ID: 1101735063

View in Genome Browser
Species Human (GRCh38)
Location 12:107457181-107457203
Sequence AGGTTTGCCCAGGATTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101735063_1101735066 10 Left 1101735063 12:107457181-107457203 CCTTGATAATCCTGGGCAAACCT 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1101735066 12:107457214-107457236 CACAGCTGCCTGTGTTAGCCTGG 0: 1
1: 0
2: 2
3: 32
4: 198
1101735063_1101735068 18 Left 1101735063 12:107457181-107457203 CCTTGATAATCCTGGGCAAACCT 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1101735068 12:107457222-107457244 CCTGTGTTAGCCTGGAATAATGG 0: 1
1: 0
2: 1
3: 17
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101735063 Original CRISPR AGGTTTGCCCAGGATTATCA AGG (reversed) Intronic
902875350 1:19337640-19337662 AGTTTTATCCAGGATCATCAAGG - Intergenic
903484254 1:23677847-23677869 GGGCTTGCCCAGGATCATCTGGG - Intergenic
905749108 1:40446354-40446376 AGTTTTTCCCAGGAATATAAGGG - Intergenic
908359202 1:63351018-63351040 AACTTAGCCCAGGATGATCAAGG + Intergenic
915947382 1:160163496-160163518 AGGTTTACCCATTATTATAAAGG + Intronic
918620941 1:186605203-186605225 AGGATTGTCAAGGATTATAAAGG - Intergenic
920724282 1:208419326-208419348 ACGTTTGCTGAGGACTATCATGG - Intergenic
923409110 1:233689968-233689990 AGGTTTGCCCAGAACTATCCTGG - Intergenic
1064522783 10:16221089-16221111 AAGTTTGCTTAGGATTATTAGGG + Intergenic
1069885409 10:71620522-71620544 AGGAATGCCCAGGAGTATCTGGG + Intronic
1071468757 10:85963658-85963680 AGGTGTGACCAGGAGAATCATGG - Intronic
1072126607 10:92451122-92451144 TAGTTTGCCCAGGATCATCCAGG - Intergenic
1073647147 10:105316961-105316983 AAGTTTGCCTAGGATTGTCTTGG + Intergenic
1074149438 10:110745114-110745136 GGGTTTGCCCAGGAGAAACAGGG - Intronic
1074424609 10:113339855-113339877 AGGTTTCCCCAGGACTGTAATGG - Intergenic
1075312714 10:121428284-121428306 AGGTGTCCCCAGGATAATGAGGG + Intergenic
1078080088 11:8197825-8197847 AGGTTTTCCCTGGATTTTCCCGG + Intergenic
1079194237 11:18311280-18311302 TGGTTTGCCTAGGATTGTCCCGG - Intronic
1079578233 11:22029626-22029648 CTTTTTGCCCAGGATTGTCATGG - Intergenic
1083063452 11:59898521-59898543 TGGTTTGCTCAGAATTCTCAGGG + Intergenic
1085806611 11:79642685-79642707 TGGTTTGCCCAGGACAATCCTGG + Intergenic
1085907922 11:80787104-80787126 AAGATTGCCCTGGATTATCTAGG + Intergenic
1087051317 11:93888991-93889013 ATCTTTGCCCATAATTATCAAGG + Intergenic
1087837901 11:102893042-102893064 AGTTTTGCCCACGATGATCTTGG - Intergenic
1089733622 11:120534953-120534975 AGGTTTGCCCGGGATCATCCTGG - Intronic
1090474282 11:127005238-127005260 AGGTGTGCCCAGGTTCATTAAGG - Intergenic
1093372666 12:18383688-18383710 AGGTTTGGACATGATTATCTGGG + Intronic
1094785374 12:33842430-33842452 AGGTTTGTCAAAGATTATCATGG - Intergenic
