ID: 1101738439

View in Genome Browser
Species Human (GRCh38)
Location 12:107481398-107481420
Sequence CCTGGTGCTCAGAGGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 276}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101738439_1101738450 15 Left 1101738439 12:107481398-107481420 CCTGGTTCCCTCTGAGCACCAGG 0: 1
1: 0
2: 2
3: 36
4: 276
Right 1101738450 12:107481436-107481458 CTTATCTGGAATTTAGGACTTGG 0: 1
1: 0
2: 0
3: 18
4: 123
1101738439_1101738452 23 Left 1101738439 12:107481398-107481420 CCTGGTTCCCTCTGAGCACCAGG 0: 1
1: 0
2: 2
3: 36
4: 276
Right 1101738452 12:107481444-107481466 GAATTTAGGACTTGGGTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 94
1101738439_1101738444 1 Left 1101738439 12:107481398-107481420 CCTGGTTCCCTCTGAGCACCAGG 0: 1
1: 0
2: 2
3: 36
4: 276
Right 1101738444 12:107481422-107481444 TGCATCTCCCCCTGCTTATCTGG 0: 1
1: 0
2: 1
3: 7
4: 141
1101738439_1101738453 29 Left 1101738439 12:107481398-107481420 CCTGGTTCCCTCTGAGCACCAGG 0: 1
1: 0
2: 2
3: 36
4: 276
Right 1101738453 12:107481450-107481472 AGGACTTGGGTCACTGGTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 127
1101738439_1101738451 16 Left 1101738439 12:107481398-107481420 CCTGGTTCCCTCTGAGCACCAGG 0: 1
1: 0
2: 2
3: 36
4: 276
Right 1101738451 12:107481437-107481459 TTATCTGGAATTTAGGACTTGGG 0: 1
1: 0
2: 2
3: 21
4: 183
1101738439_1101738447 9 Left 1101738439 12:107481398-107481420 CCTGGTTCCCTCTGAGCACCAGG 0: 1
1: 0
2: 2
3: 36
4: 276
Right 1101738447 12:107481430-107481452 CCCCTGCTTATCTGGAATTTAGG 0: 1
1: 0
2: 1
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101738439 Original CRISPR CCTGGTGCTCAGAGGGAACC AGG (reversed) Intronic
900605307 1:3521168-3521190 CGGGCTGCTCAGCGGGAACCTGG - Intronic
901215975 1:7555630-7555652 CCTGGAGCTCCGTGGGAGCCAGG - Intronic
902961876 1:19969246-19969268 CCTGGGGCTAAAAGTGAACCAGG + Intergenic
903261965 1:22136379-22136401 CCTGCTGGGCTGAGGGAACCTGG + Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903696098 1:25207995-25208017 CCTGGTGACCACAGGCAACCAGG + Intergenic
904351935 1:29914019-29914041 CCAGGTGCACACAGGAAACCTGG + Intergenic
904489148 1:30847590-30847612 CCTGTTTCCCAGAGGGAATCCGG + Intergenic
904761389 1:32807024-32807046 CCTCCTGCTCAGAGGGAGTCTGG + Intronic
905031010 1:34884738-34884760 CCAGGTGCTCAGAGGCAGACGGG - Intronic
905939576 1:41852474-41852496 CCTGGTCATAAGAGGGAAGCTGG - Intronic
907371893 1:54009170-54009192 CCTGGTGCACAGAGCGTTCCAGG - Intronic
907559934 1:55379023-55379045 CCCAGTGGTCAGAGGGTACCAGG - Intergenic
911858517 1:102914359-102914381 CCTGGTCCTCCTGGGGAACCTGG - Exonic
913331672 1:117672802-117672824 CCTGCTTCTCAGAGGGTACAAGG - Intergenic
917798359 1:178548320-178548342 CCTGGTGGGCAGAGGTTACCTGG + Intronic
920416280 1:205800985-205801007 GCTGGGGCTCAAAGGGAACCTGG - Exonic
922606857 1:226894917-226894939 CCAGGTGAGCACAGGGAACCAGG - Intronic
