
3: 132
4: 1169
1101734200_1101734211 1 Left 1101734200 12:107450769-107450791 CCCCTGCTTTGGGAGAGGTGGAG 0: 1
1: 0
2: 7
3: 38
4: 340
Right 1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG 0: 1
1: 1
2: 8
3: 132
4: 1169
1101734203_1101734211 -1 Left 1101734203 12:107450771-107450793 CCTGCTTTGGGAGAGGTGGAGGA 0: 1
1: 0
2: 7
3: 28
4: 321
Right 1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG 0: 1
1: 1
2: 8
3: 132
4: 1169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101734211 Original CRISPR ACTGAGAGGCAGGAGGGGGA GGG Intronic
900013646 1:135335-135357 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900014410 1:138301-138323 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900043716 1:491318-491340 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900044275 1:493503-493525 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900065154 1:726321-726343 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900065683 1:728409-728431 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900129188 1:1080422-1080444 ACTGGGTGGGAGGAGGAGGAGGG + Intergenic
900166962 1:1247691-1247713 CCTGAGAGCCCGGAGGGCGAGGG - Intergenic
900285039 1:1894951-1894973 GCTGAGAAGCAGGTGGGGGTGGG - Intergenic
900371948 1:2336148-2336170 GCAGAGAGGCAGGAGGGGTGCGG - Intronic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
900483782 1:2911836-2911858 TCTGAGAGGAGGAAGGGGGAGGG + Intergenic
900496723 1:2979087-2979109 ACTGGGAGGAATGAGGGGGTGGG - Intergenic
900533834 1:3167643-3167665 ACTGGGAGGCAGGGGTGGGGTGG - Intronic
900533994 1:3168117-3168139 ACTGGGAGGCAGGGGTGGGGCGG - Intronic
900534014 1:3168175-3168197 ACTGGGAGGCAGGGGTGGGGTGG - Intronic
900534054 1:3168291-3168313 ACTGGGAGGCAGGGGTGGGGCGG - Intronic
900840723 1:5046650-5046672 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
900883513 1:5399357-5399379 AATGAGTGGAAGGATGGGGATGG + Intergenic
900895383 1:5479591-5479613 TGTGAGAGGCAGGACGGGGCAGG - Intergenic
900974902 1:6010878-6010900 AATGAGTGGCAGGAGGTGCATGG + Intronic
901002318 1:6154905-6154927 GGGGAGAGGCAGGAGGGTGAGGG + Intronic
901089075 1:6629549-6629571 ACTGAGGGGCAGGAAGGGGTCGG - Intronic
901154256 1:7124903-7124925 AGTGGGAGTCAGGAAGGGGAAGG + Intronic
901193153 1:7424643-7424665 ACTGAGAGGAAGGAAGGAGAGGG - Intronic
901260007 1:7864365-7864387 ATTGAGAGACAGGAGGGAGAGGG - Intergenic
901266461 1:7914275-7914297 GCTGGGAGGCAGGGGAGGGAGGG - Intergenic
901428065 1:9196085-9196107 AGGGAAAGGCTGGAGGGGGAAGG + Intergenic
901469191 1:9443880-9443902 ACAGAGAGGGAGGAGAAGGAGGG - Intergenic
901621126 1:10588397-10588419 ACAGGGTGGCAGGAGTGGGAAGG + Intronic
901657146 1:10775920-10775942 ACGGAGAGGCTGCAGCGGGAGGG - Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
902038608 1:13475819-13475841 AGTAAGAGGCAGGAGGGAGGAGG + Exonic
902203934 1:14853564-14853586 ACTGAGAGGCAGGACAGTGTGGG - Intronic
902255423 1:15186071-15186093 GCTGAGTGGGAGGAGGGGGCAGG - Intronic
902399651 1:16150963-16150985 ACTGAAAGGGAGAAGGGAGAGGG + Exonic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902839222 1:19064916-19064938 ACTGAGGCCCAGGAGGGGCAGGG - Intergenic
902870198 1:19309487-19309509 TCTGTGAGTCAGGAAGGGGAGGG - Intronic
903173123 1:21565719-21565741 ACGGAGAGGCAGGTGGGGCTGGG - Intronic
903480869 1:23652407-23652429 AGGGAGAGGGAGGAGGGGGAAGG + Intergenic
903608368 1:24591672-24591694 ACAGAGTGGCAGGAGTGGGGAGG + Intronic
903706139 1:25287275-25287297 ACTGTGGGGCAGGAGGCTGAAGG - Intronic
903721099 1:25406099-25406121 ACTGTGGGGCAGGAGGCTGAAGG + Intronic
903812626 1:26043346-26043368 TGTGAGAGGCGGGAGGAGGAGGG + Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904285838 1:29452812-29452834 ACGGGGATGCAGGAGGGGAAGGG + Intergenic
904300391 1:29550088-29550110 ACTGTGAGGAGGGAGGGGGCGGG - Intergenic
904380499 1:30107384-30107406 ACTGGGAGCCAGGTCGGGGAGGG - Intergenic
904430754 1:30462581-30462603 ACTGGGCTGCGGGAGGGGGAAGG + Intergenic
904442301 1:30539694-30539716 ACTTAGAGGCTAAAGGGGGAGGG - Intergenic
905306404 1:37021792-37021814 ACTGAGAGTGAGGATGGGGCAGG - Intronic
905489408 1:38331916-38331938 ACTGGGAAGCTGGAGGGGAAGGG - Intergenic
905892478 1:41526046-41526068 ACAGAGGGGCAGGAGGTGGCTGG + Intronic
906139371 1:43524635-43524657 CCTGAGAAGCAGGAGTGGGTAGG + Intergenic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906282813 1:44565805-44565827 ACTGGGTTGCAGGACGGGGATGG - Intronic
906476815 1:46174922-46174944 AGTGAAGGTCAGGAGGGGGATGG - Intronic
906501241 1:46342879-46342901 CCAGAGAGGCAGGAGGGAGGTGG - Intronic
906646301 1:47477988-47478010 ACTGAGGGTCAGAAAGGGGAAGG - Intergenic
906726406 1:48047676-48047698 ACTGAGATGGAGGAGGATGAGGG + Intergenic
906916596 1:50017738-50017760 AGAGAGGGGCAGGAGGGTGAGGG + Intronic
906935787 1:50212960-50212982 ACTGTGAGGCAGGAAGAGGAAGG - Intergenic
907190953 1:52648503-52648525 AAGGAGAGGAAGGAGGGTGAAGG - Intronic
907303797 1:53503007-53503029 ACAGAGAGAGAGGAGGAGGAGGG + Intergenic
907592139 1:55685522-55685544 ACTGGGAGGCATGAAGGAGATGG - Intergenic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
908571869 1:65419900-65419922 GGGGAGAGGCAGGAGAGGGAAGG - Intergenic
908810877 1:67981199-67981221 AATGGGAGGCAGGTGGGGGTGGG + Intergenic
908845795 1:68323137-68323159 ACTGAGGGGCAGAAAAGGGATGG - Intergenic
909092840 1:71248014-71248036 ATTGAGAGACAGGAGTGGTATGG + Intergenic
909909899 1:81247241-81247263 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
910015685 1:82520420-82520442 ACTGAGAGGCAGGATGGAAAAGG + Intergenic
910525949 1:88178373-88178395 ACTGAGTGGCAGTGGGGAGATGG - Intergenic
910666815 1:89734501-89734523 ATAGAGAGGAAGGAGGGGAAGGG + Intronic
910738484 1:90489187-90489209 ACTTGGAGGGAGGAGGGGTAGGG - Intergenic
910852021 1:91657744-91657766 ACTTAGGGGCAGGATGAGGAAGG - Intergenic
911215131 1:95184723-95184745 TCTGAGAGGAAAGAGGGGAAGGG - Intronic
911570341 1:99511439-99511461 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
911614478 1:99993446-99993468 ACCGAGAGGGAGAAGGGAGAGGG - Intronic
911716429 1:101138814-101138836 CCTGAGAGGCAGGCAGGGCAAGG - Intergenic
912389516 1:109292638-109292660 ACAGAGAGGGAGGTGAGGGAGGG + Intronic
912560519 1:110548274-110548296 CCTGAGGGGCAGAAGTGGGAAGG - Intergenic
912730324 1:112096597-112096619 ACTGAGAGGCAGGAAGTGGGCGG + Intergenic
912821682 1:112872762-112872784 AGTCAGAGACAGGAGCGGGAGGG - Intergenic
913295979 1:117320908-117320930 ACTGAGGGGCAGGAGAAGGTTGG - Intergenic
913538363 1:119795695-119795717 CCTGAGAACCAGGAGTGGGAGGG - Intronic
913565044 1:120065023-120065045 AGTGAGAGGCAGGGGGTGGATGG + Intronic
913615911 1:120558999-120559021 GCTGCGAGGCAGGCGAGGGAAGG + Intergenic
913633082 1:120728534-120728556 AGTGAGAGGCAGGGGGTGGATGG - Intergenic
913711549 1:121489062-121489084 ATTGAGAGACAGGAGGGCAAAGG + Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914420350 1:147522942-147522964 TCTGAGAGGCTGAAGTGGGAGGG + Intergenic
914456410 1:147841140-147841162 ACCCAGAGGGAGGCGGGGGAAGG - Intergenic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
914574368 1:148951903-148951925 GCTGCGAGGCAGGCGAGGGAAGG - Intronic
914619897 1:149395536-149395558 AGTGAGAGGCAGGGGGTGGGTGG - Intergenic
914689516 1:150012948-150012970 ACTGAGACACAGGAATGGGAAGG - Intergenic
915037711 1:152942696-152942718 ACTGAGAGGAAGGAAGGAAAGGG - Intergenic
915271434 1:154756452-154756474 ACTGAGCCGCAGAAGGGGGCAGG - Intronic
915594474 1:156888292-156888314 ACTAAGACCCAGGAGGGTGAGGG + Intergenic
915631737 1:157157954-157157976 ACTGGGACCCAGCAGGGGGATGG - Intergenic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916054565 1:161059500-161059522 AGTGAGAGGCAGTGGGGAGAAGG - Intronic
917481351 1:175414794-175414816 ACTGGGAGGAAGGACTGGGAAGG + Intronic
917779624 1:178379388-178379410 ACAGAGAGAAAGGAAGGGGAGGG + Intronic
917928702 1:179809303-179809325 ACTGTGAGGAAAGAGGGGGATGG - Intronic
918031724 1:180819935-180819957 ACTTGGACCCAGGAGGGGGAGGG + Intronic
918115477 1:181492744-181492766 ACTCAGAGTCAGGTTGGGGAAGG - Intronic
918117647 1:181510658-181510680 ACTCACAGGCAGGAAGGGAATGG - Intronic
918567737 1:185952208-185952230 ATTGCTGGGCAGGAGGGGGAGGG + Intronic
919538631 1:198820487-198820509 ACTGAGAGACAGCAGGGCCAGGG + Intergenic
919829306 1:201529170-201529192 AAAGAGAGGCGGGAGGGAGAGGG - Intergenic
919982040 1:202647820-202647842 AGGGGGAGGGAGGAGGGGGAAGG - Intronic
920003742 1:202817353-202817375 ACTGGGAGGCTGGAATGGGAGGG + Intergenic
920025439 1:202990895-202990917 GCTGAGAGACAGGAGAGGGGAGG - Intergenic
920045436 1:203129348-203129370 CCAGAGAAACAGGAGGGGGATGG + Intronic
920637250 1:207715802-207715824 ACTGGGAGGCTGAAGTGGGAGGG - Intronic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
921011914 1:211150213-211150235 AGTGAGAGAGAGTAGGGGGAAGG + Intergenic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921390944 1:214612914-214612936 AATGGGGGGCAGGAAGGGGAAGG + Intronic
921412288 1:214848759-214848781 GCTGAAAGGCAGGAGGAAGATGG - Intergenic
921671169 1:217925330-217925352 CCTGGGAGGCAGGAGGGCTATGG - Intergenic
922007397 1:221545743-221545765 ACTGAAGGGCAGGTAGGGGAAGG + Intergenic
922048350 1:221967758-221967780 ATTGCTAGGCAGGTGGGGGAGGG - Intergenic
922100059 1:222472330-222472352 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922100264 1:222473158-222473180 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922100465 1:222473958-222473980 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922233343 1:223704950-223704972 AGGGAGCGGCAGGAGGGGGCTGG - Intronic
922262083 1:223951796-223951818 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922734185 1:227970782-227970804 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
922734981 1:227973918-227973940 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
922813907 1:228435565-228435587 ATTGAGGGGCAGGAGGGGGTCGG - Intergenic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923482382 1:234397324-234397346 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
923760979 1:236843823-236843845 ACTGAGAAGCAGGTTTGGGATGG + Intronic
923983398 1:239352381-239352403 ACAGAGAACCAGGAGAGGGAAGG - Intergenic
924322742 1:242865900-242865922 ACATAGAGGCAGGAGGGGCGAGG - Intergenic
924343257 1:243053995-243054017 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
924343728 1:243055875-243055897 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
924517770 1:244780609-244780631 ACGGAGGGGCAGGTGGGGGCAGG - Intergenic
924779161 1:247131200-247131222 CCTGAGAGCCAGGCGGGGAAGGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062833577 10:622257-622279 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1062833584 10:622270-622292 AGGGGGAGGGAGGAGGGGGAGGG + Intronic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063086062 10:2818532-2818554 ACTGAGAGGGAGGGAGGGGATGG + Intergenic
1063150683 10:3333615-3333637 CCTGAGAGGCAGGAGCTGGTGGG + Intergenic
1063201982 10:3792936-3792958 ACTGAGAGAAAGAAAGGGGAAGG + Intergenic
1063507937 10:6618527-6618549 ACTAGGAGGAAGGAGGGGGTTGG + Intergenic
1063509663 10:6633503-6633525 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1063527743 10:6801000-6801022 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1064107724 10:12514207-12514229 ACTATGAGGCAAGAGGGTGATGG + Intronic
1064321551 10:14310002-14310024 ACTGAGATGCACGAGGGCGAAGG - Intronic