1097224623 12:57470221-57470243 AGCCTTGCCCTGGATTCTCAGGG - Intronic
1097927354 12:65143817-65143839 AGGTGTGGACAGGATTATAAAGG - Intergenic
1099040247 12:77644443-77644465 AGGAGTGCACAGAATTATCAGGG + Intergenic
1100906747 12:99309475-99309497 ATGCTTGCCAAGGATTTTCAAGG + Intronic
1101504578 12:105334133-105334155 AAGTCTACCCAGAATTATCAAGG - Intronic
1101735063 12:107457181-107457203 AGGTTTGCCCAGGATTATCAAGG - Intronic
1102770058 12:115468119-115468141 TGGTTTGCCCAGGACTGTCCTGG - Intergenic
1103593288 12:122007397-122007419 AGGTTTGCCCAGCCTGATGAGGG - Intergenic
1105736368 13:23275554-23275576 AGTTTTGCATATGATTATCAGGG + Intronic
1106389607 13:29322435-29322457 AGGTCTGCCCAGGCATTTCAGGG - Intronic
1109153521 13:58874515-58874537 AGGTTTCCCCAGAACTGTCATGG + Intergenic
1114033947 14:18603383-18603405 AGGTTTGCAAAATATTATCAAGG - Intergenic
1114078742 14:19182556-19182578 AGGTTTGCAAAATATTATCAAGG - Intergenic
1114124698 14:19711628-19711650 AGGTTTGCAAAATATTATCAAGG + Intergenic
1115878561 14:37889893-37889915 ACCTTTGACCAGGATGATCAGGG + Intronic
1116221798 14:42096636-42096658 AGTTTTGCCCAGGAAGTTCAAGG + Intergenic
1118836520 14:69482227-69482249 AGCCTTCCCCAGGATTATCTGGG + Intergenic
1118908174 14:70038426-70038448 TGGTTTGCCCAGGACTTTCCTGG - Intergenic
1122639462 14:103149721-103149743 AGGTTTGTCCAGCATTTGCATGG + Intergenic
1123510931 15:20999164-20999186 AGGTTTGCAAAATATTATCAAGG + Intergenic
1123568154 15:21572923-21572945 AGGTTTGCAAAATATTATCAAGG + Intergenic
1123604261 15:22008245-22008267 AGGTTTGCAAAATATTATCAAGG + Intergenic
1125348548 15:38743665-38743687 TGGTTTGCCCAGGACTGTCCTGG - Intergenic
1128843042 15:70865793-70865815 TGGCTTGCCCAGGATTTTCTTGG - Intronic
1129199123 15:73988388-73988410 AAGTTTGCCCAGGATCGTTATGG + Intronic
1129249810 15:74302675-74302697 AGGTTTGCCTAGGACTGTCTTGG - Intronic
1129858829 15:78844389-78844411 TGGTTAGCCCAGGATGTTCAGGG + Intronic
1131309094 15:91271417-91271439 AGGTGTGCCAAGGATTGTCTTGG + Intronic
1202976511 15_KI270727v1_random:300011-300033 AGGTTTGCAAAATATTATCAAGG + Intergenic
1133945339 16:10343300-10343322 AGGTTTGCTCAGGCTTATCTTGG - Intronic
1134381850 16:13734670-13734692 AGGTTTGTTCAGAATCATCATGG - Intergenic
1136176663 16:28521863-28521885 AGGTTTTCCCAGGGTTCCCATGG - Intergenic
1141007089 16:80362702-80362724 AGCTTTGCACAAGATCATCAGGG + Intergenic
1141370340 16:83480690-83480712 TGGTTTGCCCAGGAGTGTCCTGG + Intronic
1141804438 16:86333597-86333619 AGGTATGCAGAGGAATATCATGG + Intergenic
1141888104 16:86907079-86907101 ACGTTTGCACGGGATTGTCAAGG + Intergenic
1146262729 17:31432257-31432279 AGGTTTGCCCAGGACTGCCCTGG - Intronic
1150462463 17:65364146-65364168 AGGTTGGGCCAGGATCTTCATGG + Intergenic
