ID: 1101734633

View in Genome Browser
Species Human (GRCh38)
Location 12:107453859-107453881
Sequence CAGAATAGTACCAAATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101734633_1101734642 1 Left 1101734633 12:107453859-107453881 CCTGGGAATTTGGTACTATTCTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1101734642 12:107453883-107453905 AAGTAGGGGTGAGGAGGGGGAGG 0: 1
1: 0
2: 11
3: 176
4: 1695
1101734633_1101734643 7 Left 1101734633 12:107453859-107453881 CCTGGGAATTTGGTACTATTCTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1101734643 12:107453889-107453911 GGGTGAGGAGGGGGAGGAATTGG 0: 1
1: 2
2: 42
3: 529
4: 4495
1101734633_1101734640 -3 Left 1101734633 12:107453859-107453881 CCTGGGAATTTGGTACTATTCTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1101734640 12:107453879-107453901 CTGCAAGTAGGGGTGAGGAGGGG 0: 1
1: 0
2: 2
3: 42
4: 413
1101734633_1101734641 -2 Left 1101734633 12:107453859-107453881 CCTGGGAATTTGGTACTATTCTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1101734641 12:107453880-107453902 TGCAAGTAGGGGTGAGGAGGGGG 0: 1
1: 0
2: 8
3: 40
4: 537
1101734633_1101734638 -5 Left 1101734633 12:107453859-107453881 CCTGGGAATTTGGTACTATTCTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1101734638 12:107453877-107453899 TTCTGCAAGTAGGGGTGAGGAGG 0: 1
1: 0
2: 2
3: 22
4: 220
1101734633_1101734637 -8 Left 1101734633 12:107453859-107453881 CCTGGGAATTTGGTACTATTCTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1101734637 12:107453874-107453896 CTATTCTGCAAGTAGGGGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 133
1101734633_1101734639 -4 Left 1101734633 12:107453859-107453881 CCTGGGAATTTGGTACTATTCTG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1101734639 12:107453878-107453900 TCTGCAAGTAGGGGTGAGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101734633 Original CRISPR CAGAATAGTACCAAATTCCC AGG (reversed) Intronic
901373585 1:8821023-8821045 CAGAGTAGTCTCAAATTCCTGGG - Intergenic
902253283 1:15170518-15170540 CAGACTGGTATCAAACTCCCAGG + Intronic
903787183 1:25869218-25869240 CAGAATAGTACTTACCTCCCAGG - Intronic
904194305 1:28773577-28773599 CAGGCTGGTATCAAATTCCCAGG - Intergenic
904974266 1:34443741-34443763 CATAATAGTGCCTAATTCACAGG + Intergenic
907105633 1:51879824-51879846 CAGGCTGGTACCAAATTCCCAGG - Intergenic
908918031 1:69155717-69155739 CACAAAAGTACCAAACTCACTGG - Intergenic
910619408 1:89236339-89236361 CATAAGACTACCAAGTTCCCAGG - Intergenic
910925959 1:92398482-92398504 CAGAATAGTACCACTTACCTTGG - Exonic
912061997 1:105685726-105685748 CAGGATAGTAACAATTTCTCTGG + Intergenic
912179775 1:107205748-107205770 CAGAACATTACCACACTCCCAGG + Intronic
913489949 1:119369734-119369756 GGGAATATTGCCAAATTCCCAGG + Intronic
913748000 1:121928612-121928634 CAGAGAAGTCCCAAAATCCCTGG + Intergenic