922772907 1:228197985-228198007 CCTGGTGGTCACATGGAACACGG - Intergenic
923512032 1:234661224-234661246 CCTGGTGCTCAGAACAATCCAGG - Intergenic
924021889 1:239792106-239792128 CAAGGTGCTCAGAGAGAGCCTGG - Intronic
1062863075 10:825260-825282 CCTAGTGCAGAGAGGGGACCTGG - Exonic
1063346154 10:5313940-5313962 ACTGGTGGTCAGAGGGTTCCTGG + Intergenic
1064313566 10:14234424-14234446 CCTGGATCTCAGAGGGATCCCGG + Intronic
1064973552 10:21090089-21090111 CCTGGAGCTCACAGTGCACCTGG - Intronic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1072615379 10:97046175-97046197 TCTGGAGCTCAGTGGGATCCTGG - Intronic
1072679868 10:97498875-97498897 CCTGGTGCCCCGAGCGAGCCGGG + Exonic
1073143024 10:101261380-101261402 CCCGGGGCTCAGAGGGGGCCAGG + Intergenic
1074523279 10:114243870-114243892 GCTGGTGCTGCGTGGGAACCAGG + Intronic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1077537093 11:3129610-3129632 CCTGGTGCTCAGCGGCCACCTGG - Intronic
1077550771 11:3199282-3199304 CCTGCTGCTCAGAGGACACAGGG + Intergenic
1077673877 11:4181005-4181027 CCTGGTGCAGGGAGGCAACCTGG - Intergenic
1078962407 11:16292810-16292832 ACTGGTACAGAGAGGGAACCCGG + Intronic
1079009455 11:16816339-16816361 TCTGGGGCTCAGAGGGGACATGG - Intronic
1081525568 11:43925323-43925345 CCTGGTGACAAGAGGGAACATGG + Exonic
1083335160 11:61917694-61917716 CACGGCGCTCGGAGGGAACCCGG + Intronic
1083441343 11:62678712-62678734 TCTGGCCCTCACAGGGAACCAGG - Exonic
1083633583 11:64108447-64108469 CCTGGTGCTCAGGGAGACCCAGG - Intronic
1085796278 11:79542935-79542957 GCAGGTCCTCAGAGGGACCCAGG - Intergenic
1086087340 11:82968804-82968826 CCTGATGCTCCTAGAGAACCAGG + Intronic
1086154376 11:83649339-83649361 CCTGGTGCTCAAAGGGAGAAAGG + Intronic
1086380598 11:86248511-86248533 ACTTTTACTCAGAGGGAACCAGG + Intronic
1086561484 11:88174759-88174781 GCTGGTTCACAGAGGAAACCGGG - Intronic
1091302822 11:134518435-134518457 CCTGCTGCCCTGAGGGAACAGGG - Intergenic
1091972109 12:4796376-4796398 CCTGATTCTCAGAGGGGACGCGG - Intronic
1092106172 12:5922949-5922971 CCTTGTGGTCAGTGTGAACCTGG - Intronic
1095103528 12:38205560-38205582 CCTGTTCCCCAGATGGAACCAGG - Intergenic
1096486415 12:51984808-51984830 CCTAGTTCTCAGAAGGAAACAGG - Intronic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1098342938 12:69470501-69470523 CCAGGTGCTGAGAGGGAGCAGGG - Exonic
1100924655 12:99531016-99531038 CCTGCTACTCAGAGGGAATAAGG - Intronic
1101738439 12:107481398-107481420 CCTGGTGCTCAGAGGGAACCAGG - Intronic
1102019249 12:109670337-109670359 ACTGGAGATCAGATGGAACCGGG - Intergenic
1102108688 12:110347908-110347930 CCCGGTGCTCACAGGGCATCAGG - Intronic
1102925420 12:116822271-116822293 CTTGGTTCCCAGAGGGAAGCAGG + Intronic
1104388315 12:128370254-128370276 ACTGTTGCTCAGAGGAAACCAGG - Intronic
1107565905 13:41604144-41604166 CCTGAAGCTCAGAGCCAACCTGG + Intronic
1110709689 13:78636610-78636632 CCTAGAGCCCAGAGGGAACCTGG - Intronic
1113861754 13:113491263-113491285 CCTGGTGCTCACCGGGACGCAGG - Exonic