1151527827 17:74682990-74683012 AGCCTTGCCCTGGATTACCATGG - Intronic
1152291829 17:79444211-79444233 AGGTTTGCCCAGCACCCTCAGGG + Intronic
1153973085 18:10244179-10244201 AGCTGTGCCCTGTATTATCAGGG - Intergenic
1153995182 18:10434339-10434361 AAGTTTGCCCAGGACTGTCCTGG + Intergenic
1157224270 18:45848682-45848704 GGGTGTGCCCCGGATTAGCAGGG - Exonic
1161807302 19:6452150-6452172 AGGGTTCCCCAGGATTCCCAGGG + Intronic
1162175858 19:8829658-8829680 TGGTTTGCCAAGGATTGTCCCGG + Intronic
1164633762 19:29778160-29778182 AGCTGTGCCCAGGATGATCGTGG + Intergenic
926168923 2:10538573-10538595 CGGTGTGCCCAGGATTATCCTGG + Intergenic
926411323 2:12605569-12605591 AGGTTTTCCCAGGACTGGCAGGG + Intergenic
927739111 2:25551382-25551404 AGGCTTCCCCTGGATTTTCATGG + Intronic
927922701 2:26985745-26985767 AGGTTTATCCTGGATTATCTGGG + Intronic
930013731 2:46956858-46956880 CAGTTTGCCCAGGATCAGCATGG - Exonic
938913931 2:135915367-135915389 ACTTGTGCCCAGGAGTATCAAGG - Intronic
941466016 2:165828272-165828294 TGGTTTGCCCAGGAGTCTCCTGG - Intergenic
943666045 2:190609525-190609547 AGTTTTGCCTAGGCTTTTCATGG - Intergenic
946517858 2:220432793-220432815 ATTTTTGCCCATGATTCTCATGG + Intergenic
947805010 2:232960452-232960474 AGGTATGGCCAGGGTAATCACGG - Intronic
1170480736 20:16762439-16762461 AGGTTTGTTCAGGCTTATCCTGG + Intronic
1173192020 20:40883993-40884015 AAGGTTGCCCAGGACTGTCAAGG - Intergenic
1173617273 20:44411335-44411357 ATGTTTGCTCAGTATTAGCAGGG - Intronic
1174148218 20:48467460-48467482 AGGTTTGCCCAGAACTCTCTTGG + Intergenic
1180458066 22:15530425-15530447 AGGTTTGCAAAATATTATCAAGG - Intergenic
1184382330 22:44152747-44152769 TGATTTTCCCAGGATTAGCAGGG + Intronic
950683141 3:14598948-14598970 AGGATGGCCTAGGATGATCAGGG - Intergenic
952643983 3:35633975-35633997 AGGTTTGCCCATGGTTCCCAGGG + Intergenic
953719819 3:45345626-45345648 AGGTTTGAACAGTATCATCAAGG - Intergenic
957311649 3:78527567-78527589 AGGTATGCACAGGAGTTTCATGG + Intergenic
957329242 3:78738678-78738700 TGGTTTGCCCAGGATGGTCCTGG - Intronic
959984708 3:112559980-112560002 CAGTTTGCACAGGAGTATCAAGG + Intronic
963575599 3:147058277-147058299 AGAATTGCCCAGGATCATGATGG - Intergenic
965396180 3:168162661-168162683 GGGTTTGCCCAGGACTTTCTTGG - Intergenic
966297915 3:178445206-178445228 TGGTTTGCCTAGGATTGTCCCGG + Intronic
968793747 4:2688135-2688157 ATGTCTGCCCAGCATTAGCAAGG + Intronic
969260483 4:6030360-6030382 CGGTTTGCCCAGGACTTTCCTGG + Intronic
973088659 4:46102968-46102990 AGGTTTGCCAAGGAAAATCTTGG + Intronic
975012487 4:69374640-69374662 AGTTTTTCCCAAGATTATGAAGG + Intronic
977371209 4:96139240-96139262 AGGTTTGACTAGGATTATGGAGG - Intergenic
982634476 4:157876078-157876100 AGGATTCCCAAGGATTTTCAAGG + Intergenic
983376623 4:166937282-166937304 AATTTTTCCCAGGATTACCATGG + Intronic