914988854 1:152481206-152481228 CAGAATTGTCCCAGACTCCCAGG + Intergenic
916845008 1:168641756-168641778 CAGAATAGTAACAAAATCTAAGG + Intergenic
919607413 1:199702121-199702143 CAGAATATTAAACAATTCCCAGG + Intergenic
1063554749 10:7067668-7067690 CAGACTGGTCCCAAACTCCCAGG + Intergenic
1064244493 10:13657928-13657950 CAGGATGGTCTCAAATTCCCAGG - Intronic
1064846383 10:19659324-19659346 CATAATAGTACCCATCTCCCAGG - Intronic
1069621922 10:69842623-69842645 CACAGTTGTACCAAATGCCCAGG - Intronic
1071723906 10:88176686-88176708 CACAAAAGTACAAAATTCACTGG - Intergenic
1077699283 11:4425196-4425218 CATAATATTACCATATTCCCAGG - Intergenic
1079307006 11:19332302-19332324 CAGGATAGTCTCAAATTCCTGGG + Intergenic
1079437686 11:20474329-20474351 CTGAGAAGCACCAAATTCCCAGG - Intronic
1079908940 11:26285004-26285026 CAAAATAGTTCCAAATTGGCAGG - Intergenic
1080372862 11:31672579-31672601 CAGACTAGTCTCAAATTCCTGGG - Intronic
1082891593 11:58144685-58144707 CAGAAGAGTAGCAAATGTCCAGG - Intronic
1082968175 11:58989811-58989833 CAGAAGTGTACCATTTTCCCAGG + Intronic
1085353172 11:75814085-75814107 CAGACTAGTCTCAAACTCCCAGG - Intergenic
1085668676 11:78440484-78440506 GATAATAGTACCTAATTCACAGG + Intronic
1088633108 11:111793190-111793212 CAGACTAGTCTCAAACTCCCGGG + Intronic
1091202174 11:133789765-133789787 CAAAATAGTACCTAATGCACAGG - Intergenic
1093373374 12:18391714-18391736 TTGAATAGAACCAAAATCCCAGG + Intronic
1101734633 12:107453859-107453881 CAGAATAGTACCAAATTCCCAGG - Intronic
1106351288 13:28933037-28933059 CAGAACAATAACAAATTTCCAGG - Intronic
1106446526 13:29837571-29837593 AAGAATATTAGCTAATTCCCGGG + Intronic
1106962687 13:35018594-35018616 AAGAATTTTACCAAATTCTCAGG - Intronic
1108516518 13:51208300-51208322 CAGAAGAGTACCAAGTGCCAAGG + Intergenic
1110299596 13:73910686-73910708 CTGAATATTACCAAATAACCAGG + Intronic
1116746903 14:48831423-48831445 AAGAGTTGTACCAAATTCTCTGG - Intergenic
1118679028 14:68220167-68220189 TAGCATAGTACCAAATTTCTTGG - Intronic
1121751033 14:96356682-96356704 CTGAATGTTAGCAAATTCCCAGG + Intronic
1125368310 15:38942866-38942888 CAGAAGAGAACCAAATACCAAGG + Intergenic
1125800604 15:42443419-42443441 CAGGATAGTCCCAAACTCCTGGG - Intronic
1126962089 15:54007967-54007989 CAGTAAAGTACTAAATACCCAGG - Intergenic
1127853940 15:62939701-62939723 CAGTATAGTACCACATCCCATGG - Intergenic
1129662064 15:77558473-77558495 GAGAATAGAACCAAATTCCTAGG + Intergenic
1134650329 16:15903449-15903471 CATAATAGTACCTAACTCCTGGG + Intergenic
1142222949 16:88864351-88864373 CCGAAAAGAACCAACTTCCCTGG - Exonic
1146619335 17:34385416-34385438 CAGACTAGTCTCAAATTCCTGGG + Intergenic
1147169420 17:38609349-38609371 CAGAATAGGACCAGGTCCCCAGG - Intergenic
1149216961 17:54368821-54368843 GAGAATAACACAAAATTCCCTGG + Intergenic
1149317647 17:55453664-55453686 CAGAACATTACCAGATCCCCTGG + Intergenic
1153103515 18:1501129-1501151 CAGACTAGTCCCAAGTTTCCTGG - Intergenic