1064460333 10:15529002-15529024 ACAGGGAGGAAGGAAGGGGAAGG - Intronic
1065121992 10:22539180-22539202 ACACAGAGCCAGGAGGGGGCTGG + Intronic
1065169261 10:23010696-23010718 AGGGAAAGGAAGGAGGGGGAAGG - Intronic
1066084421 10:31962485-31962507 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1066289768 10:34003067-34003089 AATGAGAGGCCGGAGGAGGAAGG + Intergenic
1066442058 10:35448730-35448752 TCAGAGAGGCAGCAGGGGCAGGG + Intronic
1066728904 10:38419092-38419114 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
1066733235 10:38451597-38451619 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1067080540 10:43209957-43209979 ACTGAGAGGCTGTAGGGGAAGGG - Intronic
1067089617 10:43259906-43259928 ACGGAGGGGCAGGGCGGGGACGG + Intronic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1068058410 10:52037672-52037694 ATTGCTGGGCAGGAGGGGGAGGG + Intronic
1068447985 10:57147274-57147296 AAGGAGAGGCAAGAGTGGGAAGG + Intergenic
1068590392 10:58846940-58846962 ACTGAGAGTCAGGAAGTGGAAGG + Intergenic
1068805080 10:61186160-61186182 ACTAAGAGGAGGAAGGGGGAAGG + Intergenic
1069249656 10:66252731-66252753 ACTGAGTGTCAAGAGGTGGAAGG + Intronic
1069344937 10:67457813-67457835 AGAGAGAGGCAGGAGAGAGATGG - Intronic
1069725302 10:70573718-70573740 ACGTAGAGGCAAGAGGGGGAAGG - Intergenic
1069841299 10:71341080-71341102 AATGAGAGGCAGGAGCTGGAAGG - Intronic
1069982318 10:72260993-72261015 ACTGAGGAACGGGAGGGGGATGG - Intergenic
1070281862 10:75055576-75055598 CCTGAGAGGCAGGTAGGGAATGG + Intronic
1070765903 10:79056275-79056297 ACTGAGACCCAGGCAGGGGAAGG - Intergenic
1070769864 10:79075937-79075959 ACTGGCAGGGAGGATGGGGACGG + Intronic
1070960711 10:80498345-80498367 ACTGAGGCCCAGGAGAGGGATGG + Intronic
1070979522 10:80633081-80633103 CCTGGGAGGCAGGAGAGTGATGG + Intronic
1071076247 10:81756765-81756787 ACTGAGAGACAGGAGAGCGGGGG - Intergenic
1071228427 10:83558834-83558856 ACTGAGAGGCAAGATGGAGTGGG + Intergenic
1071482334 10:86074318-86074340 ACTGAGATGGACGAGTGGGAGGG - Intronic
1071826794 10:89333497-89333519 CCCAAGAGGCAGGAGGGGGGAGG + Intronic
1072000939 10:91195067-91195089 GCTGAGAGTGAGGATGGGGAAGG + Intronic
1072105143 10:92266609-92266631 AATGGGAAGCGGGAGGGGGAAGG + Intronic
1072442809 10:95471778-95471800 AGTGGAAGGCAGGAGAGGGAAGG + Intronic
1072633020 10:97159816-97159838 GTTGAGAGTCAGGAGGGTGAGGG - Intronic
1073045908 10:100638038-100638060 AATGTGAGGCAGGAGGGAGGTGG + Intergenic
1074532059 10:114304979-114305001 ACGCAGATGCAGGAGGGGGCGGG + Intronic
1074532071 10:114305015-114305037 ACACAGATGCAGGAGGGGGCGGG + Intronic
1074714265 10:116203551-116203573 AGAGAGAGGCAGCTGGGGGAAGG + Intronic
1075320666 10:121489398-121489420 ACAGAGAGGCAGCTGAGGGAAGG - Intronic
1075625098 10:123958282-123958304 ACTCAGGGGCAGGAGTGGGAAGG + Intergenic
1075958443 10:126545735-126545757 ACTGAGAGAGAAGAGGGGGAGGG - Intronic
1076009359 10:126974994-126975016 TATGGGAGGCAGGAGGAGGAAGG - Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076468693 10:130703684-130703706 CCTGAGAGGCAGTAGGAAGAAGG + Intergenic
1076574224 10:131453357-131453379 GCAGAGAGGCGGGAGGTGGATGG + Intergenic
1076643516 10:131935330-131935352 ACTCAGAGACAGGAAGGGCAAGG - Intronic
1076698070 10:132256687-132256709 AGTGAGAGGCAGGGGTGGGTGGG - Intronic
1076778051 10:132709181-132709203 AGGGAGAGGCCCGAGGGGGAGGG - Intronic
1076806789 10:132862791-132862813 CAGGAGAGGCTGGAGGGGGACGG + Intronic
1076969990 11:127549-127571 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1076970607 11:129978-130000 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077466458 11:2735928-2735950 AGTCAGAGGCAGGAGGAGGTGGG + Intronic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1077850855 11:6073747-6073769 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1078046186 11:7916071-7916093 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1078068451 11:8093239-8093261 ACTGAGGGGGGCGAGGGGGAGGG + Intronic
1078578621 11:12521721-12521743 AGTGGGAGGCAGGAGTGTGAGGG + Intronic
1078729317 11:13961535-13961557 ACTGAGAGGCAGGGGGCTTATGG + Intergenic
1078869127 11:15327792-15327814 TCTTAGAGGGAGAAGGGGGATGG + Intergenic
1078908770 11:15711737-15711759 ATTTAGAGGCAGGAGGAGCAAGG - Intergenic
1078929742 11:15903918-15903940 ACGCCGAGGCAGGAGGGGAAAGG + Intergenic
1079085816 11:17444199-17444221 ACTGGGAGGCAGGTGGTGAAGGG - Intronic
1079311971 11:19374899-19374921 ACTGAGAATCAGGAAGGGGATGG - Intronic
1079621923 11:22566374-22566396 GCTGGGAGGCAGCAGGGGAAGGG + Intergenic
1079691098 11:23417992-23418014 AATGAGAGGCTGGAGGGGTGGGG + Intergenic
1080027970 11:27632986-27633008 ATTGCCGGGCAGGAGGGGGAAGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080866315 11:36198574-36198596 ATGCAGAGGCAGGAGTGGGATGG - Intronic
1081575772 11:44317807-44317829 AATGAAAGGGAGGAGGGGGAAGG - Intergenic
1081700087 11:45147134-45147156 GCTGGGAGGAAGGAGGCGGAGGG - Intronic
1082039629 11:47674196-47674218 AAGGAGTGGCAGGAGGGTGAAGG + Intronic
1082099708 11:48162386-48162408 AGGGAGAGGGAGGAGGGAGAGGG - Intronic
1082942726 11:58725608-58725630 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
1082943076 11:58728412-58728434 ACTGAGGGGCATAAGGTGGAAGG - Intronic
1083271850 11:61576734-61576756 CAGGAGGGGCAGGAGGGGGAGGG + Intronic
1083274250 11:61587892-61587914 GCCCAGAGGGAGGAGGGGGACGG + Intergenic
1083276474 11:61599812-61599834 TCTGAGGGGCAGGAGGGGAGGGG + Intergenic
1083430244 11:62610690-62610712 ACTGAGATGGAGGAGGTCGAGGG + Intronic
1083579783 11:63817783-63817805 ACTGCGAGGGGAGAGGGGGAGGG - Exonic
1083616363 11:64028465-64028487 GGTGGGAGGCAGGAGGCGGAAGG + Intronic
1083803504 11:65059964-65059986 ACGGAGAGCCAGGAGGGGCTGGG + Intergenic
1083808452 11:65088629-65088651 AGTGAGTGGCAGGAGTGGGAGGG - Exonic
1083871366 11:65490346-65490368 ACTAAGAGACAGGAGGGAGGGGG + Intergenic
1083886428 11:65575717-65575739 ACTGAGACCCAGAAAGGGGAAGG - Intergenic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084537270 11:69764548-69764570 AGTGAGAGGCTGCTGGGGGAGGG + Intergenic
1084596947 11:70122627-70122649 ACAGAGAGAGAGAAGGGGGAGGG - Intronic
1084764972 11:71302288-71302310 ACTGCGGGGCTGGATGGGGAAGG - Intergenic
1084945462 11:72635998-72636020 ACTGGGAGACAGGAAGGGCATGG - Intronic
1085024837 11:73230325-73230347 ACTGAGAGCCAAGCAGGGGAAGG - Intronic
1085050417 11:73377314-73377336 AGTAAGAGGCAGGAGGAGGAGGG + Intronic
1085279231 11:75319476-75319498 ACAGAGAGGCAGGGTGGGAAGGG - Intronic
1085618488 11:78020113-78020135 ACTGAAAGGTAGGAGGGGTCAGG + Intronic
1085880881 11:80464643-80464665 ACTTGGAGGCAGAAGAGGGAAGG - Intergenic
1086249682 11:84798394-84798416 AAAGAGAGGAAAGAGGGGGAAGG - Intronic
1087129988 11:94660457-94660479 ACTGAGAGGCAGATGCTGGATGG - Intergenic
1087187826 11:95220399-95220421 ACTGGTTGGCAGGAGGGGGAGGG + Intronic
1087636954 11:100712565-100712587 ACTGAGTGGCAGGTGGTGGGAGG + Intronic
1088895110 11:114072545-114072567 ACTGACAGGCAGGAAAGGGAAGG - Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089189046 11:116641159-116641181 CATGTGGGGCAGGAGGGGGATGG - Intergenic
1089359074 11:117874556-117874578 CCAGGGAGGCAGGAAGGGGAGGG - Intronic
1089586795 11:119514738-119514760 AGTGAGCAGTAGGAGGGGGATGG - Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090177209 11:124661555-124661577 GATGAGAGGTAGGAGGGTGATGG - Intronic
1090248506 11:125234974-125234996 AGTGAAAGCCAGGATGGGGAAGG - Intronic
1090254434 11:125273396-125273418 ACCGAGGGGCAGGAGGAGGCGGG + Intronic
1090268833 11:125371530-125371552 ACTGGAGGGGAGGAGGGGGAGGG - Intronic
1090861179 11:130653957-130653979 ACTGAGAGGGTGGAAGGGGTGGG - Intergenic
1091059268 11:132446319-132446341 ACAGAGAGGCAGAGGAGGGAGGG + Intronic
1091081424 11:132672510-132672532 ACAGAGAGCAAGGAGGGAGATGG - Intronic
1091338200 11:134789312-134789334 CCTGGGAGGCAGGAGAGCGACGG + Intergenic
1091363974 11:135001661-135001683 ACGGAGAAGCAGGAAGGAGAGGG + Intergenic
1091636285 12:2199334-2199356 ACTGAGGAGGAGGAAGGGGAGGG - Intronic
1091790925 12:3271752-3271774 AGGGAGAGGCAGGAGGGGCAGGG - Intronic
1092019149 12:5185935-5185957 ACTGCCAGGCAGGGAGGGGACGG - Intergenic
1092226362 12:6750672-6750694 ACTGAGAGCAAGGCCGGGGAAGG + Intronic
1092653047 12:10655012-10655034 ACAGAGAGGGAGGAAAGGGAAGG - Intronic
1092732220 12:11545645-11545667 GCTGAGTGGCAGGGGGAGGAAGG - Intergenic
1092739386 12:11613605-11613627 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1092746500 12:11677271-11677293 AGAGAGAGGCAGGAGGAGGGAGG - Intronic
1092789648 12:12060200-12060222 ATTGCTGGGCAGGAGGGGGAGGG - Intronic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1092997151 12:13961194-13961216 ACAGAGTGGCAGGGGAGGGAAGG + Intronic
1093071222 12:14708779-14708801 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1093093228 12:14944140-14944162 AATGAGAGGCGGGAAGGTGATGG - Intronic
1093172841 12:15878497-15878519 ACTTGGAGGGAGGAGTGGGAGGG + Intronic
1093850713 12:24034347-24034369 GCTGAGAGGCAGGAGAGAGGAGG - Intergenic
1094250529 12:28354985-28355007 AAGGAGAGGCAGGAGGGAGAAGG - Intronic
1094487013 12:30933481-30933503 GCTGAGAGGAAGGAGCTGGAAGG - Intronic
1095297120 12:40539718-40539740 ATTGGGTGGGAGGAGGGGGAAGG - Intronic
1095432159 12:42145319-42145341 ACTTAGAGGCTGGGGGAGGATGG - Intergenic
1096468799 12:51863835-51863857 TCTGAGAGGCCGGGGGAGGAGGG + Intergenic
1096468886 12:51864184-51864206 TCTGGGAGGCGGGAGGGTGATGG - Intergenic
1096525319 12:52206909-52206931 ACAGAGAGGGAGGTGGGGGCCGG + Intergenic
1096556830 12:52409017-52409039 AGGGAGAGGGAGGAGGGAGAGGG - Intergenic
1096713397 12:53475081-53475103 ATTTAGAGCCAGGAGAGGGATGG - Intronic
1096745687 12:53725462-53725484 AGTGTGAGACAGGATGGGGACGG - Intronic
1096869849 12:54586486-54586508 ACAGAGTGGCAGGCGGTGGAGGG - Intronic
1097493772 12:60301870-60301892 ACTGAGAGGCATGAGGCAGAAGG - Intergenic
1097931567 12:65193168-65193190 ACTGAGAGGCATAAGGCAGAAGG + Intronic
1098205081 12:68100465-68100487 AATCAGAGGCAGGAGAGGGTAGG + Intergenic
1098941246 12:76539047-76539069 ACTGGGGGGGGGGAGGGGGAGGG + Intronic
1099304608 12:80937788-80937810 AAGGAGGGGGAGGAGGGGGAAGG + Exonic
1099983127 12:89629827-89629849 ACTTAGAAGCAGGGTGGGGAGGG + Intronic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101856528 12:108448151-108448173 AGTGGGAGGCAGGAGAGGAAGGG - Intergenic
1101990911 12:109484292-109484314 ACTGACAGGCAGCAGTGGTAAGG + Intronic
1102247569 12:111364976-111364998 ACTTACAGGAAGGAGGGGCAGGG + Intronic
1102278499 12:111599986-111600008 ACTGTGTGGCGGGCGGGGGACGG - Intergenic
1102534887 12:113574189-113574211 TCAGAGGGGCAGGAGGGGGTCGG + Intergenic
1102598736 12:114012862-114012884 AGGGAGAGGGAGGAGGGAGAGGG + Intergenic
1102598742 12:114012881-114012903 AGGGAGAGGGAGGAGGGAGAAGG + Intergenic
1102688814 12:114744479-114744501 ACTGAGACCCAGGGAGGGGAGGG + Intergenic
1102719244 12:115002154-115002176 ACTGAGAGTTAGGAGGGACAAGG + Intergenic
1103148409 12:118615614-118615636 GCGAAGAGGCAGGAGAGGGAGGG + Intergenic
1103191942 12:119008946-119008968 AATGAGAGGAGGGAGGGGAAGGG - Intronic
1103552745 12:121748266-121748288 ACTCAGAGGGAGGAGGGCTATGG - Intronic
1103715915 12:122945260-122945282 AGTGAGAGGGAGGAGGGAGCTGG - Intronic
1104466774 12:128996813-128996835 AGTGGGATGCAGGAGGGGCAGGG + Intergenic
1104549951 12:129747180-129747202 AAGGAGAGGGAGGAGGGAGAAGG - Intronic
1104749664 12:131230202-131230224 ACTGAGGGGCAGGTGAGGGCGGG + Intergenic