1114066431 14:19062704-19062726 CCTGAGGCTCGGAGGGACCCAGG - Intergenic
1114076929 14:19166214-19166236 CCTGGTTCCCATATGGAACCTGG - Intergenic
1114095837 14:19337320-19337342 CCTGAGGCTCGGAGGGACCCAGG + Intergenic
1114282654 14:21207910-21207932 CCTCTTTTTCAGAGGGAACCGGG - Intergenic
1116167178 14:41349468-41349490 CCTTGTGCTCTGAGGGGCCCAGG + Intergenic
1116196029 14:41726245-41726267 CTTGTTGTTCAGAGGGATCCAGG + Intronic
1118603711 14:67488222-67488244 CCTGGTGGTCAGAGGGGAGTGGG - Intronic
1119020466 14:71107083-71107105 CCTGGTGTGCAGAAGGAATCAGG + Intronic
1119048013 14:71338049-71338071 GCTGGTGCCCAGAGGGAAAAGGG - Intronic
1120022597 14:79547630-79547652 GCTGGTGCTCAGAGGGAATAGGG + Intronic
1120143013 14:80949502-80949524 TCTGTTGCTCACAGGGGACCAGG + Intronic
1121729148 14:96174237-96174259 CCTGGGGCTCAGAGGAGTCCAGG + Intergenic
1122745597 14:103895561-103895583 CCCTGTGCTCACAGGGAACGAGG + Intergenic
1122767740 14:104083402-104083424 CATGGTGCTCACAGGGATGCAGG + Intergenic
1122817235 14:104319743-104319765 CCTGGGGCTGAAAGGGAACAGGG + Intergenic
1123450583 15:20357142-20357164 GCTGGTCCTAAGAGGGAACGGGG + Intergenic
1124801230 15:32834818-32834840 CAAGGTGATCAGAGGGAACTAGG - Intronic
1126372728 15:47964303-47964325 CCTGAAGCTCAGGGGGAGCCAGG + Intergenic
1127795642 15:62436209-62436231 CCTGGAACTCAGAGGGAACGTGG - Intronic
1127903552 15:63359146-63359168 TCTGGAGCTCAGAGGAAAACTGG - Intronic
1128135615 15:65261109-65261131 CCTGGTGCTGAGGGGGAAGAAGG + Intronic
1129108011 15:73322527-73322549 GCTGGACCCCAGAGGGAACCTGG - Exonic
1129169491 15:73799006-73799028 GTTGGTGCTCAGAGGGGACGAGG + Intergenic
1129329955 15:74821947-74821969 GCTGGTGCTCTGGGAGAACCAGG + Intronic
1129450811 15:75650188-75650210 CCTGGTGCTCGGTGGGGATCTGG - Exonic
1130448332 15:84025407-84025429 CCATGTGTTCAGTGGGAACCAGG + Exonic
1131353591 15:91723911-91723933 CCTGGAGCTCGGAGGGCAGCAGG + Intergenic
1132114351 15:99124858-99124880 CCTGGTGCTCAGTGTCAGCCAGG + Intronic
1132468140 16:87057-87079 CCTGGTGGTCAGCGGGACCGTGG - Intronic
1132789944 16:1680134-1680156 ACTAGTGCTCAGAGCGAATCCGG + Intronic
1132793447 16:1706540-1706562 CTCGGTGCTCAGCGAGAACCAGG + Exonic
1132947032 16:2537667-2537689 ACTGAGGCTCAGAGGGGACCAGG - Intergenic
1132968656 16:2673725-2673747 ACTGAGGCTCAGAGGGGACCTGG + Intergenic
1134058009 16:11182333-11182355 CCTGGGGATGGGAGGGAACCTGG - Intergenic
1134543452 16:15088889-15088911 CCATGTGCTTAGAGAGAACCAGG + Intronic
1135361033 16:21815046-21815068 CCATGTGCTTAGAGAGAACCAGG + Intergenic
1136261497 16:29080350-29080372 CCATGTGCTTAGAGAGAACCAGG - Intergenic
1136292741 16:29285592-29285614 CCTGGGGCTCATAGGGATTCTGG - Intergenic
1136872995 16:33825034-33825056 CCTGGTGCTCAGGGAGGTCCGGG + Intergenic
1137290295 16:47047955-47047977 CCCTGAGCTCAGAGGGCACCAGG - Intergenic
1137528648 16:49261670-49261692 CCTGGTGCTGTCAGGGAAGCTGG + Intergenic
1137576775 16:49605135-49605157 CCTGGAGCTCGGTGGGAACCTGG - Intronic
