ID: 1101737827

View in Genome Browser
Species Human (GRCh38)
Location 12:107476165-107476187
Sequence GGCTGAACAGCCTAGGTAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101737827_1101737834 9 Left 1101737827 12:107476165-107476187 CCGGCTACCTAGGCTGTTCAGCC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1101737834 12:107476197-107476219 CCCCTCCTGATGAGGCTTCCTGG 0: 1
1: 0
2: 1
3: 27
4: 185
1101737827_1101737838 11 Left 1101737827 12:107476165-107476187 CCGGCTACCTAGGCTGTTCAGCC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1101737838 12:107476199-107476221 CCTCCTGATGAGGCTTCCTGGGG 0: 1
1: 0
2: 3
3: 22
4: 295
1101737827_1101737832 1 Left 1101737827 12:107476165-107476187 CCGGCTACCTAGGCTGTTCAGCC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1101737832 12:107476189-107476211 CTTGTCTGCCCCTCCTGATGAGG 0: 1
1: 0
2: 0
3: 19
4: 134
1101737827_1101737836 10 Left 1101737827 12:107476165-107476187 CCGGCTACCTAGGCTGTTCAGCC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1101737836 12:107476198-107476220 CCCTCCTGATGAGGCTTCCTGGG 0: 1
1: 0
2: 2
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101737827 Original CRISPR GGCTGAACAGCCTAGGTAGC CGG (reversed) Intronic
903405047 1:23088969-23088991 GTCTGAACTGCCTGGGAAGCAGG - Exonic
904188577 1:28725337-28725359 GGCTGAGCCTCCTAAGTAGCTGG + Intergenic
910113679 1:83709260-83709282 GGGTGAACAGGCAAGGTGGCAGG + Intergenic
911565815 1:99462141-99462163 GGCTGAAGAGCCTGGGAACCAGG + Intergenic
911601586 1:99853773-99853795 GCCTCAACCTCCTAGGTAGCTGG - Intronic
912435975 1:109661298-109661320 CGCTGCACAGCCTGGGCAGCAGG - Exonic
912437917 1:109674880-109674902 CGCTGCACAGCCTGGGCAGCAGG - Exonic
912440428 1:109693339-109693361 CGCTGCACAGCCTGGGCAGCAGG - Exonic
914047186 1:144102581-144102603 GGCTGACCAGCCTGGCTGGCTGG + Intergenic
919202683 1:194377656-194377678 AGATGAACAGCTTAGGTAACAGG + Intergenic
923617963 1:235553342-235553364 GGCAGAACAGCCTAATTGGCAGG - Intronic
924835671 1:247644650-247644672 AGCTGAAGTGCCTAGGTAGATGG + Intergenic
1064167009 10:12995354-12995376 GCCTCAACATCCTAAGTAGCTGG + Intronic
1069035643 10:63643292-63643314 AGCTGAAAACCCCAGGTAGCTGG + Intergenic
1070104332 10:73417091-73417113 GGCTGAACCTCCCAAGTAGCTGG + Intergenic
1070620210 10:78003811-78003833 GCCTCAACATCCTAAGTAGCTGG - Intronic
1073254462 10:102141854-102141876 GTGGGAACAGCCTTGGTAGCAGG - Exonic
1076721042 10:132393366-132393388 GCCTGGACAGACTAGGGAGCAGG - Intergenic
1078318312 11:10309830-10309852 GGCTGAACAGCCAAGGGTGAAGG + Intronic
1083001482 11:59296319-59296341 GGCTCTACAGCCTAATTAGCAGG + Intergenic
1085405519 11:76259551-76259573 GGCAGAACAGCCCATGGAGCTGG + Intergenic
1089479119 11:118791071-118791093 GGCTGGACAGCCGGGGGAGCCGG - Intronic
1091277320 11:134361381-134361403 GGCTGAACAGCCATGCTGGCAGG - Intronic
1101737827 12:107476165-107476187 GGCTGAACAGCCTAGGTAGCCGG - Intronic
1101738573 12:107482217-107482239 GGAGGAACAGGCTAGATAGCAGG - Intronic
1107472273 13:40702127-40702149 GTCTCAGCATCCTAGGTAGCTGG - Intergenic
1113939481 13:114010870-114010892 GGCTGAACAGGCCAGGCAGATGG - Intronic
1117468891 14:56022215-56022237 GGCTGAACAGCCTAATTATCTGG - Intergenic
1121556670 14:94843255-94843277 AGCTGAACAGCCTAGAGACCTGG + Intergenic
1124094066 15:26632263-26632285 GGCTGAAAAGCCTCAGTAACTGG - Intronic
1132156821 15:99501722-99501744 GGCTGCAGAGCCTTGGTAGTGGG - Intergenic
1133325179 16:4937592-4937614 GGCTGAACTGCCGAGGGCGCCGG + Intronic
1134632831 16:15769199-15769221 GGCTGAGCCTCCTGGGTAGCTGG - Intronic
1140189789 16:72805614-72805636 GGCTGAGCAGTCTAGCTAGTTGG + Intronic
1140769394 16:78189767-78189789 GGCTCAACCTCCTAAGTAGCTGG + Intronic
1143834188 17:9676936-9676958 GCCTAAACAGCCTAGACAGCTGG - Intronic
1144081426 17:11767519-11767541 GGCTGAAGAGACCAGGGAGCTGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148054454 17:44785893-44785915 GCCTGAAGAGCCTAGGCCGCAGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151683950 17:75636094-75636116 GGCTGGGCAGCCTGGGCAGCAGG + Intronic