1104949001 12:132430379-132430401 ACAGAGAGGCAGGTCTGGGAAGG + Intergenic
1105306227 13:19170817-19170839 ACTTACAGGCAGGAAGGAGATGG + Intergenic
1105533136 13:21237900-21237922 AGTGAGAGAGAGTAGGGGGAGGG - Intergenic
1105593233 13:21812867-21812889 ACTGAGGGCCAGGGTGGGGAAGG + Intergenic
1105742730 13:23345369-23345391 ACTGCTAGGCTGGAGGTGGAGGG - Intronic
1105813962 13:24016648-24016670 ACTGAGAGCCAGGAAGGAGAGGG - Intronic
1106038073 13:26063347-26063369 ACTGGGGGGCAGGTGGGGGTGGG + Intergenic
1106134462 13:26963569-26963591 ACTTAGTGGCTGGAGGGGGTGGG + Intergenic
1106239478 13:27899420-27899442 ACTGAGAGACAGCAGGAGGCAGG - Intergenic
1106469205 13:30039732-30039754 AGTGAGTGGCAGGTGGGGGCTGG - Intergenic
1106477211 13:30108973-30108995 GCTGAGAGGCAGGCGGGGTCAGG + Intergenic
1106665575 13:31847157-31847179 ACATGGAGGCAGGAGGAGGACGG - Intergenic
1106747980 13:32724222-32724244 ACTGAGAGGCTGAGGTGGGATGG - Intronic
1107075517 13:36318244-36318266 ATTGCTGGGCAGGAGGGGGAGGG - Intronic
1107562512 13:41571300-41571322 AGGGAGAGGGAGGAGGGAGAGGG - Intronic
1107683204 13:42871323-42871345 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1107708201 13:43127603-43127625 AGGGAGAGGGAGGAGGGCGAAGG - Intergenic
1108266691 13:48717153-48717175 GGTGAGAGGGTGGAGGGGGATGG - Intergenic
1108453049 13:50586412-50586434 ACTGAGCAGCGGGAGAGGGATGG - Intronic
1108702141 13:52952823-52952845 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1108821751 13:54359324-54359346 AATGGGAGGTAGGAGGTGGAAGG - Intergenic
1108919606 13:55658884-55658906 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1108947374 13:56042114-56042136 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1110886038 13:80636807-80636829 AATGAGAGGGAAGAGTGGGAAGG - Intergenic
1111043144 13:82778170-82778192 ACTGAGGGGCATGAGGCAGAAGG + Intergenic
1111226116 13:85273085-85273107 ACTCAGAGGGAAGAGTGGGAGGG + Intergenic
1111872777 13:93854930-93854952 GGTGAGGGGCAGGAGGGGAAAGG - Intronic
1112321253 13:98409758-98409780 AGTGGCTGGCAGGAGGGGGAAGG - Intronic
1112368680 13:98776042-98776064 ACTGAGAGAGTGGATGGGGAGGG + Intergenic
1112434752 13:99383885-99383907 GTAGAGAGGCAGGTGGGGGAGGG - Intronic
1112484252 13:99805565-99805587 GCTGGGAGGAAGGAGGGGGTGGG + Intronic
1112530270 13:100194831-100194853 ACTGTGAGGCATGAGCAGGAAGG + Intronic
1113415229 13:110123728-110123750 GCTGAGTGGCACGATGGGGATGG - Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113781169 13:112978370-112978392 TGTGGAAGGCAGGAGGGGGATGG + Intronic
1113805730 13:113109302-113109324 CCTGGGCGGCAGGAGTGGGAGGG - Intronic
1113883158 13:113640098-113640120 ACTGCAAGGCAGGAGGCGGATGG - Exonic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114264034 14:21060742-21060764 ACTGAGAGGCTGCAGGAGAAGGG - Intronic
1114272119 14:21107223-21107245 ACAATGAGGCAGGAGGCGGAGGG + Intergenic
1115255453 14:31396296-31396318 ACTGAGAGGCTGAGGTGGGAGGG + Intronic
1115724189 14:36194740-36194762 AGGGAGAGGAAGGAAGGGGAGGG + Intergenic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116142920 14:41023098-41023120 ACTCAGAGGAATGAGGGTGATGG - Intergenic
1116179614 14:41517739-41517761 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1116613450 14:47105983-47106005 ATTGCTGGGCAGGAGGGGGAGGG - Intronic
1116663797 14:47748719-47748741 ACTGAGATGGAGGAGGAAGAAGG - Intergenic
1116822451 14:49638661-49638683 ACTGAATGGCAGCAGGGTGAGGG - Intergenic
1117131939 14:52695617-52695639 GCTGAGAGGCAGGAGGGCCGAGG - Exonic
1118445883 14:65850984-65851006 TCCGAGAGGCAGGAAGGGCAAGG - Intergenic
1118494194 14:66291896-66291918 ACTGAGGGGAGGGAGGTGGAAGG - Intergenic
1118532673 14:66724511-66724533 ACTGAGGGGCTGGAGTGGGAAGG + Intronic
1118669547 14:68108602-68108624 AGAGAGAGGCAGGAATGGGAAGG + Intronic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1118736562 14:68705395-68705417 ACAGAGAGGCAGGTGGAGGAAGG + Intronic
1118765159 14:68904601-68904623 GCTGAGTGGCAGGTGGGCGATGG + Intronic
1118821623 14:69349653-69349675 ACTGAGTGAAGGGAGGGGGAGGG - Intronic
1118932168 14:70252963-70252985 CCTGAGAGACAAAAGGGGGAAGG - Intergenic
1119438074 14:74611093-74611115 TCTGAGAGGCAGCGGGGAGAGGG - Intronic
1119636727 14:76279381-76279403 AAAGAGTGGAAGGAGGGGGATGG - Intergenic
1119708914 14:76807024-76807046 ACTGAGGGGCTGGAAGGGCAAGG + Intronic
1119716672 14:76864400-76864422 AGTGAGAGGAAGGGGGGGGGGGG + Intronic
1119771168 14:77221296-77221318 ATTGGGAGGCGAGAGGGGGAGGG - Intronic
1119771234 14:77221525-77221547 AGTGAGAGGCGAGAGGGGGAGGG - Intronic
1119800212 14:77437709-77437731 ATGGATAGGCAGGAAGGGGAGGG - Intronic
1121015500 14:90546495-90546517 GCTGGGAGGCAGGAGGGGGCTGG - Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121430297 14:93881755-93881777 ACTGAGAGCCAGGGGGCTGAGGG - Intergenic
1121522735 14:94597581-94597603 ACTGAGAGGCACCTGGGGTAGGG + Intronic
1122023808 14:98859986-98860008 ACTGAGGGGCAGCAGGGGCCAGG + Intergenic
1122040934 14:98987002-98987024 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1122196014 14:100086495-100086517 ACCAAGAGGCAGGAAGGGAATGG - Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122863637 14:104593762-104593784 ACTCAGAGGAAGGAGGAGGCCGG + Intronic
1122917932 14:104867348-104867370 ACACAGAGGCAGGGCGGGGATGG - Intronic
1122926539 14:104905706-104905728 ACCGAGAGCCAGGACGGGCAGGG + Intergenic
1122926665 14:104906308-104906330 ACTGAGAGCCAGGACGCGCAGGG + Intergenic
1123431008 15:20216330-20216352 ACTGAGGGGCAGAAGGCAGAAGG - Intergenic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123817997 15:23999079-23999101 ACTGAGAGCCTCAAGGGGGAGGG + Intergenic
1124189785 15:27564804-27564826 ACTGAGAGGGGGGTGGGGGGAGG - Intergenic
1124614551 15:31231964-31231986 ACTCAGAGGAAGCAGAGGGAAGG + Intergenic
1124805863 15:32882045-32882067 ATTGACAGGCAGGAGGTGGAAGG + Intronic
1125234533 15:37497667-37497689 CCCCAGAGGAAGGAGGGGGAAGG + Intergenic
1125385629 15:39133510-39133532 AGTGAGAAGCAAGAGGGGGTTGG + Intergenic
1125516160 15:40322593-40322615 AGAGAGCGGAAGGAGGGGGAGGG + Intergenic
1125638939 15:41213596-41213618 GCTGAGTGGGAGGAGGTGGAGGG - Intronic
1125687633 15:41572876-41572898 ACTGGAAGGAAGGAAGGGGATGG - Intronic
1125757220 15:42071925-42071947 AAGGAGAGGCAGGAGTGTGAGGG + Intronic
1126395721 15:48214744-48214766 ATTGAGTGGCAGGAGTGGGAGGG + Intronic
1127262194 15:57334662-57334684 ACTGAGAGGCTGGATGGAGGTGG - Intergenic
1127725531 15:61745597-61745619 AGTGGGAGCCAGGAGGGAGAAGG - Intergenic
1127733320 15:61819700-61819722 GCTGAGAGGAAGGATGGAGAAGG - Intergenic
1127782028 15:62325436-62325458 AGAGAGAGGAAGGAGGAGGAGGG + Intergenic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128134069 15:65249782-65249804 AATGTGGGGCAGGAAGGGGATGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128528319 15:68427519-68427541 AGTGAGAGGCAGCAGGGAGGGGG + Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128759476 15:70206106-70206128 TCAGAGAGGAAGGATGGGGAAGG + Intergenic
1128889606 15:71318820-71318842 CCTGAGAGGCAGGAGGGCTGGGG + Intronic
1129249764 15:74302486-74302508 CCTGAGAGGCAGGTAGGGTAGGG - Intronic
1129253525 15:74321339-74321361 ACTGGGGGGCAGGCGGGGGTGGG - Intronic
1129732363 15:77939583-77939605 TATGAGGGGCATGAGGGGGAAGG + Intergenic
1129944079 15:79524216-79524238 TCTGAGAGCCAGGAGTGGGAAGG - Intergenic
1130275957 15:82476463-82476485 TCTGAGAGCCGGGAAGGGGAAGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130468318 15:84203855-84203877 TCTGAGAGCCGGGAAGGGGAAGG - Intergenic
1130495948 15:84469687-84469709 TCTGAGAGCCGGGAAGGGGAAGG + Intergenic
1130590611 15:85208453-85208475 TCTGAGAGCCGGGAAGGGGAAGG - Intergenic
1130721002 15:86386050-86386072 GGAGAGAGGGAGGAGGGGGAGGG - Intronic
1130932003 15:88436337-88436359 ACTGAATTGCAAGAGGGGGAGGG - Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131074925 15:89489575-89489597 CCTGGGAGGCAGGTGGGTGAGGG - Intronic
1131150138 15:90042647-90042669 ACTGAGAGACAGCAGGAGAAGGG + Intronic
1131308110 15:91263820-91263842 ACTGAAAGGGAGGAGGGGCACGG - Intronic
1131423317 15:92325701-92325723 ACTGAGAGGCAGAATGGTTATGG - Intergenic
1132062526 15:98704239-98704261 AATGAGAGGTAGGGGAGGGAGGG + Intronic
1132212708 15:100036212-100036234 GCAGAGAGGCAGCAAGGGGAAGG + Intronic
1132303399 15:100790188-100790210 ACTGAGAAGCAAGACAGGGATGG + Intergenic
1132305131 15:100806619-100806641 AGGGAGAGGAAGGAGAGGGACGG + Intergenic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132664633 16:1075973-1075995 AGGGAGGGGGAGGAGGGGGAGGG - Intergenic
1132801754 16:1758106-1758128 ACAGAGAGGCAGGGGAAGGAAGG - Intronic
1132828526 16:1916730-1916752 GGGGAGAGGCGGGAGGGGGAAGG - Intronic
1132931175 16:2459963-2459985 CCTGGGAGGCAGGAGTGGGCGGG + Intergenic
1132931239 16:2460177-2460199 CCTGCGCGGCAGGAGGGGGTGGG + Intronic
1133052237 16:3123877-3123899 ACTGAGAGGTAGGAGGCTGGAGG + Intergenic
1133392829 16:5423013-5423035 AAGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133392859 16:5423102-5423124 AGGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133460706 16:5984077-5984099 AGTGGGAGGGAGGAGGAGGAGGG - Intergenic
1133612152 16:7443347-7443369 TGTGTGAGACAGGAGGGGGATGG - Intronic
1133651338 16:7816505-7816527 ATTGTTGGGCAGGAGGGGGAGGG - Intergenic
1133743001 16:8665444-8665466 ATTCAGAGGCAGCAGAGGGAGGG - Intergenic
1133770843 16:8866688-8866710 GCAGAGAGAGAGGAGGGGGAGGG + Intronic
1134077223 16:11300315-11300337 GCTGAGAGGCCGGAGGGTGGTGG + Intronic
1134120886 16:11584477-11584499 ACTGAGAGGAAGGAGCTGGAAGG - Intronic
1134207969 16:12253110-12253132 GCTGAGGGGCAGGAGGGTTAGGG - Intronic
1134342240 16:13356475-13356497 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
1134819920 16:17238714-17238736 ACTAAGAGCCAGAAGGCGGAAGG - Intronic
1134872340 16:17663320-17663342 ACTCAGAGGAAGGAGAAGGAAGG + Intergenic
1135420877 16:22304807-22304829 TCTGAGAGGCAGGCAGGCGAGGG - Intronic
1135423944 16:22323065-22323087 TCTGAGAGGAAGGAGGAGAAAGG - Intronic
1135694710 16:24575799-24575821 AGGGAGAGGGAGGAGGGGGAGGG + Intergenic
1135948866 16:26893153-26893175 AATGACAAGCAGGAGGGGGCTGG - Intergenic
1135964037 16:27021300-27021322 AGTGAGAGGAAGGATGGGGGAGG - Intergenic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136134890 16:28249711-28249733 ACTAAGGGCCAGGAGGTGGAAGG + Intergenic
1136397430 16:30000957-30000979 AGGGAGAGGCTGGAGGGAGAGGG - Exonic
1136412976 16:30087640-30087662 ACTAAGAGTCAGGCAGGGGAGGG - Intronic
1136416432 16:30107055-30107077 AGGGAGAGGGAGGAGAGGGAGGG - Intronic
1136556179 16:31009305-31009327 ACTGAGATTCAGGCGTGGGAAGG - Intronic
1136578544 16:31138810-31138832 ACTCAGAGGCCGGAGGAGGGAGG + Intergenic
1136608621 16:31352978-31353000 ACAGAGAGGCAGGAGGAGGCTGG - Intergenic
1136853645 16:33634917-33634939 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1137253439 16:46756972-46756994 GGTGAGGGGCAGGAGGAGGAAGG + Intronic
1137578391 16:49618963-49618985 ACTTTGAGGCAGGAGGTGGGTGG - Intronic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1138630372 16:58289500-58289522 ACTGAGGGGCAGGGGAGGGAAGG + Intronic
1138804886 16:60080636-60080658 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139322159 16:66123614-66123636 GTTGAGAGGGAGGAAGGGGAGGG + Intergenic
1139393682 16:66622731-66622753 CATGAGAGGCAGGTGTGGGATGG - Intronic