1153276155 18:3369714-3369736 CAGAATGGTCCCAAACTCCTGGG - Intergenic
1153347456 18:4043357-4043379 CATAATAGTATCTAATTCCATGG + Intronic
1153898782 18:9595926-9595948 CACAAAAGTACCAAATTCAGTGG - Intronic
1155482935 18:26309016-26309038 CAAAATTTTAACAAATTCCCTGG - Intronic
1155635437 18:27948965-27948987 CAGAAGAGATCCAAATTACCAGG + Intergenic
1155883362 18:31177814-31177836 CAGGCTAGTCTCAAATTCCCAGG - Intergenic
1156834449 18:41535790-41535812 CAAAATAGTACAAAGATCCCTGG - Intergenic
1157335699 18:46735821-46735843 CAGGCTAGTCTCAAATTCCCGGG + Intronic
1158497055 18:57965776-57965798 AAGAAGAGAAACAAATTCCCGGG + Intergenic
1159288616 18:66387488-66387510 CAGCATAATTCCCAATTCCCAGG + Intergenic
1159722362 18:71907594-71907616 CAGAATAATGACAAACTCCCAGG - Intergenic
1161075626 19:2283944-2283966 CAGGATGGTACCAAACTCCTGGG - Intronic
1162650958 19:12088725-12088747 CAGAATAGTCTCAAACTCCTGGG - Intergenic
1163882973 19:19943816-19943838 AAAAATACTACCGAATTCCCAGG + Intergenic
1165507002 19:36239533-36239555 CAGATTAGTCCCAAACTCCTGGG + Intronic
1165588863 19:36947707-36947729 CAGACTAGTCTCAAATTCCTGGG + Intronic
1166027730 19:40104037-40104059 CAGAGTAATACCAACATCCCAGG - Intergenic
1168261771 19:55199092-55199114 CAGGCTGGTATCAAATTCCCAGG - Intronic
926079806 2:9975988-9976010 CAAAATAGTACCAATTTCATAGG + Intronic
926352216 2:12006299-12006321 TATAATAATACCACATTCCCAGG + Intergenic
928077719 2:28280269-28280291 CAGGCTAGTCTCAAATTCCCTGG + Intronic
929023191 2:37574611-37574633 CAGACTAGTCTCAAACTCCCAGG - Intergenic
930134798 2:47891032-47891054 CAGACTAGTATCAAACTCCCGGG + Intronic
930867551 2:56136691-56136713 CAGAAGTGAACCAAATTCCCAGG - Intergenic
935746253 2:106192804-106192826 CATTATAGTACCGATTTCCCAGG + Intronic
936391407 2:112077955-112077977 CAGAGCAGTATCAAATCCCCAGG - Intronic
937779786 2:125823706-125823728 GAGATTAATACCAAATTCCCAGG - Intergenic
939058223 2:137388185-137388207 CATAATAGTACATACTTCCCAGG + Intronic
940705881 2:157104629-157104651 GAGAAAAAAACCAAATTCCCAGG + Intergenic
941235451 2:162966555-162966577 CAGAATAGTAACAAATACAGTGG - Intergenic
943402440 2:187431385-187431407 CATAATATTACCAAATTCACAGG - Intronic
946650018 2:221883237-221883259 CAGAAAAACACCAAATTTCCTGG + Intergenic
948706059 2:239793184-239793206 CAGAAAAGTGCCAAATCACCAGG + Intronic
1169678353 20:8180521-8180543 AGGAATGGTACCATATTCCCAGG + Intronic
1170240124 20:14155949-14155971 CAGACTGGTCTCAAATTCCCAGG - Intronic
1170290635 20:14764673-14764695 GAGTATTGTACCAAATTCCTAGG + Intronic
1170431714 20:16282504-16282526 CATAAAAGTAACCAATTCCCAGG - Intronic
1172659048 20:36554709-36554731 CAGACTAGTCTCAAATTCCTGGG + Intergenic
1172969990 20:38866238-38866260 CAGAATAGCTCCTAAATCCCGGG + Intronic
1173216363 20:41088543-41088565 AAGAATGGTGCCAAAGTCCCAGG + Intronic
1181905345 22:26190567-26190589 TATAATAGTACCAATTTCACAGG + Intronic