1137624686 16:49900192-49900214 CCAGGGGCCCAGAGGGCACCTGG - Intergenic
1137642023 16:50040492-50040514 ACGGGTGCTCAGAGGGAGCTGGG - Intergenic
1141309568 16:82900191-82900213 CCTGGTGGACAGAAAGAACCAGG + Intronic
1141329146 16:83092496-83092518 CCTGGTGCTCAAAAGGAACTAGG - Intronic
1142005300 16:87686946-87686968 CGAGGTGCTCAGAGTGAGCCAGG - Intronic
1142098628 16:88259596-88259618 CCTGGGGCTCATAGGGATTCTGG - Intergenic
1142146312 16:88494343-88494365 CCTGGTGCTGAGAGGGTAACGGG - Intronic
1203099177 16_KI270728v1_random:1291021-1291043 CCTGGTGCTCAGGGAGGTCCGGG - Intergenic
1142535786 17:616908-616930 CCTGGTCCTCAGATGCAACAGGG + Intronic
1142610501 17:1107174-1107196 CCCGGTGCTCACGGGGACCCAGG + Intronic
1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG + Exonic
1144854443 17:18260310-18260332 CCTGGTCCCCAGAAGGAACGGGG + Intergenic
1145868384 17:28255264-28255286 CCTGCTGCTCTCTGGGAACCTGG - Intergenic
1146208961 17:30927024-30927046 CCTGGTGCGCAGGTGGATCCAGG + Intronic
1146548642 17:33761439-33761461 CCTGGTGCTCAGTCAGAGCCTGG - Intronic
1147261792 17:39213204-39213226 ATTGGTGCTGAGTGGGAACCGGG - Intronic
1147535924 17:41323406-41323428 CCTGCAACTCAGAGGGAGCCAGG - Intergenic
1147636116 17:41965512-41965534 GCTGGTGTTCAGAGGGATCATGG + Exonic
1147879283 17:43643487-43643509 CCTGGCGCTCAGAGAGGTCCAGG + Exonic
1148322284 17:46764724-46764746 CCTGGTGCTCAGAGGTGATGAGG + Intronic
1148794373 17:50190071-50190093 CCTGGTGCTAAAGGCGAACCTGG - Exonic
1150631816 17:66885298-66885320 CCTGGGGCTCAGGGGTCACCTGG - Exonic
1151351332 17:73533762-73533784 CCTGCTGGTGACAGGGAACCTGG - Intronic
1151355475 17:73555531-73555553 CCTGGGCCTCAGAGGGGACTTGG + Intronic
1152337855 17:79708192-79708214 GCTGGTCCTAAGAGGGAACGGGG - Intergenic
1152626627 17:81390645-81390667 CCTGGTGCCTGGAGGGAACAGGG - Intergenic
1155162736 18:23208782-23208804 CCTGGGGCTCAGAGGGAACATGG - Intronic
1156941948 18:42778607-42778629 CCTGGTGCTGTCAGGGGACCTGG - Intronic
1157099586 18:44717094-44717116 CCTGGGTCTCAGAGGCAGCCAGG + Intronic
1159549843 18:69883490-69883512 CTTGGTGCTCAGAGGACACCAGG + Intronic
1160518361 18:79490536-79490558 CCAGGTGCTCAGGAGGAACCTGG - Intronic
1160584344 18:79904275-79904297 CCTGGGGCTCAGGGGCACCCAGG + Intronic
1160965155 19:1744201-1744223 GCTGGTGCCCACAGGGAAACTGG + Intergenic
1161569116 19:5020584-5020606 CTTGGTGCCCAGAGGAAGCCAGG + Intronic
1161745603 19:6057866-6057888 CCTGGCCCTCAGAGGGGAGCCGG - Intronic
1162103586 19:8355718-8355740 GCTGGTGCTCAGAAGGGAACGGG - Intronic
1163233667 19:16019395-16019417 CTTGGTGCTGAGAGGGAGCCTGG + Intergenic
1163651714 19:18521725-18521747 CCTAGTGCTGAGAAGGAACGCGG + Intronic
1164456410 19:28411306-28411328 CCTGGCACTGAGTGGGAACCTGG - Intergenic
1164698208 19:30262659-30262681 CCAGGTGGTCAGAGGGACCTGGG + Intronic
1164907238 19:31977430-31977452 AGTGGTGGTCAGAGGGGACCAGG - Intergenic