1139494505 16:67306548-67306570 ATGGAGAGGCAGGACGGGCACGG - Intronic
1139524358 16:67504820-67504842 ACTGAGAGAGAGAAGGGGGCTGG - Intergenic
1139603412 16:68000801-68000823 ACAGAGAGGCTGGCGGGGTAGGG - Intronic
1139884095 16:70196668-70196690 GGTGAGAGCCAGGAAGGGGAAGG + Intergenic
1139939670 16:70596163-70596185 CCTCAGAGGCAGGAGGGGTGAGG + Intronic
1139956795 16:70697082-70697104 TCTGAGGGGCAGGAAGGGGCCGG - Intronic
1140018683 16:71215257-71215279 AAAGGGAGGAAGGAGGGGGAAGG + Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140128056 16:72134209-72134231 ACTGAGGGGCAGAAGGCAGAAGG - Intronic
1140170392 16:72598647-72598669 ACTGAGTGGGAGGAGGGATAGGG + Intergenic
1140170398 16:72598676-72598698 ACTGAGTGGAAGGAGGGAGAGGG + Intergenic
1140170433 16:72598799-72598821 ACTGAGTGGGAGGAGGGAGGGGG + Intergenic
1140170446 16:72598860-72598882 ACTGAGTGGGAGGAGGAAGAGGG + Intergenic
1140170452 16:72598889-72598911 ACTGAGTGGGAGGAAGGAGAGGG + Intergenic
1140170458 16:72598918-72598940 ACTGAGTGGGAGGAAGGAGAGGG + Intergenic
1140282970 16:73572496-73572518 ACAGAAAGGCAGGAAGGAGAAGG + Intergenic
1140368423 16:74398828-74398850 GGTGAGAGCCAGGAAGGGGAAGG - Intergenic
1140457072 16:75111809-75111831 ACAGAGACCCTGGAGGGGGAGGG + Intergenic
1140690767 16:77481288-77481310 GCTGAGAGGCAGCATGGTGAGGG + Intergenic
1140692010 16:77493574-77493596 TCTGAGTGGCAGGAGGAAGATGG - Intergenic
1140728920 16:77838656-77838678 ACAGAGAGGCAGGGAGGGAAAGG - Intronic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141171295 16:81693374-81693396 ACTGAGTGGGAGGTGTGGGAAGG - Intronic
1141186470 16:81791109-81791131 AGAGAGAGGGAGGAGGAGGATGG + Intronic
1141198821 16:81881992-81882014 ACTGTGAGGCTGGTGGGGAAAGG + Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141507652 16:84489347-84489369 GCTGAGAGGCTGGACTGGGAAGG - Exonic
1141513139 16:84525389-84525411 ACTGACAGAGCGGAGGGGGAGGG - Intronic
1141603085 16:85137839-85137861 AGAGAAAGGCAGGAGGGGCAAGG - Intergenic
1141906970 16:87033257-87033279 ACAAAAAGGCAGGCGGGGGATGG + Intergenic
1141961419 16:87411826-87411848 ACTGAAGGGCAAGAAGGGGAAGG + Exonic
1142107103 16:88310049-88310071 ACTGAGTGGCCTGAGAGGGAGGG + Intergenic
1142109500 16:88323683-88323705 ACTGAGTGGCAGAAGTGGGCAGG + Intergenic
1142380526 16:89729463-89729485 AGTGAGCGGGAGGCGGGGGAGGG + Intronic
1142414859 16:89935821-89935843 AGTGAGAGGCAGGTGGCGGCCGG + Exonic
1142449641 16:90167504-90167526 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1142450689 16:90171583-90171605 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1203115236 16_KI270728v1_random:1483362-1483384 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1142456876 17:62108-62130 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1142498540 17:319914-319936 ATTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498551 17:319939-319961 ACTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498562 17:319964-319986 ACTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498573 17:319989-320011 ACTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498584 17:320014-320036 ATTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498595 17:320039-320061 ATTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498606 17:320064-320086 ATTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498626 17:320114-320136 ATTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498637 17:320139-320161 ATTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498648 17:320164-320186 ATTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498659 17:320189-320211 ATTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498670 17:320214-320236 ATTGAGGGGAGGGAGGGGGAGGG + Intronic
1142641550 17:1288515-1288537 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641602 17:1288641-1288663 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641670 17:1288786-1288808 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142966562 17:3585547-3585569 ACTGAGAAGCGGGAAGGGGGCGG + Intronic
1143217161 17:5233659-5233681 ACTGAGAGGCAGGCGGGGCATGG - Intronic
1143341398 17:6214065-6214087 GCTGAGAGGTAGGAGGGTGGGGG + Intergenic
1143403561 17:6661075-6661097 AGGGAGAGGCAGGAGTGGGATGG + Intergenic
1143465240 17:7132110-7132132 ACTGAGCGGGAAGAGGGGGCAGG + Intergenic
1143812596 17:9484471-9484493 AGTAATTGGCAGGAGGGGGAAGG + Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1143988410 17:10935514-10935536 ACTGGGAGGCTGGAGGGGTCAGG + Intergenic
1144031818 17:11329918-11329940 ATAGAGAGACAGGAGGGAGAGGG - Intronic
1144643206 17:16950769-16950791 ACTGAGTCCCAGGCGGGGGAGGG - Intronic
1144648345 17:16990599-16990621 ACAGAGAGGCAGTAGAGGCAGGG - Intergenic
1144837055 17:18162003-18162025 ATTCAGAGGCAGGAAGGGTAAGG - Intronic
1145100597 17:20073487-20073509 TGTGAGAGGCAGGAGAGAGACGG + Intronic
1145214558 17:21042348-21042370 GCGGAGAGAAAGGAGGGGGAGGG + Intronic
1145911834 17:28547606-28547628 ACTGAGCTGCGGGAGGGAGAGGG - Intronic
1145923895 17:28631737-28631759 ACAGAGATGGAGGAGGGGAATGG + Intronic
1146445510 17:32929600-32929622 TGTGAGAGGTAGGTGGGGGAGGG - Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146581303 17:34040430-34040452 ACAGTGGGGGAGGAGGGGGAGGG + Intronic
1146672713 17:34752796-34752818 ACTGACATGAAGGAGAGGGAAGG - Intergenic
1146768762 17:35548811-35548833 ACTGAGCAGATGGAGGGGGAAGG + Exonic
1147155942 17:38544544-38544566 AATCAGAGACAGGAAGGGGAGGG + Intronic
1147277724 17:39333140-39333162 ACGGAGAGGGAGGAGGGAGAGGG - Intronic
1147599724 17:41738424-41738446 GATGAGAAGCAGGAGAGGGAGGG - Intergenic
1147716047 17:42509423-42509445 ACCGAGAGTCAGGAAGGGAAGGG - Intronic
1147794585 17:43033438-43033460 CCTAGGAGGGAGGAGGGGGAAGG + Intergenic
1147945053 17:44076119-44076141 ACTTAGGGGCTGGAAGGGGATGG - Exonic
1148049119 17:44760476-44760498 TCTGGGAGGCAGGAGGGGCCTGG - Intronic
1148154008 17:45412328-45412350 TCTGAGAGGCACAAGGGGGAGGG + Intronic
1148444097 17:47727275-47727297 GCTGAGAGGCAGGAAGGGTGGGG + Intergenic
1148469665 17:47885261-47885283 ACTGAGGGGTGGGAAGGGGAAGG - Intergenic
1148550359 17:48546626-48546648 GCAGAGAGAGAGGAGGGGGAGGG - Intergenic
1148809935 17:50283902-50283924 ACTGAGAGATAGGCAGGGGAAGG - Intergenic
1148824709 17:50384044-50384066 AGGGAGAGGCAGGTGAGGGAAGG - Intronic
1148838839 17:50481961-50481983 GCTGGAAGGCAGGAGGGGGAAGG - Intronic
1148850095 17:50550442-50550464 TCTCTGAGGCAGGCGGGGGAGGG - Intronic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1148874907 17:50681299-50681321 ACTGAGAGGCAGGAAGGTTGAGG - Intronic
1149455025 17:56780740-56780762 GCTGAGAGGAAGGAAGGGGGTGG + Intergenic
1149502379 17:57163733-57163755 ACTGTGAGGGAGGAGAGAGAAGG + Intergenic
1149867287 17:60157864-60157886 CCAGCGAGGCAGGAGGGGGCGGG + Intronic
1150121909 17:62610724-62610746 TAAGAGAGGCAGGAGGGTGAGGG + Intronic
1151155766 17:72122268-72122290 ACTGGGAGGCGGGAGGAGGGAGG + Intronic
1151232037 17:72691986-72692008 ACTTTGAGGTAGGTGGGGGAGGG - Intronic
1151426360 17:74033335-74033357 AGTGAGAGGCGGGAGGCCGAGGG - Intergenic
1151475940 17:74344396-74344418 CCTGAGGGGCAGGAGGGGCGGGG + Intronic
1151491141 17:74432770-74432792 ACCGAGAGGCAGGCGGTGGAGGG - Intronic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151566983 17:74904228-74904250 ACTGAGGTTCAGGTGGGGGATGG - Intergenic
1151594051 17:75066052-75066074 AATGAAAGGGAGGAGGGAGAAGG - Intergenic
1151919173 17:77140959-77140981 CCGGGGAGGCGGGAGGGGGAAGG - Intronic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1152261442 17:79269465-79269487 TCTCAGAGGCAGGAGTGGGAAGG - Intronic
1152400763 17:80065046-80065068 GGGGAGAGGGAGGAGGGGGAGGG - Intronic
1152464637 17:80458853-80458875 ACTGGGAGCCAGCAGGGGAACGG - Intergenic
1152500123 17:80702454-80702476 TCTGAGAGACAGGAGAGGCACGG - Intronic
1152521031 17:80857166-80857188 CCTCAGAGGCAGGGGAGGGAGGG - Intronic
1152580168 17:81162286-81162308 CCTGAGAGGAAGTAGGGGGATGG + Intronic
1152721368 17:81925293-81925315 ACTGAGAGCCAGGAAAGGGAGGG + Intronic
1152820294 17:82434328-82434350 AGTGAGTGGCAGGAGGGGCAAGG - Intronic
1152864844 17:82716545-82716567 ATTGAGGGGCGGGAAGGGGAGGG - Intergenic
1153015379 18:578264-578286 ACTGGAAGGCAGGAGAGGGGAGG + Intergenic
1153762448 18:8344913-8344935 AGGGAGAGGGAGGAGGGAGAAGG + Intronic
1153776139 18:8455876-8455898 GCTGAGAGGAAGGAGGGGATGGG + Intergenic
1154077490 18:11218231-11218253 AGTGAAAGGCAGGAGGGGTGGGG + Intergenic
1154190999 18:12231197-12231219 ACTGGGAGTCAGGTGGGGGTGGG + Intergenic
1154371015 18:13763330-13763352 ACTGAGCAGCACGAGAGGGAGGG - Exonic
1154394191 18:13971914-13971936 GCTGAATGGCAGGAGGGGAATGG - Intergenic
1154496179 18:14963071-14963093 GCTGAGAGGCAGGAGGGTTGAGG + Intergenic
1154980368 18:21498560-21498582 AGGGAGAGGAAGGAGTGGGACGG - Intronic
1155096031 18:22557448-22557470 AATTGGGGGCAGGAGGGGGATGG + Intergenic
1155145417 18:23079207-23079229 ACAGAGAGGGAGAAGAGGGATGG + Intergenic
1155320464 18:24613921-24613943 ACAGTCAGCCAGGAGGGGGATGG + Intergenic
1155546775 18:26923985-26924007 AGGGAGAGGCAGGAGGGGTTGGG + Intronic
1156338386 18:36188803-36188825 AGGGAGAGTCAGGAGGGAGACGG + Intronic
1156788952 18:40949024-40949046 ACTGAAAGAAAAGAGGGGGAGGG + Intergenic
1157221201 18:45829466-45829488 ACCAAGGGGCAGGAGGGGAAGGG + Intronic
1157300476 18:46475240-46475262 ACCAAAAGGCAGGAGGAGGAGGG + Intergenic
1157462971 18:47918066-47918088 ACTGAGGGCCAGGCAGGGGAAGG + Intronic
1157594077 18:48853270-48853292 GCTGGGAGGTAGGTGGGGGATGG + Intronic
1157621007 18:49017499-49017521 ACTGAGGCCCAGGAGGGAGAGGG + Intergenic
1157763223 18:50280334-50280356 ACAGGGAGGAATGAGGGGGAAGG - Intronic
1157893211 18:51438632-51438654 ACACAGAGGCAGGAGAGGGCAGG + Intergenic
1158381730 18:56938052-56938074 ACTGAGGGGGAGGAAGTGGAGGG + Intronic
1159006654 18:63019493-63019515 ACTGTGAGATAGGAGGTGGAGGG - Intergenic
1159054630 18:63451598-63451620 ACTGAGGGGCATGAGGCAGAAGG + Intergenic
1159325693 18:66913716-66913738 AATCAGAGGCAGGAAGGGCATGG + Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1160072816 18:75643334-75643356 TCTGAAAGACAGGAGGGCGAGGG - Intergenic
1160239423 18:77112553-77112575 ACAGAGAAGGGGGAGGGGGAGGG - Intronic
1160465657 18:79073672-79073694 ACGGAGAGGGAGAAGGGAGAGGG + Intronic
1160560119 18:79750926-79750948 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160560190 18:79751131-79751153 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160646788 19:197467-197489 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1160849005 19:1180713-1180735 GGAGAGAGGCAGGAGGGGAAGGG - Intronic
1161015611 19:1981401-1981423 CCGGACAGGCAGGATGGGGATGG - Intergenic
1161046100 19:2135874-2135896 ACTGGGAGGGAGGAGGGTGGAGG - Intronic
1161099802 19:2415971-2415993 GCTGAGAGACAGGAGGGAGCCGG + Intronic
1161284025 19:3459643-3459665 ACAGCCAGGCAGGAAGGGGAGGG + Intronic
1161310552 19:3591683-3591705 ACTGGGCTGCAGGATGGGGATGG - Exonic
1161389886 19:4015455-4015477 AGAGAGAGGCAGGGTGGGGATGG - Intronic
1161648716 19:5470818-5470840 AAGGAGGGGAAGGAGGGGGAGGG + Intergenic
1161661654 19:5550275-5550297 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1161768478 19:6219240-6219262 TTTGAGGGGCAGGAGGGGGCTGG - Intronic
1161777579 19:6272015-6272037 ACTGAGAGCTCAGAGGGGGACGG - Intronic