1182124516 22:27806779-27806801 CAGAACAGAACCACAATCCCAGG + Intergenic
1183344550 22:37300048-37300070 AATAATAGTACCAACTTCACAGG + Intronic
1183791748 22:40076947-40076969 CAGACTAGTCTCAAATTCCTGGG - Intronic
1184358655 22:43999784-43999806 CAGAGTAGTCTCAAATTCCTGGG - Intronic
952730225 3:36630808-36630830 CAGATTAGAACCACATTGCCAGG - Intergenic
953852783 3:46478753-46478775 CAGAATATTTCCAAATATCCTGG - Intronic
954340573 3:49950362-49950384 CAGCACAGTACCAATATCCCAGG - Intronic
956090081 3:65657140-65657162 AAGAATAGTACCTACTTCCTAGG - Intronic
957387839 3:79519946-79519968 CAGAATAGTCTCAAACTCCCAGG - Intronic
957526914 3:81389833-81389855 CAGAATACAAACATATTCCCTGG - Intergenic
959048016 3:101496464-101496486 CAGGCTAGTCCCAAATTCCTGGG + Intronic
962148260 3:132864707-132864729 CAAAATAATACCAAATTGGCTGG - Intergenic
962569073 3:136693777-136693799 CAGGCTGGTATCAAATTCCCAGG + Intronic
963667002 3:148200618-148200640 CATATCAGCACCAAATTCCCAGG + Intergenic
963869078 3:150394804-150394826 CAGCATACAAGCAAATTCCCAGG - Intergenic
966045591 3:175544595-175544617 CAGAATAGTGACAAATACACAGG - Intronic
966785416 3:183618840-183618862 CAGGAAAGTTCCAGATTCCCCGG - Intergenic
967371937 3:188756427-188756449 GAGAATAGTACCAAACTTCAAGG - Intronic
967647203 3:191939916-191939938 CAGAAATCTACAAAATTCCCTGG - Intergenic
968946011 4:3664668-3664690 AAGAATAGTACCACGTGCCCGGG - Intergenic
970609693 4:17713611-17713633 CAGAAAAATACCAAATTGCAGGG - Intronic
970790179 4:19848981-19849003 TACAATAATACCAAATTCCCAGG - Intergenic
971708804 4:30084833-30084855 CTGAATAGAACAAAATACCCAGG + Intergenic
971803490 4:31323508-31323530 CAGAATAAAACCAATGTCCCAGG + Intergenic
971853124 4:32010159-32010181 CTGAAGAATACCAAACTCCCGGG + Intergenic
973658969 4:53082703-53082725 CAGAAGAGGACCAAATTTGCAGG + Intronic
976194094 4:82516508-82516530 CATAATAGTACCTATTTCCTAGG + Intronic
979808655 4:125007139-125007161 CATAATGGTACCAAAATGCCAGG - Intergenic
979979444 4:127236593-127236615 TAAAATAGTACCTAATTCACTGG - Intergenic
980073912 4:128273293-128273315 GAGAATGGTACCCAATTCCTTGG - Intronic
981961511 4:150545470-150545492 CAGAATAATAACAGATTCCCTGG - Intronic
984331046 4:178319309-178319331 CAAAATAGTATCAAATTTCATGG + Intergenic
989105152 5:37856215-37856237 CAGGATAGTCCCAAACTCCTGGG - Intergenic
989179132 5:38558463-38558485 GAGAATAGTACCTATTTCACAGG - Intronic
989679384 5:44011572-44011594 CAGAATAGTACCTATTGCCTGGG - Intergenic
994349390 5:98727130-98727152 CAGAATAGTCTCAAATCCCTGGG + Intergenic
996518564 5:124400976-124400998 CAGAATATAACGAGATTCCCAGG - Intergenic
999317035 5:150590948-150590970 CAGAAAAGGAGCTAATTCCCTGG - Intergenic
1000434698 5:161193976-161193998 GAAAATAGTATCAATTTCCCTGG - Intergenic
1002549798 5:179979121-179979143 CACAATAGTATGAAATTCCCTGG - Intronic
1003416759 6:5916811-5916833 CAGAATAATAACAAACTCCTTGG - Intergenic