1165760287 19:38317087-38317109 TTTGGTGGACAGAGGGAACCAGG - Intronic
1166984670 19:46652693-46652715 CCCGGGGCTCAGAGGGACCCAGG + Exonic
1167010236 19:46802347-46802369 CCTGGGGGTCTGAGGGAACAGGG + Intergenic
1167528899 19:50002543-50002565 CCCGGTACTCAGAGGCAAGCAGG + Intronic
925406703 2:3610386-3610408 CCTGGTGCTCTGGGGGACCGAGG + Intronic
926238192 2:11065699-11065721 GCAGGTGCTCAGAGGGTAACTGG + Intergenic
926259125 2:11240599-11240621 CCTGGGGCTCAGAGGGTAATAGG + Intronic
927932754 2:27055805-27055827 GCTGGTGCTCAGAGGAACTCTGG - Exonic
928181683 2:29072575-29072597 CCTGGTGCCCACAGGGCACAGGG + Exonic
929526145 2:42704751-42704773 ACTGGTGCACTGAGGGAACATGG - Intronic
929593650 2:43162419-43162441 CCTGGGGCTCAGAGGGGAGCTGG - Intergenic
932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG + Intronic
932413875 2:71562374-71562396 CCTGGGGTTCAGAGGCATCCAGG - Intronic
938066848 2:128286010-128286032 CCTGGGGCTCAGAGGGGCCAGGG - Intronic
938207960 2:129439808-129439830 CTTGGTGCTGAGAGTGAGCCTGG + Intergenic
938483824 2:131682837-131682859 CCTGGGGCTCCGAGGGACCCAGG - Intergenic
938578955 2:132628933-132628955 CCAAGTGCTCAGAGTGACCCAGG + Intronic
939334030 2:140802028-140802050 CCTTAAGCTCAGAGGGAACTGGG - Intronic
944678157 2:202051806-202051828 CCTGCTGCTAAGAGGCAACATGG + Intergenic
947768457 2:232652454-232652476 CCTGGGGATCAGAATGAACCCGG - Intronic
948355447 2:237373773-237373795 CCTGGTGCTGAGAAGGAAGGAGG - Intronic
948719610 2:239890591-239890613 CCTGGTGCTCACAAGCAAACAGG + Intergenic
948939085 2:241187352-241187374 GCTGGTGCTGACAGGGAACCCGG + Intergenic
949034155 2:241808911-241808933 CCTGATGCTCAGAGGGTAACTGG - Intronic
1168861733 20:1050542-1050564 GCTGGTGCCCACATGGAACCTGG - Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169244988 20:4018120-4018142 CCTAGTGCTGAGAGGGAAGTGGG - Intergenic
1169816023 20:9657265-9657287 CCTCGTGCTGAGAGGGAAACAGG - Intronic
1171479705 20:25444747-25444769 GCTCTTGCTCTGAGGGAACCAGG - Intronic
1174671356 20:52310796-52310818 ACTTGTGCTCAGAAGGACCCCGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175787850 20:61723346-61723368 CACGGTGCTCAGAGGGCCCCGGG - Intronic
1175863241 20:62161262-62161284 CCTGGTGCTCTGCGGTCACCTGG + Intronic
1175872285 20:62214210-62214232 CCAGGTGCTCAGAGGCCACTTGG - Intergenic
1175905476 20:62377553-62377575 CCTGGAGCTCAGATGGTTCCTGG + Intergenic
1176143306 20:63554357-63554379 CCTGGTGGTCTCAGGGAAGCGGG + Exonic
1179563349 21:42231143-42231165 CCTGGTGAGAAGAGGGAAGCTGG - Intronic
1179961668 21:44770903-44770925 CATGGGGCCCACAGGGAACCAGG + Exonic
1180054590 21:45351311-45351333 CCTGGGGCTCCGCGGGGACCAGG + Intergenic
1180054619 21:45351382-45351404 CCTGGGGCTCAGCGGGGACCAGG + Intergenic
1180147373 21:45928909-45928931 CCTGGGGCTCAGGAGGACCCTGG - Intronic
1180230155 21:46422232-46422254 GCAGGTGCTCAGAGGCACCCAGG - Intronic
1180484909 22:15785295-15785317 CCTGAGGCTCGGAGGGACCCAGG - Intergenic