1161910965 19:7193530-7193552 AATTAGGGGCAGGAGGGGGGAGG + Intronic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162031545 19:7919658-7919680 AAGGAGAGGAGGGAGGGGGAAGG - Intergenic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162452777 19:10764768-10764790 CCTGAGAATCAGGAGGGAGATGG - Intronic
1162583394 19:11544443-11544465 ACTGAGAGTCAGATGGTGGAGGG + Intronic
1162818114 19:13208158-13208180 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
1163298067 19:16425188-16425210 GCTGGCAGGCAGGACGGGGACGG + Exonic
1163322851 19:16584725-16584747 GGTGAGTGACAGGAGGGGGATGG + Intronic
1163648611 19:18504191-18504213 ACAGAGAGGCTGGAGGGGTGAGG + Intronic
1164053227 19:21600672-21600694 AAAGAAAGGTAGGAGGGGGAGGG - Intergenic
1164468213 19:28506148-28506170 ACTGAGAGTCAGGAAGATGAGGG + Intergenic
1164667543 19:30051517-30051539 ACAGAAAAGGAGGAGGGGGAAGG - Intergenic
1164667927 19:30053685-30053707 GCTGAGAGGGAGGAGGTGGTGGG + Intergenic
1164779078 19:30878232-30878254 ACTGAGAAACAGGTGGGGCATGG + Intergenic
1165340133 19:35205494-35205516 AGTGAGAGTAAGGCGGGGGAGGG + Intergenic
1165348986 19:35266586-35266608 ACTGAGGGGCAGGGGCTGGAAGG + Intronic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165996682 19:39848658-39848680 GCAGAGAGGTGGGAGGGGGATGG + Intergenic
1166134757 19:40769325-40769347 ACTGAGAGGCCGAGGTGGGAGGG + Intergenic
1166301687 19:41914908-41914930 ACGGAGATGGTGGAGGGGGAGGG - Intronic
1166301702 19:41914972-41914994 ACAGAGATGCTGGAGGGGGAGGG - Intronic
1166852943 19:45769038-45769060 ACAGACAGACGGGAGGGGGACGG - Exonic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167035063 19:46990305-46990327 ACAGAGAGGCAGGCTGGGGCAGG - Intronic
1167058997 19:47131576-47131598 TCGGAGAGGCTGGAGGGGGACGG + Intronic
1167115035 19:47484148-47484170 ACTGAGGGGCATGATGGGGGAGG - Exonic
1167123280 19:47531845-47531867 CCTGAGATGCAGGAGAGAGAAGG - Intronic
1167271414 19:48508656-48508678 AGTGAGAGGCAGGATGGTGGAGG - Intronic
1167311570 19:48740361-48740383 AGTCAGAGGGAGGAGGGGGCTGG + Intronic
1167509158 19:49887296-49887318 AGTGGGAGGAAGGAGGGGCAGGG + Intronic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
1167588879 19:50391681-50391703 ACTGAGAGGGGGGAGGGGGAGGG + Intronic
1167628397 19:50607519-50607541 ACTGAGAAAGAGGATGGGGACGG - Intergenic
1168254931 19:55159967-55159989 ATTGAGCGGCAGGAAGTGGACGG + Exonic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
1168543521 19:57231720-57231742 ACTGAAAGAGAGGAGGAGGAGGG - Exonic
925476354 2:4221063-4221085 AAGGAGAGGCAGGAGGGCAATGG - Intergenic
925828883 2:7876568-7876590 ACTGCTGGGCAGGTGGGGGAGGG + Intergenic
925957051 2:8977040-8977062 AGGGAGAGGCAGGAGGGAGACGG + Intronic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926684044 2:15684898-15684920 AGTGAGGGGAAGGAGGGTGAGGG + Intergenic
926815612 2:16795847-16795869 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
926881763 2:17552567-17552589 AGAGAGAGGAAGGATGGGGACGG - Intronic
927090190 2:19704779-19704801 ACTGCAAGGCAGGAGGGGAAAGG - Intergenic
927099105 2:19774254-19774276 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
927482487 2:23465360-23465382 ACAGAGAGGCAGGAGGTGAGAGG - Intronic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
927681079 2:25139437-25139459 ACAGAGGGGCAGGAAGTGGAGGG - Intronic
927705637 2:25294879-25294901 AATGGGAGGGAGGAGGAGGAGGG - Intronic
928105838 2:28470082-28470104 GAGGAGAGGGAGGAGGGGGAGGG + Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
928333939 2:30379707-30379729 ACTGAGAGGCCAGAAGTGGAGGG - Intergenic
928512445 2:32014033-32014055 ACAGAGAGGGAGGGAGGGGAGGG + Intronic
929008673 2:37419719-37419741 ACTGAGGGGTAGGCGTGGGAAGG + Intergenic
929285200 2:40127746-40127768 CCAGAGAGGCAGGATGGGGTGGG + Intronic
930107554 2:47651919-47651941 GTTGAGAGACAGGAGTGGGAGGG - Intergenic
930430809 2:51273596-51273618 ACGGATAGGAAGGAGGGGAAAGG - Intergenic
930658247 2:54028422-54028444 ATTGAGAGCCAGGAGGCTGAGGG - Intronic
930791054 2:55329146-55329168 ACAGAGTGGCAAGAGGGTGATGG + Intronic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
931214447 2:60228147-60228169 ACTCAGCGTGAGGAGGGGGAGGG - Intergenic
932396574 2:71452926-71452948 ACTGGGTGGGGGGAGGGGGAGGG + Intergenic
932429568 2:71666038-71666060 AATGAGAAGGAGGAGGGGGTGGG - Intronic
932494320 2:72138963-72138985 GGTGAGAGGCAGGAGGGGTGAGG - Intronic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
932974012 2:76577758-76577780 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
933080395 2:77977658-77977680 ACTTAGAGGCAGCAGGGGAAGGG - Intergenic
933158849 2:79002416-79002438 AGAGAGAGCCAGTAGGGGGAAGG + Intergenic
933691475 2:85182342-85182364 ACTGAGAAGCAGGTGGGTGCTGG + Intronic
933792420 2:85893726-85893748 TCTGTGAGGCAGGAGGGGTGAGG + Intergenic
934502799 2:94872819-94872841 ACTGAGAGAGTGCAGGGGGAAGG - Intronic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
934656663 2:96119951-96119973 ACTGAAAGGCTGGTGGGGGGCGG - Intergenic
935192582 2:100790883-100790905 ACTGGGAGGGAGGCGGGGAATGG - Intergenic
935199617 2:100845002-100845024 ACTTAGAGGCAGGCAGGGGGTGG + Intronic
935203213 2:100876364-100876386 ACTGACAGTCACGAGGGTGATGG - Intronic
935292248 2:101620546-101620568 ACTGAGAGGGTGGCTGGGGAAGG - Intergenic
936115507 2:109699646-109699668 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
936384837 2:112020165-112020187 GCTGGGAGGCGGGAGGGGGCAGG - Intronic
936469798 2:112788926-112788948 GCTCAGAGAGAGGAGGGGGAAGG + Intergenic
936985643 2:118309499-118309521 AAGGAGAGGCAGGCGAGGGAGGG + Intergenic
937623431 2:124016614-124016636 GCTGAGAGACGGGAGGAGGATGG - Intergenic
937873248 2:126801605-126801627 ACTGATATGCAGGTGGGTGAGGG - Intergenic
938213490 2:129488305-129488327 ACTGGGAGGCAGCTGGGAGAAGG - Intergenic
938314730 2:130317750-130317772 ACTGAGAGGGTGCAGGGGGAGGG - Intergenic
938397945 2:130964316-130964338 AAGGAAAGGCAGGAGGGGGGCGG - Intronic
938833403 2:135074847-135074869 ACTAAGAGGCAGGAGCTGGAGGG + Intronic
939536750 2:143440903-143440925 ACTGACAGCAAAGAGGGGGAAGG + Intronic
940254435 2:151714111-151714133 ATTGAGAGACAGGATGGGGGTGG - Intronic
941188347 2:162344603-162344625 ACTGAGTGGGGGGCGGGGGAGGG - Intronic
941357683 2:164513115-164513137 GCAGAGAGGGAGGAGTGGGAAGG - Intronic
941536640 2:166730425-166730447 ACTGAGAGGAAGAAGGCAGAAGG + Intergenic
941706216 2:168661042-168661064 GCAGAGAGGCGGGAGGGGGTGGG + Intronic
942110014 2:172672988-172673010 ACTGAGGGGCATGAGGCAGAAGG + Intergenic
942215762 2:173717791-173717813 ACTCAGAAGTAAGAGGGGGAGGG - Intergenic
942960981 2:181829644-181829666 GTTGGGAGGAAGGAGGGGGACGG - Intergenic
943412990 2:187564384-187564406 ATTGCTGGGCAGGAGGGGGAGGG + Intronic
944260927 2:197676062-197676084 AGAGAGAGGCAGTAGGGGGGTGG + Intergenic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
944660748 2:201919557-201919579 ACAGGGAGGCGTGAGGGGGATGG + Intergenic
945135420 2:206622535-206622557 ACTGATGGGCAGGTGGGCGAGGG + Intergenic
945672650 2:212820676-212820698 ATTGAGAGACAGGAAGGGGTAGG - Intergenic
945921632 2:215761196-215761218 ATTGAGAGGGAGGAGAGGGAAGG - Intergenic
946040730 2:216781123-216781145 ACAGAGAGGAAGGGAGGGGAAGG - Intergenic
946192578 2:218015340-218015362 AGGGAGAGGAGGGAGGGGGAGGG + Intergenic
946419654 2:219557677-219557699 ACGGGGAGGCATGACGGGGAAGG + Intronic
946459745 2:219858212-219858234 ACAGAGAGGGAGGAGGGGTTTGG - Intergenic
947156887 2:227171729-227171751 ACTGAGGGGCAGAAGGCTGAAGG + Intronic
947182461 2:227423605-227423627 AATGACAGGCAGGGGTGGGAGGG + Intergenic
947373974 2:229476347-229476369 GCTGAGAGGCAGGGGGAGGGCGG - Intronic
947650696 2:231784117-231784139 ACTGAGAAGGGGGAGGGGGTGGG + Intronic
947770706 2:232668091-232668113 ACTGTGAAGAAAGAGGGGGAGGG - Intronic
947900097 2:233714051-233714073 ACTGAGAGGAAGGAGAGGCAGGG + Intronic
947900803 2:233719859-233719881 ACTGAGAGGAAGAAGAGGCACGG + Intronic
948447136 2:238041418-238041440 ACTGAGAGGGAGCATGAGGACGG - Exonic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948755197 2:240155374-240155396 AGTCAGAGGGAGGAGGGCGATGG - Intergenic
948772312 2:240257996-240258018 GCGGAGAGCCAGGAGCGGGAAGG + Intergenic
948958965 2:241316558-241316580 ACGGACAGGCAGCAGGGGGTAGG + Intronic
1168883237 20:1225568-1225590 ACTGAGAGGGACGAGGGCGCAGG - Intergenic
1170540297 20:17380921-17380943 TCTGGGAGGCAGGACAGGGAGGG - Intronic
1170820767 20:19755052-19755074 ACTGCTGGGCAGGTGGGGGAGGG + Intergenic
1172107646 20:32526345-32526367 ACCGAGAAGCAGGAGGGGCGGGG + Intronic
1172116244 20:32575075-32575097 GGTGAGAGGCAAGAGGGCGATGG - Intronic
1172193337 20:33075473-33075495 AAGGATGGGCAGGAGGGGGATGG - Intergenic
1172876974 20:38170318-38170340 ACTGAGAGCCAGGTGGGTGGAGG - Intergenic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173336135 20:42113685-42113707 AGTGGGAAGCAGGAGAGGGAAGG - Intronic
1173385267 20:42581807-42581829 ACTCAGAGGTTGAAGGGGGAGGG + Intronic
1173577187 20:44120076-44120098 AATGAGAGGCAGGATGGCGTAGG - Intronic
1173752894 20:45490464-45490486 ACTGAGAGGTGGGATGGGGCAGG + Intergenic
1173876630 20:46376415-46376437 AGGGAGAGTCAGGAGGGAGAGGG - Intronic
1173903423 20:46607643-46607665 TCTGAGACTCAGGAAGGGGAAGG - Intronic
1174119049 20:48248598-48248620 ATTGAGAAGCAGGAGAGGGGTGG - Intergenic
1174872535 20:54196350-54196372 ACTGATAGGGAGGAAGGGGAGGG + Intergenic
1174952213 20:55054634-55054656 ATTTGGAGGCAGGAGGGAGAAGG - Intergenic
1175105113 20:56609679-56609701 TCTTAGAGGAAGCAGGGGGAGGG - Intergenic
1175296705 20:57913612-57913634 AATGAGAGACAGGAGGGGACAGG + Intergenic
1175391185 20:58628455-58628477 AGTGGGAGGCAAGCGGGGGAGGG - Intergenic
1175631005 20:60536385-60536407 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1175824675 20:61930498-61930520 AGTGGGAGGCAGGGCGGGGAAGG + Intronic
1175825054 20:61932162-61932184 TCTGAGCAGCAGGAGGGAGATGG - Intronic
1175957368 20:62618266-62618288 ACTGTGAGACACGAGGAGGAAGG + Intergenic
1176278714 20:64288759-64288781 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1177100558 21:16893958-16893980 ACTGCTGGGCAGGTGGGGGAGGG - Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1177854562 21:26386598-26386620 ACTGAGAAGTAGTAGGGGAAAGG - Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178184866 21:30207885-30207907 ACTGGTGGGGAGGAGGGGGATGG + Intergenic
1178357163 21:31918967-31918989 ACTGAGCGGTATGAGGAGGAGGG + Intronic
1178357170 21:31918995-31919017 ACTGAGCGGTATGAGGAGGAGGG + Intronic
1178357177 21:31919023-31919045 ACTGAGCGGTATGAGGAGGAGGG + Intronic
1178357190 21:31919079-31919101 ACTGAGCGGTATGAGGAGGAGGG + Intronic
1178357203 21:31919135-31919157 ACTGAGCGGTATGAGGAGGAGGG + Intronic
1178357216 21:31919191-31919213 ACTGAGCGGTATGAGGAGGAGGG + Intronic
1178514064 21:33230756-33230778 GCGTGGAGGCAGGAGGGGGAAGG + Intronic
1178696474 21:34797058-34797080 ACCTGGAGGCAGGAGGGGGGTGG - Intronic
1179387490 21:40956754-40956776 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1179455020 21:41493304-41493326 ACTCAGAGACAGGAGGTGGCTGG + Intronic
1179603323 21:42495879-42495901 AATGGGAGGCAGGATGGGGGTGG + Intronic
1179646967 21:42782046-42782068 AAGGAGAGGCAGGGGAGGGAAGG - Intergenic
1180058271 21:45370938-45370960 GCTGACAGCCAGGAGGGAGAGGG + Intergenic
1180075424 21:45459279-45459301 GGTGAGGGGCAGGAGGAGGAGGG + Intronic
1180171395 21:46060553-46060575 ACTGAGAGCCAGGGTGGGGAAGG - Intergenic
1180961097 22:19762702-19762724 CCTGAGAGTCAGGGGAGGGAGGG + Intronic