1007433140 6:41787836-41787858 CAGAAAAGGACCAAGTTCCTCGG - Intronic
1011220990 6:85054290-85054312 CAGAACAGTACCACTTTCCAGGG - Intergenic
1012240500 6:96865753-96865775 AATAATAGTACCAAATTCACAGG + Intergenic
1013060363 6:106628142-106628164 CAGAATACCACAAAGTTCCCTGG + Intronic
1013245209 6:108279819-108279841 AATAATAGTACCTAATTCACAGG + Intergenic
1013568816 6:111399304-111399326 CAGAAAAGTTCCAAGTTCCAAGG + Intronic
1016510860 6:144841425-144841447 CAGAAAATAACCAAATTCCTGGG + Intronic
1018026733 6:159812809-159812831 CAGACTAGTCTCAAATTCCTGGG - Intronic
1025759358 7:64375829-64375851 CAGAATAGTGACATATTCCTAGG + Intergenic
1028246405 7:88484015-88484037 GAAAATAGTACCAACTTCACAGG + Intergenic
1029424576 7:100487930-100487952 CAGACTGGTCCCAAATTCCTGGG - Intronic
1029561134 7:101303451-101303473 CAGAATAGTCACCAATCCCCAGG - Intergenic
1029968684 7:104767724-104767746 AAGTATAGTACCAAATCCACGGG + Intronic
1030076123 7:105738560-105738582 AAGAATAGTACATAATTCACAGG - Intronic
1035014897 7:155757284-155757306 CAGAACAGTTTCAAGTTCCCGGG - Intronic
1036148613 8:6277328-6277350 CATAATAGTACCTAAATCACAGG - Intergenic
1038016316 8:23518542-23518564 CAGAACACAACCAGATTCCCAGG + Intergenic
1039416256 8:37396854-37396876 AAGACTAGTACAAAAGTCCCAGG - Intergenic
1040795128 8:51281883-51281905 CAGAAAATTACCAGTTTCCCTGG + Intergenic
1041548111 8:59069316-59069338 GAGGATTGTACCAAATTACCTGG - Intronic
1041727066 8:61028507-61028529 GAGAGTAGTAGCAAATGCCCTGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1045833872 8:106496985-106497007 CAGAATGGTGCAAAAATCCCAGG - Intronic
1047370489 8:124252121-124252143 TAGAATAGTACCGACTTCACAGG - Intergenic
1047371956 8:124263469-124263491 AAGCATATTACCTAATTCCCAGG + Intergenic
1047975204 8:130123172-130123194 CAGAATAGGAATAAATTCCCAGG + Intronic
1050064540 9:1745151-1745173 CAGAATAGATCCTTATTCCCTGG + Intergenic
1050964779 9:11785239-11785261 CATGATAGTACCAATCTCCCAGG + Intergenic
1051363563 9:16303767-16303789 GAGAATAGTACCACATTCCATGG + Intergenic
1056136939 9:83639736-83639758 CAGAATAGTCACAATTTCACTGG - Intronic
1056175460 9:84030590-84030612 CAGAGTACTACCAAATTTACTGG - Intergenic
1059816376 9:117920331-117920353 CATAATAGTTCCTAATTCACAGG - Intergenic
1060087892 9:120717875-120717897 CATAATAGTACCTATTTCCTGGG - Intergenic
1186540787 X:10397917-10397939 CAGAATGCTACCAATATCCCTGG + Intergenic
1187176892 X:16904147-16904169 CAGAATGGTCTCAAATTCCTGGG - Intergenic
1187395403 X:18915042-18915064 TAGAATAATAACAAATTGCCAGG + Intronic
1189732449 X:44035740-44035762 CAGATAAGTCCAAAATTCCCAGG + Intergenic
1190299101 X:49045831-49045853 CAGACTAGTCTCAAACTCCCGGG - Intergenic
1192868894 X:75166703-75166725 CAGAGCATTAACAAATTCCCAGG + Intergenic
1194688389 X:96952910-96952932 CAGAACAGTCTCAAATTCCTGGG - Intronic
1195933700 X:110105340-110105362 CATAATAGTACCCAATTCATAGG - Intronic