1181494983 22:23282665-23282687 CCTTGTGCTCTCAGGGAGCCAGG - Intronic
1182709718 22:32312915-32312937 CCATGTGTTCAGAGGAAACCTGG - Intergenic
1182972118 22:34588909-34588931 CCTGGGGCTCAGCGGGGAGCAGG + Intergenic
1184153375 22:42651070-42651092 CCTGGTGCTCTGAGGGGATGGGG + Intergenic
1184586338 22:45450530-45450552 GCTGGTGCTCACAGGGACTCAGG + Intergenic
1184641240 22:45871558-45871580 CCTGGTGCTCACACGGGCCCAGG + Intergenic
1185400133 22:50611303-50611325 CATGGAGCTCAGGGGGAAGCAGG + Exonic
952857425 3:37783882-37783904 CCTGGGGCACACAGGGACCCTGG - Intronic
954285572 3:49616700-49616722 CCTGGTGCACAGTGGGAAGGAGG - Intronic
958573109 3:95912352-95912374 CCCAGTGCTCAGAGGCAGCCCGG + Intergenic
959093836 3:101932508-101932530 CCTGGTGCCCAGACGCCACCTGG - Intergenic
959130944 3:102355363-102355385 CCTGGTTATCAGAGGGAAACAGG + Intronic
960818087 3:121694503-121694525 CAAGGTGCTCAGAAAGAACCCGG - Exonic
961378478 3:126482335-126482357 CCTGCAGCTCTGAGGGAGCCAGG - Exonic
961871621 3:129992722-129992744 CCTGGAGGTCACAGGGACCCAGG - Intergenic
962326027 3:134433011-134433033 CCTGGAGCCCTCAGGGAACCGGG + Intergenic
962743188 3:138378153-138378175 CCTGGTTCTCTGAAGGACCCTGG - Intronic
966757457 3:183384762-183384784 CCTGCTGCCCAGACAGAACCAGG - Intronic
967037250 3:185657206-185657228 CCTGGGACTGAGAGGGAACAAGG + Intronic
967464887 3:189793145-189793167 CCTCGAGCCCAGAGGGAACTAGG + Intronic
968547875 4:1207885-1207907 GCTGGTGCTCAGAGGGGCCGGGG + Intronic
968618150 4:1591627-1591649 CCATGTGCTCAGAAGGAACCAGG - Intergenic
968787412 4:2632922-2632944 CCTGGTGCCCAGAGAGACTCTGG + Intronic
968890161 4:3364595-3364617 CCCGACGCTCAGAGGGAGCCAGG + Intronic
969408046 4:7007908-7007930 CCAGGCTCTCAGAGGGATCCAGG + Intronic
969860714 4:10033541-10033563 CCAGATGCTCAGAGGAAGCCAGG - Intronic
970329613 4:14966071-14966093 CCTGGTGCTATGAGGAGACCAGG + Intergenic
970419430 4:15891505-15891527 ACAGGGGCTCAGAGGGACCCAGG - Intergenic
974474280 4:62360008-62360030 CCTTGTGCTCAGAGTGAATTTGG - Intergenic
977932098 4:102760651-102760673 TCTGGTGCTGAGAGGGGCCCAGG - Intronic
978253044 4:106656406-106656428 CCTTGAACTCAGAGGCAACCTGG + Intergenic
980084899 4:128380719-128380741 GCTGGTCCTGAGAGGGCACCAGG + Intergenic
981637577 4:146898350-146898372 CCAGGAGCTCAGAAGGCACCAGG - Intronic
985536863 5:469943-469965 CCTGCTGCTAAGTGGGAAGCTGG - Intronic
985563016 5:601424-601446 CCTGGTGCACAGGTGGAGCCCGG - Intergenic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
986115609 5:4770889-4770911 CAAGGTGCTCAATGGGAACCTGG - Intergenic
986728842 5:10619953-10619975 GCTGGGGCTGAGAGGGAGCCGGG + Intronic
988996643 5:36721676-36721698 TCTGGTGCTCAGAGGAAAAGGGG - Intergenic
990504973 5:56434988-56435010 CCTGGTTTTCAGAGAGAACAAGG - Intergenic
992105836 5:73448409-73448431 GCTGGGGCGCAGAGGGAGCCCGG - Intergenic
994658766 5:102627777-102627799 CATGGGGCTCAGATGGAACCTGG - Intergenic
998334855 5:141362169-141362191 CCTGGGGGTCAGAGGGCTCCCGG - Exonic