1152026297 17:77811595-77811617 GGCTGAAGTGCCCAGGAAGCAGG - Intergenic
1155071175 18:22317710-22317732 ACCTCAACATCCTAGGTAGCTGG + Intergenic
1157280364 18:46343051-46343073 GGCTCAACAGCCAAGTTTGCTGG + Intronic
1158830458 18:61271885-61271907 GGCTGAGCAGCATAGATAACTGG + Intergenic
1160692082 19:464805-464827 GGGTGAACAGGATAGGTAGGAGG + Intronic
1161758413 19:6151895-6151917 GGATGAACGCCCTAGTTAGCAGG + Intronic
929093339 2:38241013-38241035 GGCCCAGCAGCCTAAGTAGCTGG + Intergenic
930780096 2:55216170-55216192 GCCTGAACATCCCAAGTAGCTGG - Intronic
933644521 2:84799501-84799523 GGCTGAGAAGCCTAGGCAGCAGG + Intronic
941746388 2:169091303-169091325 TGCTCAACAGCATAGGGAGCAGG + Intronic
943595494 2:189850342-189850364 GGTTTAACAGACTAGGTAGCTGG + Intronic
944803027 2:203254874-203254896 GCCTCAACATCCTAAGTAGCTGG - Intronic
948445625 2:238030754-238030776 GGCTAAGTAGCCTAGGCAGCAGG - Intronic
948894555 2:240922136-240922158 GGCTGGGCTGCCCAGGTAGCTGG + Intronic
1168759422 20:339256-339278 GGCTAAAAAGCCTATGAAGCTGG - Intergenic
1168845062 20:938841-938863 GGCTGCACAGCCTTTGTAGCAGG - Intergenic
1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG + Intronic
1178720875 21:35007890-35007912 GGCTGAAGAGCTTGGGTACCAGG - Intronic
1180105872 21:45617691-45617713 GGCTGAGCAGCAGAGGGAGCTGG - Intergenic
1182721956 22:32410214-32410236 GCCTCAACAGTCTAGGGAGCTGG + Intronic
949607622 3:5671768-5671790 GGGTGAGCAGTCTAGGTAGCTGG + Intergenic
953101543 3:39833912-39833934 GCCTCAGCATCCTAGGTAGCTGG - Intronic
954060923 3:48066606-48066628 GCCTGAACCTCCTAAGTAGCTGG + Intronic
961438367 3:126935129-126935151 GGCTGAGCATCCCAGGTGGCCGG - Intronic
976324283 4:83752862-83752884 AGCTGAAGAGCCAAGGAAGCTGG - Intergenic
977594116 4:98859394-98859416 GCCTCAACAGCCTGAGTAGCTGG - Intergenic
981034562 4:140156168-140156190 GGCTGAGCCTCCTGGGTAGCTGG + Intergenic
989395998 5:40957568-40957590 GCCTCAACATCCTAAGTAGCTGG + Intronic
995823025 5:116259576-116259598 GGCTGAACAGTCTTGGTGGCTGG + Intronic
996258820 5:121440330-121440352 GCCTCAACCTCCTAGGTAGCTGG - Intergenic
1005669760 6:28093331-28093353 TGCTGTTCAGCCTGGGTAGCTGG - Intergenic
1006368923 6:33632691-33632713 GTCTGAACAGCAGAGGGAGCAGG - Intronic
1007779262 6:44243217-44243239 GCCTGAGCATCCCAGGTAGCTGG - Intergenic
1008701681 6:54107890-54107912 GTCTGAATAGCCTTGGCAGCTGG + Intronic
1012159019 6:95859578-95859600 GGCTGTACAGCTCAGGTAGAGGG + Intergenic
1018609177 6:165630231-165630253 GCCTGAACCTCCTGGGTAGCTGG - Intronic
1019296247 7:276833-276855 GGCTGCACACCCCAGGTAGCTGG - Intergenic
1019495831 7:1340217-1340239 GGCAGAATAGCCCAGGCAGCTGG - Intergenic
1022267543 7:28772068-28772090 GGCTGGGCAGCCAAGGTAGGTGG - Intronic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG + Intronic
1032414956 7:131728773-131728795 GGCTGAGCAACCTAGGCAGAGGG + Intergenic
1032462852 7:132124773-132124795 GGCTGAAAATCCTGGGTTGCGGG - Exonic
1036699377 8:11001889-11001911 GGCTGAACAGCAGAGGGACCAGG - Intronic
1037499189 8:19469274-19469296 GCCTGCACCGCCTAAGTAGCTGG - Intronic
1037948353 8:23003486-23003508 GGCTGAAGATCCCAGGCAGCTGG - Intronic
1039449341 8:37659099-37659121 GGCTGAACCTCCTGAGTAGCTGG - Intergenic
1041022013 8:53647779-53647801 GTCTCAACCTCCTAGGTAGCTGG + Intergenic
1041331626 8:56732429-56732451 GACTGATTAGCATAGGTAGCTGG - Intergenic
1051505630 9:17824663-17824685 GGATGAACAGCCCAGGGAGAAGG + Intergenic
1052970646 9:34375343-34375365 GGCTGACAAGCTTAGGCAGCTGG - Intronic
1056453269 9:86737020-86737042 GGCTGAAAGGCCTTGGTTGCTGG + Intergenic
1060093259 9:120763740-120763762 GGCTGTACAGACAAGGAAGCTGG + Exonic
1061221187 9:129253232-129253254 GGCTCAGCAGCCCAGGCAGCTGG + Intergenic
1198806396 X:140499517-140499539 AGCTGAACAGCCTGGGCTGCGGG - Intergenic
1198912800 X:141633488-141633510 GACTGAAGTGCCTAGGAAGCAGG - Intronic