1180971960 22:19820496-19820518 ACTGAGGGGCAGAATGGGGTGGG - Intronic
1181085792 22:20438755-20438777 ACTGGGAGGCAGCAGGGTGCGGG + Intronic
1181292019 22:21802468-21802490 ACTGGGAGGCAGCAGGAAGAAGG - Intronic
1181425320 22:22833686-22833708 TCTGAGAGGGAGGTGGGGGCAGG + Intronic
1181611687 22:24018143-24018165 ACTGAGAAACAGGATGGGCATGG - Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181732161 22:24855263-24855285 ACTGAGGGGCATGTGGGGGCTGG - Exonic
1181851158 22:25750860-25750882 AGTCAGAGCCAGGAAGGGGAAGG + Intronic
1182010296 22:26995101-26995123 ACTGGGAGCCTGGAGGGTGAAGG + Intergenic
1182345863 22:29664308-29664330 CCTGAGAGGGAGGAAGGGGTGGG - Intronic
1182876360 22:33694707-33694729 GTGGAGAGACAGGAGGGGGAAGG + Intronic
1182886386 22:33777623-33777645 ACAGAGAGGGAGGGAGGGGAAGG + Intronic
1182964994 22:34512642-34512664 ACTGAGAGCCAGGAGTGATAAGG + Intergenic
1183247931 22:36708294-36708316 ACTGTGAGGCAGGAGCAGGTTGG + Intergenic
1183635743 22:39061430-39061452 ACTGTTGGGCAGGTGGGGGAGGG + Intronic
1183753102 22:39733379-39733401 ACTGAGGGGCAGGGGTGGAAAGG + Intergenic
1183758139 22:39790010-39790032 ACCCACAGGCAGGAGGGGGCTGG + Intronic
1184109911 22:42388619-42388641 GCTCAGAGGCAGGAGGAGGGCGG + Intronic
1184629259 22:45763154-45763176 ACTGAGAGTCACCAGGGTGAGGG - Intronic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
1184959373 22:47917934-47917956 AAAGAGAGGGAGGAGGGAGAGGG - Intergenic
1185006177 22:48278231-48278253 TCTGGGTGGGAGGAGGGGGAAGG - Intergenic
1185009433 22:48304996-48305018 ACGGAGATGCAGCAGGGGGTGGG + Intergenic
1185125323 22:49007328-49007350 ACTGAGAGGGAGGAGTCAGAGGG - Intergenic
1185178593 22:49346455-49346477 ACACAGAGGCAGGAGGAAGATGG + Intergenic
1185181199 22:49364430-49364452 TCCGAGAGCCAGGAAGGGGAGGG - Intergenic
949213761 3:1538841-1538863 ACTGAGACCCAGCAGGGTGAAGG - Intergenic
949396289 3:3617628-3617650 ACCGAGAGGCATAAGGGAGAGGG - Intergenic
949616802 3:5762531-5762553 AATGAGCGGCAGCAGTGGGATGG + Intergenic
950092397 3:10305142-10305164 ACTGTTAGGGAGGAGGAGGACGG - Exonic
950332022 3:12163534-12163556 ACTCAGAGTCTGGAGGAGGAGGG - Intronic
950430759 3:12949665-12949687 ACCCAGAGGAAGGAAGGGGATGG + Intronic
950482190 3:13251053-13251075 ACTGAGGGGGAGCCGGGGGAGGG - Intergenic
950794074 3:15496386-15496408 ACTGGGAGGGAGGAGGGAGGGGG - Intronic
950958344 3:17079167-17079189 ACTGAGAGGCAAGTGGGGCTGGG - Intronic
951125132 3:18975823-18975845 ACTAACACTCAGGAGGGGGAGGG - Intergenic
952003338 3:28810859-28810881 ATAGGGAGCCAGGAGGGGGATGG + Intergenic
952125630 3:30297278-30297300 AGTGAGAGGCAGTAGGAGGTAGG - Intergenic
953226599 3:41027191-41027213 ACAAAGAGGCAGGAAGGGAAGGG + Intergenic
954212066 3:49103545-49103567 AGTGAGAAGGAGGTGGGGGAAGG - Intronic
954391858 3:50271738-50271760 ACTGGGTGGCTGGAGGGGGTTGG + Intronic
954411579 3:50373518-50373540 AGGGGGAGGGAGGAGGGGGATGG + Intronic
954645647 3:52130046-52130068 TCTGAGAGTCAGGCGGGAGAAGG - Intronic
954709183 3:52496508-52496530 TCAGAGAGGCAGCAGGGAGAAGG + Intronic
955148890 3:56347407-56347429 GCTGGGAGGCTGGAGGAGGAAGG + Intronic
955253302 3:57305473-57305495 ATTGCTGGGCAGGAGGGGGAGGG - Intronic
955403996 3:58613807-58613829 ACTGATGGGCAGGAGGCAGAAGG + Intronic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955892176 3:63661975-63661997 ACTGAGAGACATGAGGCTGAAGG - Intronic
956403570 3:68905243-68905265 CCTGGGAGGCAGGAGGCGGGAGG - Intronic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
957130972 3:76222260-76222282 ACTGAGAGGCATAAGGTAGAAGG + Intronic
957164029 3:76647329-76647351 ACTGAAAGGCTAGAGGAGGAAGG - Intronic
957295179 3:78325683-78325705 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
957467076 3:80608075-80608097 AGTGGGAGGGAGGAGGGGGAAGG + Intergenic
957599955 3:82321115-82321137 ACTGAGAGAGAGGAGGGAAAAGG + Intergenic
957938010 3:86968911-86968933 ACTCAGACACAGCAGGGGGAGGG + Exonic
958566282 3:95815542-95815564 ACTGAGAGGCAGGAGAGGGAGGG + Intergenic
959105270 3:102058375-102058397 AGTAAGTGGCAGGAGAGGGATGG + Intergenic
959623976 3:108428757-108428779 AATGAGAGGCTGGAGGAGGTAGG - Exonic
960857078 3:122113001-122113023 ACTCAGAGGAAAGAGTGGGAGGG - Intronic
961106115 3:124243096-124243118 ACAGACAGGCAGGTGGGTGAAGG - Intronic
961166885 3:124769715-124769737 TCTGAGAGGGAGAAGGGGGCTGG - Intronic
961379097 3:126485895-126485917 GGTGAGATGCAGGAGGGGCAGGG - Intronic
961394762 3:126578983-126579005 ACTGAGGGTCAGGAGGTGAAGGG - Intronic
961516426 3:127440237-127440259 ACTCAGAGGCTGAAGGGGGCTGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961842062 3:129722603-129722625 ATTGATAGTCAGGTGGGGGAGGG - Intronic
962754199 3:138455907-138455929 ACTTCGAGGCAGGAGGCGTAGGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
963663277 3:148153454-148153476 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
963684270 3:148416151-148416173 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
963716243 3:148807628-148807650 ACTGAGAGGCTAGAGTGGGAGGG + Intronic
963742977 3:149097961-149097983 AGGGAGGGGGAGGAGGGGGAGGG + Intergenic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964626154 3:158762043-158762065 ACAGAGTGGCAGGAGCAGGATGG + Intronic
964680395 3:159331611-159331633 CGTGAGAGGAAGTAGGGGGATGG - Intronic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
964793328 3:160473033-160473055 ATTGAGAGGTAGGAGCAGGAAGG - Intronic
964803661 3:160582670-160582692 ACTAAAAGTCAAGAGGGGGAGGG + Intergenic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
965757668 3:172041172-172041194 CCTGGGAGGGAAGAGGGGGAGGG - Intronic
965786246 3:172338353-172338375 TATCAGAGGCAGGAAGGGGAAGG + Intronic
967297567 3:187980043-187980065 ACTGAGAGGTAGCTGGGGAAGGG + Intergenic
967311437 3:188110095-188110117 ATTGAGTGGCAGTAGGGGAAGGG + Intergenic
967415226 3:189209540-189209562 ACTGGGAGGCAGGCAGGAGAGGG + Intronic
967496160 3:190146324-190146346 ACCGATGGGCAGGTGGGGGAGGG - Intergenic
967703527 3:192622200-192622222 ACTGAGAGACAGGAAGGCTATGG + Intronic
967710114 3:192697042-192697064 ACTGAGAGGCGGGGGAGGGTGGG - Intronic
968370893 3:198222055-198222077 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
968612803 4:1564704-1564726 AGTGAGGGGCAGGATGGGGGAGG + Intergenic
968703703 4:2068776-2068798 ACTGAGGGGCAAGAGGGGCCAGG - Exonic
968738073 4:2309227-2309249 GCAGAGAAGCAGGAGGGGAAGGG - Intronic
968821980 4:2861134-2861156 ACTCTGAGGCAGGAAGGGGCTGG + Intronic
969299535 4:6289626-6289648 ACAGAGAGGCAGGGGAGGAAAGG + Intronic
969477699 4:7430923-7430945 GCAGAGAGGCAGGAGGAGCAAGG - Intronic
969652187 4:8474407-8474429 ACAGAGAGGCAGCCGTGGGAGGG + Intronic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971200071 4:24502811-24502833 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
972565523 4:40265682-40265704 AGGGAGAGGGAGGAGGGAGATGG + Intergenic
972593587 4:40510773-40510795 ACTAAGAGTCAATAGGGGGACGG + Intronic
973832851 4:54779289-54779311 ACAGGGAGGGAGGAGGGGGAGGG + Intergenic
974021829 4:56698405-56698427 TCTGGGAGTGAGGAGGGGGAGGG - Intergenic
975416067 4:74106050-74106072 ACAGGGAGGGAGGAGTGGGAAGG - Intergenic
975460856 4:74651272-74651294 GATGGGAGGGAGGAGGGGGAGGG + Intergenic
975460863 4:74651285-74651307 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460870 4:74651298-74651320 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975460877 4:74651311-74651333 AGGGGGAGGGAGGAGGGGGAGGG + Intergenic
975661127 4:76689726-76689748 ACGGAGAGGGAGGCGGGGGCCGG + Intronic
975865151 4:78717768-78717790 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
975933952 4:79557888-79557910 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
976696472 4:87923669-87923691 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
976884635 4:89968703-89968725 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
977062572 4:92275402-92275424 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
977075270 4:92442870-92442892 ATTGTTGGGCAGGAGGGGGAGGG + Intronic
978013673 4:103719090-103719112 ACAGAGAGGAAAGAGGGAGAAGG - Intronic
978102549 4:104860346-104860368 ACAGAGAGGCAGGAAAGGAAAGG + Intergenic
978153723 4:105466556-105466578 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
979084447 4:116388989-116389011 ACTGAGAGACTGGGTGGGGAAGG + Intergenic
979146555 4:117253890-117253912 ACTGCTGGGCAGGTGGGGGAGGG - Intergenic
979259347 4:118633682-118633704 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
979259575 4:118634543-118634565 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
979328799 4:119406081-119406103 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
979329003 4:119406881-119406903 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
979631057 4:122903677-122903699 ACTGCAAGGCTGGAGGAGGAAGG + Intronic
979850370 4:125565546-125565568 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
980982769 4:139668604-139668626 AGAGAGAGAGAGGAGGGGGAGGG + Intronic
981421913 4:144560628-144560650 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
981550706 4:145938059-145938081 ACCCAGAGTGAGGAGGGGGAAGG + Intronic
982088185 4:151857613-151857635 AATGAGATGGAGGAGGGAGATGG - Intergenic
982946446 4:161630119-161630141 ACGGAGGGGCAGGAAGGGGAGGG - Intronic
983037142 4:162881053-162881075 ATTGAGAGACAGGAGTGGGGAGG - Intergenic
983240216 4:165223442-165223464 ACTGAGGGGATGGAGTGGGAAGG + Intronic
983919718 4:173333480-173333502 AAGGTGAGGCAGGAGAGGGACGG - Exonic
984700603 4:182816322-182816344 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
984781800 4:183533211-183533233 ACTGAAGGGCAGCAGGGAGAGGG + Intergenic
984853878 4:184176559-184176581 ACTGAACTGCAGGAGGGAGAAGG + Intronic
984866106 4:184282063-184282085 ACTGAGAGGTTGCAGGAGGAAGG + Intergenic
985175844 4:187199957-187199979 ACAGAAACGCAGGAGGGGTAAGG - Intergenic
985223390 4:187732042-187732064 GCTGAGGGGGAGGAGGAGGACGG - Intergenic
985541105 5:488160-488182 GCTGGGAGGAAGGAGGTGGAGGG + Intronic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
985932805 5:3072382-3072404 AGAGAGAGGCAGGGGGGAGACGG - Intergenic
986125630 5:4880472-4880494 AGTGAGAGACAGGAAGGGGAAGG + Intergenic
986199940 5:5571102-5571124 GCTGAGAGTGAGGAGTGGGAGGG + Intergenic
986919649 5:12666450-12666472 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
987246457 5:16054093-16054115 ACTGAGAGCCAAGATGGGGATGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
989165853 5:38433035-38433057 ACTGTGAACCAGGAGTGGGAAGG + Intronic
989445533 5:41524328-41524350 ACTGGAAGGCAGGAAGTGGAAGG - Intergenic
990224518 5:53634599-53634621 AGGGAGAGGAAGGAGGGGGAAGG - Intronic
990493827 5:56326978-56327000 ACTGGGAGACAGGACAGGGAGGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991503694 5:67302967-67302989 ACAGAGAGGGAGAAGGGGTAGGG + Intergenic
992453208 5:76891820-76891842 TGGGAGAGGGAGGAGGGGGAGGG + Intronic
993052318 5:82939896-82939918 ACAGAGAGAGAGAAGGGGGAGGG - Intergenic
993392035 5:87330688-87330710 ACTGAGAGCAAGAAGGGTGAAGG + Intronic
993413598 5:87600486-87600508 ACTTAGAGGCAACAGAGGGAAGG + Intergenic
993523481 5:88934819-88934841 ACTGAGATGGAGGAGAGAGATGG - Intergenic
993786636 5:92147065-92147087 ACTGAGAGCCAGCAGCAGGATGG + Intergenic
995042602 5:107605853-107605875 ACTGGGAGGAAGCAGGGGGAGGG + Intronic
995224567 5:109689274-109689296 ACTGGGAGGCAGGCGCGGGGCGG + Intergenic
995336080 5:111001382-111001404 ACTGAAAAGCAGGAAGGGCAAGG + Intergenic