998339062 5:141400149-141400171 CCTGGGGGTCAGAGGGTACAGGG - Exonic
998922417 5:147084334-147084356 CCTGGTGGTAAAAGGGAATCTGG - Intronic
998950790 5:147391401-147391423 CGTGGCCCTCAGAGAGAACCGGG + Exonic
999141896 5:149367880-149367902 CCTGGTGCTCAGGGTGCAGCAGG - Intronic
1000830310 5:166093915-166093937 GCTGGGGCTCAAAGGGACCCAGG - Intergenic
1002107943 5:176889372-176889394 CCTGGTGCTCAGAGGTGACCTGG - Exonic
1003175989 6:3752253-3752275 CCTGAGGCACGGAGGGAACCCGG - Intergenic
1003198767 6:3939609-3939631 CCTGCTGCTCTGAGGGCATCGGG + Intergenic
1003352017 6:5326692-5326714 CCTGCTGCTCTGAGGGCATCAGG - Intronic
1003635498 6:7828206-7828228 GCTGTTGCTCAGAAGGGACCAGG + Intronic
1005908935 6:30290835-30290857 TCTGGACCTCAGAGGGAACAAGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006385341 6:33727630-33727652 TGTGGTGCTCAGAGGGTCCCTGG - Intronic
1006940066 6:37746041-37746063 CATGGTGGATAGAGGGAACCTGG + Intergenic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1009718729 6:67435679-67435701 CCTGTTGCCCAGAAGGAAACAGG + Intergenic
1011071816 6:83393221-83393243 CCTGGTGCTCAGAGTAGCCCAGG - Intronic
1013818245 6:114124290-114124312 CCTGGACCTCAGAGGGAATATGG + Intronic
1016199832 6:141394396-141394418 CCTGGGGCTCAGAGGCACCCCGG - Intergenic
1017778098 6:157695296-157695318 CCTGGAGCTCTGAGGATACCAGG + Intergenic
1018714444 6:166521070-166521092 GCTGGGGCTCACAGGGCACCAGG - Intronic
1018936261 6:168275878-168275900 CCTGGCTCTCAGAGGGAGTCTGG - Intergenic
1019142352 6:169956859-169956881 CCAGGTGCCCAGCGGGACCCCGG + Intergenic
1019614558 7:1953241-1953263 GCTTCTGCTCACAGGGAACCCGG + Intronic
1019807639 7:3139985-3140007 CCTGCTGCTCTGACGGAGCCTGG + Intergenic
1022478903 7:30730162-30730184 CCTGGTGCACAGAGCCCACCTGG + Intronic
1024047718 7:45596473-45596495 CCTGGTCCTAAGAGGGGATCTGG + Intronic
1024085486 7:45888789-45888811 CCTCGTGCTCGGAGGTCACCCGG + Exonic
1024194650 7:47047227-47047249 CCTGGTGCTGAGCGTGAAGCAGG - Intergenic
1024557524 7:50616134-50616156 CCAGGTCCTCAGAGTGAACCTGG - Intronic
1026639545 7:72112084-72112106 CCTGATTCTCAGAGGGCACTAGG - Intronic
1028234260 7:88341518-88341540 CCGGGTGCTCAGAGTTAACATGG - Intergenic
1028698702 7:93750017-93750039 CATGGTACTCTGTGGGAACCAGG - Intronic
1029475100 7:100778657-100778679 TCTGGTGTTCACAGGGAAGCTGG - Intronic
1033449466 7:141449655-141449677 TCTGGTACCCAGAGGGAGCCAGG - Intronic
1034345262 7:150381906-150381928 CCTTGTGCTGAGTGGGATCCGGG + Intronic
1034876561 7:154729793-154729815 CCTGGGGCTCAGAAGGAAACTGG - Intronic
1035078185 7:156194913-156194935 CCTGGTAATCAGATGGGACCTGG - Intergenic
1035476911 7:159150091-159150113 CCTGGAGTTCAGAGAGAAGCAGG + Intergenic
1037804419 8:22051067-22051089 CCAGGCGCTCAGAGGCAAGCAGG - Intronic
1038437104 8:27543880-27543902 ACGGGTGCTCAGAGGGAAGACGG + Intronic
1039305047 8:36252198-36252220 CATGCTGCTCAGAGGGATTCTGG - Intergenic
1039953334 8:42188991-42189013 CCCTGTGCTCAGAAGCAACCGGG - Exonic
1040087143 8:43355923-43355945 CCTGTTGCTCACAGTGTACCAGG - Intergenic
1040536797 8:48317479-48317501 CCTGGTGCTGAGAACAAACCCGG - Intergenic
1040939645 8:52819107-52819129 CCTGCTGCTCAGGTGGTACCTGG + Intergenic
1041177202 8:55209059-55209081 CCTGTGGCTCATAGGCAACCAGG + Intronic
1041200992 8:55451916-55451938 CCTGGTCCTCAGAGGGCGGCTGG + Intronic
1041774571 8:61509844-61509866 CCTGGAGCTGGGAGGGACCCTGG - Intronic
1042225457 8:66511497-66511519 CCTGGTACTTAGGGGAAACCAGG + Intronic
1044844300 8:96365163-96365185 CTTCGTGCTCAGAAGGAACTTGG + Intergenic
1045214543 8:100134252-100134274 CCTGGTTCTCAGAGAGAGCAAGG - Exonic
1049333726 8:142070533-142070555 CTTCGTGCTCAGGGGGAAACTGG + Intergenic
1049575515 8:143388072-143388094 CCTGGTCCTCAGGGAGCACCGGG - Intergenic
1049696798 8:143987993-143988015 CCTGATGCTCAGAGGGCTCCAGG + Intronic
1049807167 8:144546298-144546320 CCTGCTGCTCTGAGAGAACCTGG + Intronic
1051392679 9:16582624-16582646 CCTGGACCTCAGAGGGAAGCTGG - Intronic
1052789806 9:32864799-32864821 ACTGGTGCCCAGAGGAGACCTGG - Intergenic
1053429428 9:38032408-38032430 CCTGTTGCCCAGAAGGAGCCTGG - Intronic
1053735340 9:41097954-41097976 CCTGTTGCTCACAGGTAAGCAGG + Intergenic
1055666888 9:78561961-78561983 CCTGGTGGTCCAAGGGAACAGGG - Intergenic
1058654971 9:107211956-107211978 CATGGTGCTCAGTGGTAAACGGG - Intergenic
1060189374 9:121582362-121582384 GCTGAGTCTCAGAGGGAACCAGG + Intronic
1060515509 9:124263313-124263335 CCTGAGGCTCAGAGGGAGCAAGG + Intronic
1060915258 9:127385079-127385101 CCTGGTGGTGAACGGGAACCTGG + Exonic
1061118476 9:128628994-128629016 CCTGGTGCCCGGCGGGTACCTGG - Intronic
1061125922 9:128675690-128675712 TCTGGTTCCCAGAGGGAGCCTGG + Intergenic
1061391041 9:130317120-130317142 CCAGGTGCTGAGGGGGAAGCAGG + Intronic
1061954301 9:133953631-133953653 CATGGTGGTCAGAGGGAACTGGG - Intronic
1062169158 9:135125027-135125049 CCTAGTGCTCAAGGGGGACCGGG + Intergenic
1062392817 9:136340719-136340741 CCTGGGCCTCTGAGGGAACCAGG - Intronic
1062560602 9:137139963-137139985 GCTGGTCCTCAGAGGGCCCCTGG + Intronic
1187228207 X:17394602-17394624 CCAGGTCCTCAAAGGCAACCTGG - Intronic
1188275242 X:28192392-28192414 TCTGGTGCACAGAGGGGTCCTGG - Intergenic
1188860014 X:35244730-35244752 CCTGGTGCTCAGGGGTGGCCCGG + Intergenic
1190322430 X:49186842-49186864 GCTGGTGCTCGCTGGGAACCTGG + Intergenic
1190777225 X:53562562-53562584 CCTGTTGGCAAGAGGGAACCTGG + Intronic
1195385488 X:104310037-104310059 CCTGATCCTCAGAGTGAACCTGG - Intergenic
1197196574 X:123708588-123708610 TCTGGTACTCATAGGGGACCAGG + Intronic
1199683348 X:150242801-150242823 CCTCATGCTCATAGGGAACCAGG + Intergenic
1199790630 X:151152090-151152112 CCTGGTGCTAGGAGGTATCCCGG - Intergenic
1200237183 X:154473295-154473317 CCAGGTGCTCAGAGAGAATAGGG - Exonic
1202368005 Y:24179879-24179901 CAGGGTCCTCTGAGGGAACCTGG + Intergenic
1202502778 Y:25490238-25490260 CAGGGTCCTCTGAGGGAACCTGG - Intergenic