ID: 1101737827

View in Genome Browser
Species Human (GRCh38)
Location 12:107476165-107476187
Sequence GGCTGAACAGCCTAGGTAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101737827_1101737834 9 Left 1101737827 12:107476165-107476187 CCGGCTACCTAGGCTGTTCAGCC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1101737834 12:107476197-107476219 CCCCTCCTGATGAGGCTTCCTGG 0: 1
1: 0
2: 1
3: 27
4: 185
1101737827_1101737832 1 Left 1101737827 12:107476165-107476187 CCGGCTACCTAGGCTGTTCAGCC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1101737832 12:107476189-107476211 CTTGTCTGCCCCTCCTGATGAGG 0: 1
1: 0
2: 0
3: 19
4: 134
1101737827_1101737836 10 Left 1101737827 12:107476165-107476187 CCGGCTACCTAGGCTGTTCAGCC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1101737836 12:107476198-107476220 CCCTCCTGATGAGGCTTCCTGGG 0: 1
1: 0
2: 2
3: 23
4: 230
1101737827_1101737838 11 Left 1101737827 12:107476165-107476187 CCGGCTACCTAGGCTGTTCAGCC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1101737838 12:107476199-107476221 CCTCCTGATGAGGCTTCCTGGGG 0: 1
1: 0
2: 3
3: 22
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101737827 Original CRISPR GGCTGAACAGCCTAGGTAGC CGG (reversed) Intronic