995668655 5:114574489-114574511 GCAGGGTGGCAGGAGGGGGAGGG + Intergenic
995926549 5:117381837-117381859 ATAGAGAGGCAGGAGAGGGAGGG - Intergenic
996203322 5:120701501-120701523 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
996344885 5:122477515-122477537 ACTGCTGGGCAGGAGGGGGAGGG + Intergenic
996726067 5:126674265-126674287 ACTGTTGGGCAGGTGGGGGAGGG + Intergenic
996745510 5:126843469-126843491 ATTGCTGGGCAGGAGGGGGAGGG + Intergenic
997434136 5:133862030-133862052 ACTGAGAAGCAGGAGGGGCCAGG + Intergenic
997527171 5:134560829-134560851 ATTGAGACGCAGGAGGGGCTGGG + Exonic
997806646 5:136924520-136924542 ACTGATATGCAAGATGGGGAGGG + Intergenic
997986749 5:138507683-138507705 ACTGCCAGTCTGGAGGGGGACGG + Exonic
998754203 5:145358256-145358278 TATGAGAGGGAGGAGGTGGATGG + Intergenic
999257968 5:150220342-150220364 AATCAGGGGCAGGTGGGGGAGGG + Intronic
999625562 5:153517020-153517042 AGAGAGAGGCAGGAGGTGGGAGG + Intronic
999664480 5:153898392-153898414 ACAGAGAGGCAGCAGTGGGCAGG + Intergenic
999869140 5:155731112-155731134 ACAGAGGGGCACGAGAGGGAGGG + Intergenic
999969373 5:156843917-156843939 ATTGAGAGTGAGGATGGGGAAGG + Intergenic
1000235929 5:159360558-159360580 ACTCAGAGGGAAGAGTGGGAGGG + Intergenic
1000838673 5:166188486-166188508 ACTGAGGGGCAGCAGGAGGGAGG + Intergenic
1001021557 5:168187286-168187308 AGTGACAGGCTGGAGGGGGAGGG + Intronic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1001333924 5:170782671-170782693 ATGGAGGGGCAGGAAGGGGAGGG - Exonic
1001635010 5:173203420-173203442 AGAAAGAGGGAGGAGGGGGAGGG - Intergenic
1001746924 5:174099323-174099345 ACTGCGAGACAAGAGGAGGAAGG - Intronic
1002031349 5:176433022-176433044 AGGGAGAGGAGGGAGGGGGAGGG - Intergenic
1002297293 5:178238808-178238830 ACTGAGAGGGAGTGGGGGGAGGG - Intronic
1002554102 5:180020780-180020802 ACACAGAGGCAGAAGGGGGGTGG + Intronic
1002568290 5:180126425-180126447 GCTGGGAGGCAGGAACGGGAGGG - Intronic
1002729568 5:181325426-181325448 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1002730127 5:181327611-181327633 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1002754405 6:146488-146510 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1002928685 6:1619463-1619485 CCTGAGAGGGGGGAGGGGGATGG - Intergenic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1003145985 6:3511173-3511195 ACTGAGAGGTGGGAGCAGGAAGG + Intergenic
1003389118 6:5698331-5698353 AGTGAGAGAGAGTAGGGGGAGGG + Intronic
1004015645 6:11729483-11729505 TCTCAGGGACAGGAGGGGGAAGG - Intronic
1004560485 6:16744613-16744635 AGTGAGGGGCAGGTGGGAGAAGG + Intronic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1005481751 6:26261566-26261588 ATTGAGAGACAGGAGGGGTGGGG - Intergenic
1005857029 6:29870435-29870457 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005862848 6:29914586-29914608 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005874351 6:29999784-29999806 ATTGAGGAGCAGGAGGGTGAAGG + Intergenic
1005940165 6:30554974-30554996 ACTGTGAGGAAGGAGGGGTCTGG - Intronic
1006137782 6:31906419-31906441 CCTCCGAGGTAGGAGGGGGAGGG - Intronic
1006457786 6:34141897-34141919 TCTGGGAGGCAGCAGGGAGAGGG + Intronic
1006648954 6:35535337-35535359 ACTGAGAGGCTGGGGTAGGAAGG - Intergenic
1006739073 6:36294399-36294421 GGTGAGAGGCAGGAGGGGTCTGG + Exonic
1006801747 6:36764301-36764323 GCTGAGAGGCAAGGAGGGGAGGG + Intronic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007914054 6:45544365-45544387 ATTGAGAGGAAGGAGTGGGGAGG + Intronic
1008349119 6:50468009-50468031 CCAGAGAGGCAGGAGTGAGAAGG - Intergenic
1008395179 6:50997965-50997987 GCTAAGAAGCAGGAGTGGGAGGG - Intergenic
1010579338 6:77574900-77574922 ATTGAGAGACAGGAGGGCGGAGG - Intergenic
1011455549 6:87544817-87544839 AGTGAGAGGTAGGAGTGGGTTGG - Intronic
1011753543 6:90476680-90476702 CCCTAGAGGCAGGAGGGGGGTGG - Intergenic
1012251956 6:96990603-96990625 ACTTGGAGGCAGCAGAGGGAGGG + Intronic
1012409162 6:98936507-98936529 ACTAAGAGGGAGGAAGAGGATGG - Intronic
1012449408 6:99339180-99339202 ACTGGGAGGTTGGAGGGGGTGGG - Intronic
1012548453 6:100447419-100447441 ACGGAGAGACAGGAGGCAGATGG + Intronic
1012888187 6:104868719-104868741 AGAGAGAGACAGGAGAGGGATGG - Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1013269631 6:108533998-108534020 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013269643 6:108534054-108534076 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1014688230 6:124530469-124530491 AATGGGAGGCAGGAGAGGTAGGG + Intronic
1015275300 6:131377822-131377844 AAGGAGAGGCAGGAGAGAGAAGG - Intergenic
1015323767 6:131903485-131903507 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1015715915 6:136191805-136191827 ACTGAGAGCGAGGAGCAGGAAGG + Exonic
1015922700 6:138281463-138281485 ACTGCAAGGCAGGAGAGGGAGGG - Intronic
1016207231 6:141483876-141483898 ACTGGGAGGGTGGAGGGTGATGG + Intergenic
1016248800 6:142017607-142017629 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1016429604 6:143968864-143968886 ACTGGGGGGCAGGAGTTGGAGGG + Intronic
1016486299 6:144543295-144543317 CCTGGGAAGCAGGTGGGGGATGG + Intronic
1016564422 6:145437220-145437242 ACATGGAGGCAGGAGGGGGGCGG - Intergenic
1016798845 6:148147508-148147530 AAAGAAAGGCAGGAGGGGAAAGG - Intergenic
1016956550 6:149632658-149632680 GCTGAGAGACAGGAATGGGAGGG - Intronic
1016992202 6:149938162-149938184 ACTGTGAGGCTGGAGGGGGTGGG + Intergenic
1016994758 6:149954102-149954124 ACTGTGAGGCTGGAGGGGGTGGG + Intergenic
1017003848 6:150015334-150015356 ACTGTGAGGCTGGAGGGGGTGGG - Intergenic
1017694419 6:157000188-157000210 CCTGGGAGGCTGGAGAGGGAGGG + Intronic
1017777756 6:157692616-157692638 ACTGGGAGGCAGTAAGGAGATGG - Intergenic
1018134900 6:160769609-160769631 ACTGAGGGGCATGAGGCAGAAGG - Intergenic
1018396109 6:163379213-163379235 GCTGTGAGGAAGGAAGGGGATGG - Intergenic
1018652032 6:165999988-166000010 ACTGAGAGCAAGGAGGGACATGG - Intergenic
1019316085 7:387577-387599 ACTGAGGCGCAGGAAGGGCACGG + Intergenic
1019483570 7:1277265-1277287 AGGGAGAGGGAGGAGGGAGAAGG - Intergenic
1019513359 7:1429321-1429343 CCTGAGACGCAGGAGGCTGACGG - Intronic
1019637178 7:2082160-2082182 GAAGGGAGGCAGGAGGGGGAGGG + Intronic
1019638301 7:2088626-2088648 AGCGAGAGGCAGCAAGGGGACGG + Intronic
1019724730 7:2595273-2595295 ACTGAGAGGCAGGAGGGGCTTGG + Intronic
1019999100 7:4744773-4744795 ACTGGGCGGAAGGAGGGGAAAGG - Intronic
1020091429 7:5344460-5344482 CATGAGAGCGAGGAGGGGGAAGG + Intronic
1020222069 7:6246674-6246696 ACTGAGAAGTAGGTGGGGGTGGG - Intronic
1020904555 7:14048954-14048976 GCTGAGAGTGAGGATGGGGAAGG - Intergenic
1021355828 7:19652047-19652069 GCTTGGAGGCAGGAGGGGAAGGG - Intergenic
1021451339 7:20785701-20785723 TCCGAGAGGGAGGAGGGAGACGG + Exonic
1021883621 7:25116986-25117008 ACTGAGAGGCTGGCCGAGGAAGG + Intergenic
1022015413 7:26345006-26345028 ACGAAGACGGAGGAGGGGGAGGG - Intronic
1022094594 7:27130799-27130821 GAAGCGAGGCAGGAGGGGGAGGG - Exonic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022703009 7:32778868-32778890 AATGAGAGGCAGCAAGGGGCAGG - Intergenic
1022780712 7:33579756-33579778 ACTTAGAGTGAGGAGGTGGAGGG - Intronic
1022833434 7:34091030-34091052 ACTGGGAGGTAGGAGGTGGGAGG + Intronic
1023021662 7:36016952-36016974 AGAGAGAGGCAGGATGGGGCTGG - Intergenic
1023400792 7:39792213-39792235 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1024075286 7:45814811-45814833 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1024119440 7:46222094-46222116 GCTGAGAGGAAGTAGGGGCAGGG + Intergenic
1024270976 7:47641259-47641281 GCTGAGAGACAGCAGGGGGTGGG - Intergenic
1024648313 7:51386512-51386534 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1024648844 7:51388585-51388607 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1024649077 7:51389470-51389492 ACTGGGAGGCAGGAGGAGGTGGG + Intergenic
1025053155 7:55744800-55744822 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1025111452 7:56220129-56220151 AAAGAGAGGAAGGAGGAGGAGGG + Intergenic
1025129122 7:56366664-56366686 ACTGGGAGGCAGGAGAGGCTGGG + Intergenic
1025200410 7:56958104-56958126 GCAGAGGGGCAGGAGGGGAAAGG - Intergenic
1025671533 7:63618828-63618850 GCAGAGGGGCAGGAGGGGAAAGG + Intergenic
1026135571 7:67657742-67657764 ACTGAGAGACAGGATGGAGATGG - Intergenic
1026529553 7:71185148-71185170 ACAGAGAGGAAGGAAGGGGAGGG - Intronic
1026944104 7:74305435-74305457 ACTGGGAGGGAGGTGGGGGGAGG - Intronic
1026979684 7:74519093-74519115 ATGCAGAGGCAGGAAGGGGAGGG + Intronic
1027054903 7:75043179-75043201 ACTGAGAGGCAGGGCCGGGTCGG - Intronic
1027223648 7:76230633-76230655 ATTGAGAGTCAGGAAGGGAAGGG + Intronic
1027529035 7:79307101-79307123 ACTGAGCAGCAGGAGTGGTAGGG + Intronic
1028528186 7:91808724-91808746 AATGAGAGGTAGTGGGGGGAGGG + Intronic
1028653850 7:93179786-93179808 GCTGGGAGACAGGAAGGGGAGGG + Intergenic
1028903350 7:96125480-96125502 ACTAACACTCAGGAGGGGGAAGG - Intronic
1028944647 7:96563313-96563335 ATTGAGAGTGAGGATGGGGAGGG + Intronic
1029197338 7:98814786-98814808 ACAGCGAGGCAAGAGGGTGAGGG - Intergenic
1029281818 7:99440147-99440169 ACTGAGACCCAAGCGGGGGAAGG + Intronic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029465561 7:100722601-100722623 GCTGAGGGGCAGGAGGGAGAGGG + Intronic
1029611733 7:101630248-101630270 ACTGGGAGGGAGCAGGAGGAGGG - Intergenic
1029723248 7:102384255-102384277 ACTTGGACGCACGAGGGGGAGGG + Intronic
1030105363 7:105982549-105982571 ACTGAGGGGGAGAAGGGGAAAGG - Intronic
1030264675 7:107607483-107607505 ATTGAAAGGATGGAGGGGGATGG - Intronic
1030515553 7:110533792-110533814 ACTGAGAGGCATAAGGCAGAAGG - Intergenic
1030727911 7:112947857-112947879 CCTGGGAGGCAAGAGTGGGAGGG + Intergenic
1031776261 7:125911788-125911810 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1031878373 7:127167739-127167761 TCTGAGAAGAAGGAGGGAGATGG - Intronic
1032016567 7:128383893-128383915 AATGAGAGGGAGGAGGGGCCAGG + Intergenic
1032051289 7:128652547-128652569 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1032075378 7:128833446-128833468 TCCGAGAGGGAGGAGGGAGAGGG + Intronic
1032291782 7:130595804-130595826 ACTGGTAGGCTGGAGGGGGGGGG - Intronic
1032319764 7:130875310-130875332 AGTGACAGGCAGGAGGGAAAAGG + Intergenic
1032464830 7:132137673-132137695 ACTTGGAGGCAGGAATGGGAGGG + Intronic
1032474762 7:132204190-132204212 GCTGAGAGATAGGAGGTGGAGGG + Intronic
1032684902 7:134223417-134223439 TCTCAGAGGCAGCAGGGGGTAGG + Intronic
1032948716 7:136882440-136882462 GCTGAGAAGAAGGAGGGGGAAGG - Intronic
1033256577 7:139806742-139806764 GATGAGAGGGAGGATGGGGAGGG - Intronic
1034088191 7:148339441-148339463 ACTGAAAGGCAGGTGAGGGGAGG - Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1034993872 7:155566037-155566059 ACTGAGAGACAGCAGGGAGACGG + Intergenic
1034999872 7:155604070-155604092 ACTGCAAGGGAGGAGGGAGAGGG + Intergenic
1035021270 7:155802397-155802419 GCTGAGAAGCAGGAGATGGAAGG + Exonic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035555121 8:562273-562295 ACTGAGGGGCTGGGGTGGGAAGG + Intergenic
1035766220 8:2107701-2107723 ACTCACAGGCAGGGTGGGGAAGG + Intronic
1036757003 8:11477388-11477410 GCTGAGAGGAAGGAGGGGGTGGG - Intergenic
1037226783 8:16602235-16602257 ATCGGGAGCCAGGAGGGGGATGG - Intergenic
1037964328 8:23122062-23122084 ACTCAGAGGCAGTAGCAGGAAGG + Intergenic
1038309113 8:26431874-26431896 ACTGAGAGGGTGCGGGGGGAAGG - Intronic
1038310017 8:26439312-26439334 CCTGAGAGGCAGGAGGTGCTTGG + Intronic