983882275 4:172946887-172946909 TGGTTTGCCCAGGATAAGCAAGG + Intronic
985327434 4:188787375-188787397 AGGTGGGCCCAAGATAATCAGGG - Intergenic
985613567 5:905395-905417 AGGAGTGCCCAGGATCCTCATGG - Intronic
986584538 5:9300704-9300726 AGGATTCACCAGGATTATCCAGG - Intronic
987231407 5:15897389-15897411 AGTTTTGAACAGGATCATCAGGG + Intronic
987737058 5:21859802-21859824 ATGATTGACCTGGATTATCAAGG + Intronic
989147610 5:38264280-38264302 AGGTTTTCCCTGGAGTATCTGGG + Intronic
995121982 5:108545924-108545946 TGGTTTGCCTAGGATTTTCCTGG - Intergenic
999397419 5:151238763-151238785 AGATTTGCCCAGGTTTGTCAAGG - Intronic
1004462585 6:15852214-15852236 AGGTTTGCCTGGGATTTTCCTGG + Intergenic
1022317425 7:29258236-29258258 TGGTTTTCCCAGGATAATCCTGG - Intronic
1022898885 7:34781943-34781965 AGGTATGCACAGAATTATAATGG - Intronic
1023898711 7:44456929-44456951 TGGTTTGTCCAGGATTTTCCTGG + Intronic
1024391160 7:48813934-48813956 AGGTGAACACAGGATTATCAGGG + Intergenic
1025234248 7:57223176-57223198 AGGTTTGCCCAGAACTTTCCCGG - Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1034517916 7:151595562-151595584 ATGTTTTCCCAGTATGATCAAGG + Intronic
1036575337 8:10022633-10022655 AGGTTTGCCCAGGAGTTGCCTGG - Intergenic
1037115026 8:15215544-15215566 AGATTAGCTCAGGATGATCAGGG + Intronic
1037116596 8:15236393-15236415 AGGTTTGCCCTGAAATGTCAAGG - Intronic
1041178722 8:55225938-55225960 AGATTTGGCCAGGATCATGAAGG + Intronic
1042211746 8:66387908-66387930 AAGTTTACCCAAGATTACCATGG - Intergenic
1043736243 8:83748324-83748346 AGGTTAGCACAAAATTATCATGG + Intergenic
1045836808 8:106531978-106532000 AGGTTTACCCAGGCTTATATAGG - Intronic
1046547535 8:115669582-115669604 AGGATTCCCCACGATTTTCACGG + Intronic
1049357687 8:142196796-142196818 AGGTCTCCCCAGGATTCCCAAGG - Intergenic
1057461155 9:95263305-95263327 AGTTTTGTCCAGGAATCTCAAGG + Intronic
1058938222 9:109789060-109789082 AGGTTTGCCCAGGATTGGCTGGG + Intronic
1061376444 9:130227850-130227872 GGGTTTGCCCAGGTCTATCCTGG + Intronic
1186952136 X:14638201-14638223 AGGTTTGCCAAGGATTTTTGGGG + Intronic
1187153255 X:16700948-16700970 TGGTTTGCCCAGGACTAAGAGGG + Intronic
1187909720 X:24100243-24100265 AGGATTGTCCTGGATTATCTGGG - Intergenic
1189537879 X:41955247-41955269 AAGTTTGCCCAGGAGTACCCAGG - Intergenic
1194125257 X:90008616-90008638 AGTTTTGCCCAGGGTGATGAGGG + Intergenic
1196089035 X:111719226-111719248 AGGTTTAGCCAGGATGATCTTGG + Intronic
1196261744 X:113590977-113590999 AGGATTTTCCAGGATCATCATGG + Intergenic
1198391280 X:136177304-136177326 GGGTTTGACCAGGATTCTCATGG + Intronic
1198427596 X:136535601-136535623 AGGTTGGCCCAGAACTACCATGG - Intronic
1200290018 X:154862935-154862957 GGGTTTGCCCAGGACTATGCTGG + Intronic
1201698111 Y:16850373-16850395 AGCTTTGCCCAGGCTTCTCCAGG + Intergenic