1038360656 8:26872662-26872684 ACAGAGCGGCAGGAGAGAGAGGG - Intergenic
1038522909 8:28248600-28248622 CGTGAGAGGCAGGAGTGGGTTGG + Intergenic
1038547702 8:28438480-28438502 GCTGAGAGACAGGTGGAGGAGGG - Intronic
1039048092 8:33468293-33468315 AGGGAGAGGGAGGAGGAGGAGGG - Intronic
1039302110 8:36221082-36221104 ATTGAGAGACAGGAGGGGTAGGG - Intergenic
1039371052 8:36984243-36984265 CCTGACAGGCTGGAGGAGGAGGG + Intergenic
1039388380 8:37157155-37157177 AATGAGGGGCAGGGAGGGGAAGG + Intergenic
1039454681 8:37698700-37698722 AGGGAGAGGGAGGAGGGTGAGGG - Exonic
1039868988 8:41529447-41529469 ACTGAGAGGGAGGAGGGGAGGGG + Intronic
1040391013 8:46950561-46950583 ACTCAGAGTCAGGAGGAAGATGG - Intergenic
1041377279 8:57217061-57217083 ACTGAGGGGCATGAGGCGGAGGG + Intergenic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1042843423 8:73147417-73147439 CCTGTCAGGCAGGAGGGGGTAGG - Intergenic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1043666759 8:82825169-82825191 CCTGAGAGTCAGTAGGGGGTGGG - Intergenic
1044983244 8:97736375-97736397 AGGGAGGGGGAGGAGGGGGAGGG + Intergenic
1045056403 8:98371967-98371989 ACTGAGTGGGATCAGGGGGAGGG + Intergenic
1045186265 8:99841657-99841679 ACTGAGAAGCAGTAGGCAGAAGG - Intronic
1045246246 8:100443982-100444004 ACTAAGAGGCAGGACAGGGATGG + Intergenic
1045357094 8:101398921-101398943 ATTGAGATGCAAGAGAGGGAGGG - Intergenic
1045412838 8:101936103-101936125 GCTGAGAGTGAGGAGGGGGTTGG + Intronic
1045948082 8:107819703-107819725 GCTAAGAGGCAGGAAGAGGAGGG - Intergenic
1046092961 8:109524863-109524885 ACAGAGAGGACAGAGGGGGAGGG - Intronic
1046689713 8:117268759-117268781 ACAAAGAGGCAGGAGAGAGAGGG + Intergenic
1046892078 8:119433301-119433323 GCTGAGAGCCAGGAAAGGGAAGG - Intergenic
1047107494 8:121749296-121749318 ACAAATAAGCAGGAGGGGGAAGG + Intergenic
1047476468 8:125236598-125236620 TCTGAGAGACAGGAAGGGCATGG + Intronic
1047612136 8:126531523-126531545 GATGAGAGGCAGGAGGGATAAGG + Intergenic
1047631012 8:126708577-126708599 ATTGAGAGGGAAGATGGGGAAGG - Intergenic
1047731234 8:127730340-127730362 ACTAAAAGCCAGGAGGGGAAGGG + Intergenic
1047959064 8:129997695-129997717 ACCTAGTGGCAGGAGGGGGAGGG - Intronic
1048029265 8:130615699-130615721 GCTGAGAGGGAAAAGGGGGAGGG - Intergenic
1048572942 8:135669952-135669974 AATGTGAGGCAGAAGAGGGAGGG - Intergenic
1048764302 8:137828757-137828779 ATTGCTAGGCAGGTGGGGGAGGG + Intergenic
1049059424 8:140264583-140264605 AGAGAGAGAGAGGAGGGGGAGGG + Intronic
1049180171 8:141218171-141218193 ACCGAGAGTGAGGAGGGGGAGGG - Exonic
1049253189 8:141600192-141600214 ACCTAGAGGCTGGAGGGGGAAGG + Intergenic
1049331887 8:142059011-142059033 ACTGAGAGGCAAGGCTGGGACGG - Intergenic
1049354359 8:142180198-142180220 GGTGAGAGGGAGGAGGGGCAGGG + Intergenic
1050005399 9:1124416-1124438 ACTGAGACACAGGAGGGTAAGGG + Intergenic
1051165935 9:14261953-14261975 ATTGCAAGGCAGGAGGTGGAGGG + Intronic
1051431659 9:16985801-16985823 ACTGGGAGGAAGGATGGGGTGGG + Intergenic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051840457 9:21391951-21391973 GCTGCGAAGCAGGAGGAGGAAGG + Intergenic
1051910415 9:22148722-22148744 AGTGAGAGACAGAAGAGGGAGGG - Intergenic
1052434859 9:28413489-28413511 ACTGAGAGGGAGAAGTTGGAGGG - Intronic
1052939952 9:34125626-34125648 ACTGAGAGGGAGAAGGGGGCTGG - Intronic
1053113464 9:35481770-35481792 ACAGTGAGCCAGGAGGGGAAAGG - Intergenic
1053382431 9:37659986-37660008 GCTGAGAGAAAGCAGGGGGAGGG + Intronic
1053423632 9:37997031-37997053 GCTGACAGGCAGGAGGTGGGTGG + Intronic
1053474496 9:38372344-38372366 ACAGAGAGGCAGGGTGGGCACGG + Intergenic
1053580548 9:39399494-39399516 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1053705881 9:40752271-40752293 ACTGAGAGTGAGGAAGGGCAAGG - Intergenic
1053845044 9:42227568-42227590 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1054102135 9:60958299-60958321 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1054415958 9:64875875-64875897 ACTGAGAGTGAGGAAGGGCAAGG - Intergenic
1054584224 9:66948564-66948586 ACTGAGAAGAAGGAGAAGGAGGG + Intergenic
1054906581 9:70418859-70418881 ACCCAGGGGCTGGAGGGGGAAGG + Intergenic
1055030355 9:71767804-71767826 ACAGAGAGGCAGGGGGCGGAGGG + Intronic
1055074237 9:72197286-72197308 ATAGAGAGGCAGCAGGGAGAGGG - Intronic
1055638351 9:78298718-78298740 CCTGGGGGGCAGGAGGGTGAGGG + Intronic
1055650049 9:78398237-78398259 GCTGAAAGGCAGTTGGGGGACGG + Intergenic
1055809983 9:80139209-80139231 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1055931033 9:81560055-81560077 ACAGGGAGTGAGGAGGGGGAGGG + Intergenic
1056323819 9:85460446-85460468 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1056522378 9:87412726-87412748 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1056526398 9:87446867-87446889 ACTGAGGGGCAGGGTGGGGATGG - Intergenic
1056882915 9:90414375-90414397 ATTGCTGGGCAGGAGGGGGAAGG - Intergenic
1056919400 9:90772742-90772764 ACTGAGAAGCAGGAAGGAGTAGG + Intergenic
1056958507 9:91101601-91101623 CCCTACAGGCAGGAGGGGGACGG - Intergenic
1057231547 9:93324535-93324557 ATGGGGAGGCTGGAGGGGGATGG - Intronic
1057234780 9:93349405-93349427 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1057236542 9:93366082-93366104 ATGGGGAGGCTGGAGGGGGATGG + Intergenic
1057263005 9:93596541-93596563 ACTGGGAGTCGGGAGGGGCAGGG + Intronic
1057270007 9:93645320-93645342 ACAGAGAGGCAGGAGGCGCCTGG - Intronic
1057277453 9:93683628-93683650 ACTGAGAGCCAGCAGGGCCAGGG + Intergenic
1057339814 9:94190056-94190078 AATGAGAAGCAGGAGGGGAGTGG - Intergenic
1057683934 9:97216643-97216665 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1057847506 9:98536893-98536915 ACTGAGGAGCAGGATGGAGAAGG - Intronic
1058888166 9:109338746-109338768 AATGAGAGTGAGCAGGGGGAGGG - Intergenic
1058910073 9:109512896-109512918 ACTTAGGGGCAGGAGGAGGGAGG - Intergenic
1059309271 9:113377130-113377152 AGTGAGACGAAGGAGGGAGAGGG - Intergenic
1059438838 9:114291394-114291416 TCTGAGACACAGGAGGCGGAGGG + Intronic
1059964674 9:119601967-119601989 ACTGAGGCCCAGGAAGGGGAAGG - Intergenic
1060124014 9:121024260-121024282 AGTGGGAGGGGGGAGGGGGAGGG + Intronic
1060220966 9:121763914-121763936 ACTGAAGGACAGGATGGGGAAGG - Intronic
1060268610 9:122126428-122126450 AATGTGAAGCTGGAGGGGGAGGG + Intergenic
1060442689 9:123656233-123656255 AGTGAGAGGCAGGGCGGGGAGGG + Intronic
1060578973 9:124726303-124726325 AGTTAGGGGCAGGAGGGAGAAGG - Intronic
1060636828 9:125205956-125205978 ACGGAGAGTCAGGAGGTGGCTGG + Intronic
1060843498 9:126814887-126814909 ACTGAAATGAAGGTGGGGGAGGG - Intronic
1060998998 9:127891768-127891790 ACAGAGAGGGGGGAGAGGGAGGG + Intronic
1061003651 9:127916511-127916533 ACTCAGAGCCGGGAGGGGTAAGG + Intronic
1061315911 9:129795711-129795733 ACTCCGAGGCAGGAGAGAGAAGG + Intergenic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1062021143 9:134319958-134319980 GCTGAGACGCAGGGAGGGGAGGG - Intronic
1062023924 9:134331859-134331881 GCTGAGAGGCAGGAGGACCAGGG - Intronic
1062060299 9:134491913-134491935 CCTGAGAGGCAGGTGGAGGCAGG - Intergenic
1062174073 9:135151261-135151283 ACAGTAAGGCAGGAGGGCGAAGG + Intergenic
1062185648 9:135216870-135216892 AGTGTGAGTGAGGAGGGGGAAGG + Intergenic
1062207073 9:135343103-135343125 GCTGAGAGGCAGGAGGAAGCTGG - Intergenic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062754542 9:138280125-138280147 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1203563696 Un_KI270744v1:76690-76712 ACTGAGAGGGTGCAGGGGGATGG - Intergenic
1203577539 Un_KI270745v1:20695-20717 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1203578444 Un_KI270745v1:24285-24307 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1186532850 X:10314687-10314709 AATGAGAGGCAGGAGAGGGAAGG + Intergenic
1187205269 X:17175863-17175885 TCAGAAAGGCAGGTGGGGGAAGG + Intergenic
1187285329 X:17898756-17898778 ACGCAGAGGCAGGAAGGGCAGGG - Intergenic
1187302229 X:18061838-18061860 ACAGTGAGGGAGTAGGGGGAAGG + Intergenic
1187495685 X:19793508-19793530 ACTCAGAGGTGGGAGGTGGATGG - Intronic
1187499009 X:19823132-19823154 GCTGAGTGGGAGGATGGGGATGG + Intronic
1187509941 X:19908636-19908658 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1187689168 X:21847034-21847056 AATGTGAGGCTGGAGGGAGAAGG + Intronic
1187895623 X:23977215-23977237 TTAGAGAGGCAGGAGGGGGGTGG + Intergenic
1188605808 X:32028018-32028040 GAAGAGAGGCAGGAGAGGGAGGG + Intronic
1188662203 X:32774577-32774599 ACTAGGTGGCAGGAGGGGGCAGG + Intronic
1188708412 X:33363755-33363777 ACTGAGAGTCATTAGTGGGATGG + Intergenic
1189332977 X:40154413-40154435 ACAAAGGGGGAGGAGGGGGACGG - Intronic
1189668117 X:43379117-43379139 AATGAGAGGGAGGAGAGGGGAGG + Intergenic
1189773808 X:44452121-44452143 ACTGAGATGCAGGAAGGGTGAGG + Intergenic
1189993047 X:46612635-46612657 ACTGAGATGCAGGCCGGGCATGG + Intronic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190969073 X:55331451-55331473 ACTGAGAGATATGAGAGGGATGG - Intergenic
1191641784 X:63434341-63434363 ACAGAGAGGAAAGAGGGGGAAGG + Intergenic
1192184654 X:68938866-68938888 ACTGAGAAGAGGGAGGGGAAAGG - Intergenic
1192207311 X:69105076-69105098 TCTGAAAGCCAGGATGGGGAAGG + Intergenic
1193063809 X:77235504-77235526 ACTGACAGGAGGTAGGGGGAGGG + Intergenic
1193746434 X:85288228-85288250 ACTGAGGGGCAGGAGGTAGTTGG - Intronic
1194161921 X:90464674-90464696 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195446743 X:104960707-104960729 ACTTGGAGGGAGGAGGGGGAAGG - Intronic
1195691222 X:107627422-107627444 ACTGAGATGGAGGTGGGAGAGGG - Intergenic
1195937472 X:110139427-110139449 GCTGAGAGCGAGGATGGGGAAGG + Intronic
1196073020 X:111545718-111545740 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1196144792 X:112304843-112304865 AGAGAGATGCAGGAGTGGGATGG - Intergenic
1196165482 X:112532417-112532439 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1196299948 X:114041785-114041807 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1196330759 X:114468564-114468586 ATTGCTGGGCAGGAGGGGGAGGG - Intergenic
1196341780 X:114605211-114605233 ATTGCTGGGCAGGAGGGGGAGGG + Intronic
1196769587 X:119280704-119280726 ACTGAGAGGGAGGATGGGAGGGG - Intergenic
1196914135 X:120514266-120514288 ACTAAGGGGCTGGAGTGGGAAGG - Intergenic
1197125972 X:122946681-122946703 TCTAAGAGGCAGCAGGGGAAAGG - Intergenic
1197282402 X:124552684-124552706 TCTGAGAGGTAAGAGGGAGATGG - Intronic
1198985714 X:142450609-142450631 GCTGAGGGCCAGGAAGGGGAGGG - Intergenic
1199082402 X:143591517-143591539 ACTGAGAGGCATAAGGTAGAAGG + Intergenic
1199207417 X:145164966-145164988 AGTAAGAGGTAGGAGGGGGCAGG + Intergenic
1199315642 X:146374533-146374555 ATTGAGAGACTGGAGGGAGATGG - Intergenic
1199511897 X:148631678-148631700 ATTGAAAGGCAGGGGGAGGAGGG + Intronic
1199542384 X:148971583-148971605 AATGAGAGGCGGGAAGGTGATGG - Intronic
1200019775 X:153192840-153192862 AGAGTGAGTCAGGAGGGGGAAGG - Intergenic
1200102261 X:153694037-153694059 ACAGGGAGCCAGGAGGGGGGCGG + Intronic
1201421725 Y:13806684-13806706 ACTGAGAGGGAGGGAGGGAAGGG - Intergenic
1201461744 Y:14233036-14233058 AATGAGGAGGAGGAGGGGGAGGG - Intergenic
1201910024 Y:19124528-19124550 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1201968368 Y:19763410-19763432 TCTGAAAGGCAGGAGCAGGATGG + Intergenic
1202381082 Y:24276911-24276933 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1202489703 Y:25393215-25393237 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic