ID: 1101740415

View in Genome Browser
Species Human (GRCh38)
Location 12:107495620-107495642
Sequence CATGGAGGGCAGGCCCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101740415_1101740426 22 Left 1101740415 12:107495620-107495642 CCTCTCAGGGCCTGCCCTCCATG 0: 1
1: 1
2: 2
3: 42
4: 353
Right 1101740426 12:107495665-107495687 AGCCCTTCTGTATCTACAGCTGG 0: 1
1: 0
2: 2
3: 6
4: 120
1101740415_1101740421 -2 Left 1101740415 12:107495620-107495642 CCTCTCAGGGCCTGCCCTCCATG 0: 1
1: 1
2: 2
3: 42
4: 353
Right 1101740421 12:107495641-107495663 TGAATACCCCCTGAACTTCAGGG 0: 1
1: 0
2: 1
3: 4
4: 103
1101740415_1101740420 -3 Left 1101740415 12:107495620-107495642 CCTCTCAGGGCCTGCCCTCCATG 0: 1
1: 1
2: 2
3: 42
4: 353
Right 1101740420 12:107495640-107495662 ATGAATACCCCCTGAACTTCAGG 0: 1
1: 0
2: 1
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101740415 Original CRISPR CATGGAGGGCAGGCCCTGAG AGG (reversed) Intronic
900031564 1:376346-376368 TATGGAGGCCAAGGCCTGAGTGG + Intergenic
900052115 1:604546-604568 TATGGAGGCCAAGGCCTGAGTGG + Intergenic
900092829 1:927871-927893 CCTGGAGGGCAGGTCTGGAGTGG - Intronic
900318862 1:2072719-2072741 CCTGGAGGGACGGCCCCGAGAGG - Intronic
900466028 1:2825902-2825924 CATGGAGGGACGCCCCTGTGAGG - Intergenic
900532078 1:3159449-3159471 CACAGAGGGAAGGCCCTGTGAGG - Intronic
900658951 1:3773304-3773326 CCTGGAGGGGAGTCCCTGATGGG + Intronic
901068144 1:6504354-6504376 CAGGGAGGGCAGGACATGAGAGG - Intronic
901430454 1:9210959-9210981 CACAGAGGGAAGGCCCTGTGAGG - Intergenic
901527840 1:9835434-9835456 CAGGGAGGGTAGGCTCTGGGAGG - Intergenic
901680834 1:10911853-10911875 CAGGCAGGGCAGGCCCAGAACGG - Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902301900 1:15507794-15507816 CCTGCAGGGAAGGACCTGAGGGG + Intronic
902478211 1:16699121-16699143 CGTGGGAGGCAGGCCCAGAGAGG + Intergenic
902871858 1:19318520-19318542 CATTGTGTGAAGGCCCTGAGTGG - Intronic
903350873 1:22715952-22715974 CATTGAGGGAAGGACCTTAGAGG - Intronic
904565732 1:31427196-31427218 CATTAGGGGCAGTCCCTGAGTGG + Intronic
904774027 1:32895832-32895854 CAAGGAGGCCAGGCCCTTGGCGG + Intronic
905204838 1:36337508-36337530 CATGGAGGGTAAGCCATCAGAGG + Intergenic
906276778 1:44522797-44522819 CCAGGAGGGCAGGGCCTCAGAGG - Intronic
906544513 1:46611907-46611929 CAGGGTGGTCAAGCCCTGAGGGG - Intronic
906660517 1:47578341-47578363 CCTGCAGGGCAGTGCCTGAGAGG - Intergenic
907118542 1:51990075-51990097 CATGGAGGTGAGGAGCTGAGGGG - Intronic
907201400 1:52729785-52729807 AACTGAGGGCAGGGCCTGAGAGG + Intronic
907319127 1:53591947-53591969 CAGGGAGGGAAGGCCCAGAAGGG - Intronic
912619538 1:111140626-111140648 CGTGGAGGGCCAGCGCTGAGCGG + Intronic
914384594 1:147156037-147156059 CATGGAATGCAGGACCTGGGAGG - Exonic
915318396 1:155042685-155042707 CCTGGAGGACAGGCCCGGGGAGG + Intronic
917969109 1:180196023-180196045 CACGGAGGGCCGGGGCTGAGGGG + Intronic
918439046 1:184547203-184547225 CATGCAGGGCAGGACCTCTGAGG + Intronic
920565024 1:206966116-206966138 CCTGGACTGCAGGCCTTGAGGGG + Intronic
922031798 1:221808307-221808329 GATGGTGGGCAGGGGCTGAGAGG + Intergenic
922605801 1:226889120-226889142 CAAGGAGGGCAGGTGCTGAAGGG + Intronic
1065787377 10:29229369-29229391 CGTGGAGAGGAGGCTCTGAGAGG + Intergenic
1065969680 10:30796395-30796417 CATGGAGGTCAGGCAGTCAGTGG + Intergenic
1066332379 10:34438832-34438854 GATGGAGGAAAGTCCCTGAGGGG + Intronic
1067183884 10:44011003-44011025 CACAGAGGGCAGCCCCTGACTGG - Intergenic
1067728227 10:48789785-48789807 CCTGGAGGGCAGGCCCTCTGGGG - Intronic
1067947418 10:50698741-50698763 CAGGGAGGCCAGCCCCTGTGAGG + Intergenic
1069807841 10:71137089-71137111 CTTGGAGGACAGAGCCTGAGTGG + Intergenic
1069833770 10:71296240-71296262 CCAGGAGGGCATGCCCTGAAGGG - Intronic
1069861722 10:71475764-71475786 GCTGGAATGCAGGCCCTGAGGGG + Intronic
1070590382 10:77796630-77796652 CTTGGAGTGGAGGACCTGAGTGG + Intronic
1070788812 10:79177606-79177628 CAGGGACTGCAGGCCCTGTGAGG - Intronic
1070882732 10:79863728-79863750 CAGGGAGGCCAGCCCCTGTGAGG + Intergenic
1070982071 10:80657151-80657173 CGTGGAGAGCAGGCCTTGTGAGG - Intergenic
1071152628 10:82652619-82652641 CAGGTAGGGCAGGCCATGGGTGG + Intronic
1071649298 10:87380030-87380052 CAGGGAGGCCAGCCCCTGTGAGG + Intergenic
1074704724 10:116120683-116120705 GGTGGAGGGCTGGCCCTGATTGG + Intronic
1076536282 10:131179619-131179641 CATGGAGGGCTGGCGGGGAGGGG + Intronic
1076552191 10:131288509-131288531 GGTGGAGGGCAGGCCCTGGGTGG - Intronic
1076611009 10:131725912-131725934 CCTGGAGGGCAGGTGCTCAGCGG + Intergenic
1076721177 10:132394055-132394077 CAGGGGAGGCAGACCCTGAGGGG + Intergenic
1077093781 11:790908-790930 AAAGGAGGGTGGGCCCTGAGAGG + Exonic
1077101834 11:825902-825924 CATGGCAGGGAGGCCATGAGGGG + Intergenic
1077146283 11:1047608-1047630 CATTGAGGCAAGACCCTGAGGGG + Intergenic
1077206217 11:1346089-1346111 CATGGATGCCAGGCTCTGGGTGG + Intergenic
1077305885 11:1868546-1868568 CCTGCTGGGCTGGCCCTGAGGGG + Intronic
1077309279 11:1881331-1881353 CTTGGAGTCCAGGGCCTGAGCGG + Intronic
1077327861 11:1971454-1971476 GGTGGAGGGCAGGGCCGGAGAGG - Intronic
1077502834 11:2917027-2917049 CTAGGAGGGGAGGCCCAGAGAGG + Intronic
1077979223 11:7282675-7282697 CATGGTGGGAAGTCCCTGAGAGG + Intronic
1081667459 11:44924976-44924998 AATGGAGGGCCAGCCCTGAACGG + Intronic
1081693201 11:45092258-45092280 CATGTGGGGAAGGCCCTGAATGG + Intergenic
1081712496 11:45226425-45226447 CTTGGAGGGCAGGCCCTACCTGG + Intronic
1081717766 11:45263046-45263068 AATGGTGGGCAGGGCCTGGGAGG - Intronic
1083651515 11:64207306-64207328 CAAGGTGGGCAGGCCCTGGTAGG - Intronic
1083890887 11:65595327-65595349 GATGGAGCCCAGGCCCTGTGAGG - Intronic
1084570946 11:69959535-69959557 CCTGGAGGTCAGGCCCTGGCAGG + Intergenic
1084690188 11:70720566-70720588 CATGGCAGGGAGGCCCTAAGAGG + Intronic
1084972468 11:72779333-72779355 CAAAGAGGACAGGACCTGAGAGG + Intronic
1085170329 11:74444311-74444333 CAAGGAGCACAGGCCCAGAGGGG + Intergenic
1090409028 11:126495082-126495104 CCTGGAGGTCAGGGCCTAAGAGG - Intronic
1091023806 11:132124271-132124293 CAGGGAGGGCAGGGCCCCAGGGG - Intronic
1091068114 11:132536154-132536176 AATGGAGAGCAGGCCCTGGAGGG - Intronic
1202810841 11_KI270721v1_random:26634-26656 GGTGGAGGGCAGGGCCGGAGAGG - Intergenic
1091703166 12:2677407-2677429 CATGGAGGGCAGTCGGTGGGTGG - Intronic
1093997153 12:25654873-25654895 CACTGAGGGAAGGCCCAGAGAGG - Intergenic
1096594467 12:52685766-52685788 CATGGAGGACGGGCTCCGAGTGG - Intergenic
1096613837 12:52820420-52820442 CAGGGTGGGGAGGGCCTGAGAGG + Intergenic
1096883966 12:54698694-54698716 CATGGAGGGAGAGGCCTGAGGGG + Intergenic
1096980464 12:55725746-55725768 CCTGGAGGGAAGGGGCTGAGGGG - Intronic
1097240421 12:57571397-57571419 GAGGGAGGGCAGGACATGAGAGG + Intronic
1101740415 12:107495620-107495642 CATGGAGGGCAGGCCCTGAGAGG - Intronic
1101875237 12:108593031-108593053 CATGGGGGCCAGACCCTGAGGGG - Intronic
1102255044 12:111410277-111410299 CAAGGAGGAGAGGCCCAGAGAGG + Intronic
1102732173 12:115121186-115121208 CATGGGGGGCAGAGCCAGAGGGG + Intergenic
1103446346 12:120997465-120997487 CGTGGAGGCCAGGCCTGGAGTGG - Exonic
1103566690 12:121819710-121819732 CATGGAGGGCCGCTCCTCAGGGG - Exonic
1103621358 12:122189287-122189309 CCTGGAGGGCATGCCCTTGGGGG + Intronic
1103896282 12:124275415-124275437 CATGGAGGGCAGATCTAGAGAGG + Intronic
1104475451 12:129067245-129067267 CACAGAGTGCTGGCCCTGAGGGG + Intergenic
1104809472 12:131611766-131611788 CAGGGAGGACAGGGCCTGGGGGG - Intergenic
1104897637 12:132172133-132172155 CATGGAGGCCAGTCCCAGAGCGG - Intergenic
1104971823 12:132534222-132534244 CATGGAGGCCAGGACTGGAGTGG - Intronic
1105256030 13:18744573-18744595 CTGGGAGGTCAGGCCCTGTGAGG + Intergenic
1107401382 13:40072972-40072994 AGTGGAGGGATGGCCCTGAGAGG + Intergenic
1107689168 13:42934758-42934780 GATGGGGGCCAGGCCATGAGGGG - Intronic
1112338206 13:98531923-98531945 CAGGGAGGGTCGGCCCTGGGAGG - Intronic
1115641820 14:35340127-35340149 CGGGGGGGGCAGGCTCTGAGAGG - Intergenic
1117292618 14:54348269-54348291 CATGGATGGCATGAGCTGAGGGG - Intergenic
1119185943 14:72642677-72642699 CATGGAGGGCAAGGCCTGAGGGG - Intronic
1119535952 14:75402358-75402380 AACGGCAGGCAGGCCCTGAGCGG + Intergenic
1122129912 14:99598926-99598948 AAAGGAGGGCTGGCCTTGAGAGG - Intronic
1123016466 14:105377909-105377931 CATGCAGTGCAGGCCCAGCGTGG + Intronic
1123106740 14:105845299-105845321 CTTTGTGGTCAGGCCCTGAGTGG + Intergenic
1123160979 14:106277695-106277717 CCTGCAGGGCAGGAGCTGAGCGG - Intergenic
1125518243 15:40334759-40334781 GAGGGAGGCCAGGCCCTGGGGGG + Exonic
1125744090 15:41987392-41987414 GATGAAGGGCAGGTCATGAGAGG + Intronic
1126463567 15:48939329-48939351 TATGAAGGGCAGGCAATGAGAGG + Intronic
1127819087 15:62639742-62639764 CCCAGAGGGCAGGGCCTGAGTGG - Intronic
1130968759 15:88716714-88716736 CACACAGGGCAGGCCCAGAGCGG - Intergenic
1131003272 15:88955208-88955230 CATTGAGGAGAGGCCCTGAATGG + Intergenic
1132179856 15:99744024-99744046 CATAGAGGGAAGGCTCTGTGAGG + Intergenic
1132353485 15:101154880-101154902 CAGGGAGGCCAAGCACTGAGGGG + Intergenic
1132516101 16:366730-366752 CAGGAGGGGCAGGCCCTCAGAGG - Intergenic
1132665240 16:1078479-1078501 ACTGCAGGGCAGGCTCTGAGGGG + Intergenic
1132945235 16:2528619-2528641 CAGAGAGGGCAGGCTCTGGGGGG - Exonic
1133656865 16:7873335-7873357 CATAGATGCCAGGCCCTCAGGGG - Intergenic
1134761507 16:16718838-16718860 CATGGGGGCCTGGCCCTGTGAGG + Intergenic
1134984551 16:18640332-18640354 CATGGGGGCCTGGCCCTGTGAGG - Intergenic
1135635039 16:24068327-24068349 CAGGGAAGGCAGGACTTGAGGGG - Intronic
1137351072 16:47714378-47714400 CATGGAGTGAAACCCCTGAGGGG + Intergenic
1137555650 16:49468806-49468828 CATGCCTGGGAGGCCCTGAGTGG - Intergenic
1137901396 16:52272906-52272928 CATGGAGGTCATGCCCAGAGAGG + Intergenic
1138584927 16:57963378-57963400 CATGGAGGGTGGGCTCTGAATGG - Intronic
1138658097 16:58502107-58502129 TAGGGAGGGCAGGCCCTGCCAGG - Intronic
1141305801 16:82862830-82862852 CATGGAGGGCAACCACTGGGAGG - Intronic
1141652415 16:85400178-85400200 CAGGGAGGGGAGGGCCTGTGGGG - Intergenic
1141730902 16:85822270-85822292 CAGAGAGGCCAGGCCCTGCGGGG + Intergenic
1141733988 16:85840242-85840264 GAGGGAGTGAAGGCCCTGAGAGG - Intergenic
1141987407 16:87588960-87588982 CCTGGCGAGCAGGCCCAGAGAGG - Intergenic
1142029042 16:87829383-87829405 GGTGGGGGACAGGCCCTGAGTGG - Intergenic
1142081920 16:88153794-88153816 CACAGAGGGAAGGCCCTGTGAGG - Intergenic
1142251635 16:88994489-88994511 CATGGATGCCTGGCACTGAGGGG - Intergenic
1142581108 17:943382-943404 CACAGAGGGAAGGCCCAGAGAGG + Intronic
1142605926 17:1081008-1081030 CAGGGTGGGCAGGCTGTGAGGGG + Intronic
1143028488 17:3954361-3954383 GATGGAGTGCAGGGCCTGGGGGG - Intronic
1143324166 17:6087628-6087650 CAGGGAGGGCAGGGCTAGAGAGG + Intronic
1144945966 17:18969592-18969614 CAGCCAGGGCAGTCCCTGAGGGG - Exonic
1145062436 17:19741620-19741642 TCTGGAGAGCAGGCCCAGAGGGG - Intronic
1145261606 17:21357906-21357928 CGTGAAGGGCAGGTCCTGAATGG - Intergenic
1146357010 17:32142753-32142775 CAGGGAGGGCAGGGACTCAGGGG - Intronic
1146507292 17:33416495-33416517 CCTGGAGGGCAGTCCCTGATAGG + Intronic
1146605209 17:34252042-34252064 CCTGGAGGAGAGGCCTTGAGTGG + Intergenic
1147166669 17:38597021-38597043 CAGGGAGGGCTGTGCCTGAGTGG - Intronic
1147177832 17:38667613-38667635 CATGGAGTGAGAGCCCTGAGGGG - Intergenic
1147650679 17:42060101-42060123 AATGGAGGGCTGACACTGAGTGG - Intronic
1148072665 17:44917101-44917123 CATGAAGAGGAGGCCCTGGGGGG + Intergenic
1150392575 17:64798489-64798511 TGTGGAGGCCAGGCTCTGAGGGG - Intergenic
1151425004 17:74025291-74025313 CATGGAGGCGGGGCCCTCAGAGG - Intergenic
1151907006 17:77055158-77055180 CAGGGAGGCCAGTCCCTGAGAGG - Intergenic
1152195614 17:78916567-78916589 GATGGAAGGCAGGCCCTGAGCGG - Intronic
1152288640 17:79426252-79426274 CATGCAGGCAAGGCCCAGAGGGG + Intronic
1152344474 17:79742821-79742843 CAAGGATGGCAGCCCCTGGGAGG + Intergenic
1152354990 17:79802647-79802669 CATGAGGGGCAAGCCCAGAGAGG + Intergenic
1152422620 17:80202259-80202281 CATGGAGGGCAGGGCCAAAGGGG + Exonic
1152624180 17:81380688-81380710 CATGGAGGGCAGGGGCTGCACGG + Intergenic
1152948089 17:83209367-83209389 TATGGAGGCCAAGGCCTGAGTGG - Intergenic
1154435003 18:14336105-14336127 CTGGGAGGTCAGGCCCTGTGAGG - Intergenic
1156295016 18:35781645-35781667 AGTGGAGGACAGGCTCTGAGCGG + Intergenic
1156470505 18:37374724-37374746 CATGGAAGGGAGGCACAGAGTGG + Intronic
1157934110 18:51855091-51855113 CATGGAGGGAGGGAGCTGAGTGG + Intergenic
1160008825 18:75088653-75088675 CATGGGGTGGAGGCCCTGTGTGG - Intergenic
1160433816 18:78831041-78831063 CATGGTGGGCAGCCCATGACGGG - Intergenic
1160707986 19:538787-538809 CATGGTGGGCGGGCCCCGTGCGG + Intronic
1161067561 19:2246189-2246211 CCTGGTGGGGAGGCCCTGACAGG + Intronic
1161679412 19:5672215-5672237 CCTTGAGGGCAGGCACTGATTGG - Intergenic
1162478785 19:10916050-10916072 CACAGACGGCAGGGCCTGAGAGG + Intronic
1163034979 19:14564914-14564936 CAGGGAGGGGAGCCCATGAGGGG - Intronic
1163104807 19:15117065-15117087 CATGGACGGCAGGCCGGAAGGGG - Intronic
1163114573 19:15181203-15181225 GAAGGAGGGCAGGGCCTGTGAGG - Intronic
1163156532 19:15442755-15442777 CAGAGAGGGGAGACCCTGAGGGG + Intronic
1163183781 19:15622239-15622261 CATGGAGGGCAGCACCTGTCTGG + Exonic
1163632313 19:18423833-18423855 CATAGGTGACAGGCCCTGAGAGG + Intronic
1163847476 19:19645776-19645798 CATGAAGGGCGGGCCCTGTGGGG + Exonic
1164615127 19:29663159-29663181 CATGGAGGGTAGGCCCTGGCTGG - Intergenic
1164717479 19:30404161-30404183 CAAGGTAGGCAGGCCCTGCGTGG - Intronic
1164786214 19:30933203-30933225 CATGGAGGGCAGGTTCTTACGGG + Intergenic
1165332522 19:35148878-35148900 CATGGAGGGCAGAACCAGATGGG + Intronic
1165728488 19:38129243-38129265 CCTGGAGGCCAGGCCCTGCGTGG + Intronic
1165855578 19:38877902-38877924 CAAGAATGGAAGGCCCTGAGGGG - Intronic
1166039228 19:40191930-40191952 GATGGAGGGCAGTCCCTGCGGGG - Exonic
1166340692 19:42134988-42135010 CATGGCTGGGGGGCCCTGAGGGG - Intronic
1166368033 19:42287054-42287076 CAGGGAGTGCTGACCCTGAGCGG + Exonic
1166718893 19:44986423-44986445 CATGGGGGGAAGGACCTCAGAGG - Intronic
1167277273 19:48545937-48545959 AGTGGAGGGCATGTCCTGAGTGG + Intergenic
1167307759 19:48719083-48719105 CATAGAGGGCTGGCTCAGAGTGG + Intronic
1168315801 19:55484303-55484325 GATGGAGGGCAGGCCCTGAGGGG - Exonic
1202712232 1_KI270714v1_random:24949-24971 CGTGGGAGGCAGGCCCAGAGAGG + Intergenic
925202947 2:1983654-1983676 AGTGGTGGGCAGGCCCTGGGTGG - Intronic
927102817 2:19800966-19800988 CAGGGAGGGCAGGCTATTAGGGG - Intergenic
932137491 2:69243828-69243850 CATAGAGGGCAGCCTCAGAGAGG + Intronic
933763603 2:85692593-85692615 CATGGTGGGGAGACCCTGACAGG + Intronic
934580518 2:95434231-95434253 CAGGGAAGGCAGGCGCTGTGTGG + Intergenic
934598930 2:95642486-95642508 CAGGGAAGGCAGGCGCTGTGTGG - Intergenic
936265145 2:110999208-110999230 CATGGATGGATGGCCATGAGAGG - Intronic
936427706 2:112434647-112434669 CTTGGAGGGCAGCCGCTGAGGGG + Intergenic
936532276 2:113284480-113284502 CAGGGAAGGCAGGCACTGTGTGG - Intergenic
937124414 2:119464278-119464300 CATAGAGGCCAGAGCCTGAGGGG + Intronic
937274316 2:120674308-120674330 CATGGAGGGCAGCTGCTGGGGGG + Intergenic
937998105 2:127710444-127710466 CATGGAGGCCTGCCCCTGGGTGG - Intronic
938329939 2:130442229-130442251 CTGGGAGGTCAGGCCCTGCGAGG + Intergenic
938360006 2:130679274-130679296 CTGGGAGGTCAGGCCCTGCGAGG - Intergenic
938383348 2:130848744-130848766 CAGGGAGACCAGGCCCCGAGGGG + Intronic
938436414 2:131285995-131286017 CTGGGAGGTCAGGCCCTGCGAGG - Intronic
938986101 2:136578083-136578105 CATGGTGGGAAGGTCCCGAGGGG + Intergenic
939084154 2:137697083-137697105 ACTGCAGTGCAGGCCCTGAGAGG + Intergenic
941482536 2:166034847-166034869 CATTGAGGACAGGCCATGTGAGG + Intronic
942186208 2:173427219-173427241 CATGGAAGGCAGGAGCAGAGCGG + Intergenic
943697428 2:190951213-190951235 CATGGAAGGCAAGTCGTGAGAGG + Intronic
945877225 2:215291163-215291185 CATGGAGGGAATGCCCTGCTAGG - Intergenic
946310686 2:218880976-218880998 CATGGCGCGCAGGCCCTGACGGG - Exonic
948075054 2:235159374-235159396 AGTGGAGGGCAGGCAGTGAGGGG + Intergenic
948421395 2:237862749-237862771 TATGGTGGGCTGGCCCTCAGTGG + Intronic
948844708 2:240677498-240677520 CCAGGAGGGCAGGCCCAGGGAGG + Intronic
948849152 2:240697381-240697403 CCAGGAGGGCAGGCCCAGGGAGG - Intronic
1171880775 20:30616323-30616345 CTGGGAGGTCAGGCCCTGTGAGG + Intergenic
1173161335 20:40654690-40654712 CATTGAAGGCAGGCCCGTAGTGG - Intergenic
1173185533 20:40837135-40837157 CATGGAAGGAAGGCTCTGAGTGG - Intergenic
1173617426 20:44412293-44412315 CATGGGGGGCAGGGCCAGGGTGG + Intronic
1173736540 20:45365635-45365657 CATGGAGAGCCGGCCTGGAGGGG - Exonic
1173973049 20:47167241-47167263 TCTGGAGGTCAGGCTCTGAGAGG + Intronic
1174064026 20:47851916-47851938 CAGAGAGGGCAGGACCTGAGTGG + Intergenic
1175263439 20:57688885-57688907 CATGGTGAGCATTCCCTGAGCGG + Intronic
1175405037 20:58720305-58720327 CATGCAAGGCAGCCCCTGGGAGG + Intergenic
1175462675 20:59164814-59164836 CATGGAAGCCATGCTCTGAGAGG + Intergenic
1175541596 20:59751327-59751349 CATGCAGGACAGGCCCTGTGAGG + Intronic
1175546526 20:59781528-59781550 CATGGAGGGCCTGGCCTGTGTGG + Intronic
1175942021 20:62541828-62541850 CCTGCAGGACTGGCCCTGAGTGG + Intergenic
1175979393 20:62729441-62729463 GATGGAGGGTGGGCCCTCAGGGG + Intronic
1175997511 20:62818183-62818205 CAGCGTGGACAGGCCCTGAGGGG - Intronic
1176053821 20:63134506-63134528 CAGGGGAGGCAGGGCCTGAGGGG + Intergenic
1176054071 20:63135071-63135093 CAGGGGAGGCAGGGCCTGAGGGG + Intergenic
1176374537 21:6080565-6080587 CTTGGAGGGCAGCCGCTGAGGGG - Intergenic
1176842035 21:13849597-13849619 CTGGGAGGTCAGGCCCTGTGAGG + Intergenic
1178518366 21:33266952-33266974 TAGGGAGGGCTGGCACTGAGGGG - Intronic
1179005152 21:37507482-37507504 GTTGGAGGGCAGGACCTAAGTGG - Intronic
1179612530 21:42561777-42561799 CATGGGGTGCAGGCCCAGCGTGG - Intronic
1179748938 21:43457680-43457702 CTTGGAGGGCAGCCGCTGAGGGG + Intergenic
1180043415 21:45292047-45292069 CAGGGAGGCCTGGCCCTGAGCGG - Intergenic
1180050514 21:45329036-45329058 CACGGAGGGGTGGCCCTGCGAGG - Intergenic
1181537520 22:23554239-23554261 CATGCTGGGCAGGCCCTTGGGGG + Intergenic
1183063739 22:35350109-35350131 CATGGAGGGGAGGGGTTGAGTGG + Intergenic
1183748142 22:39704101-39704123 CCTGGGGGACAGGCCCTGGGAGG + Intergenic
1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG + Intronic
1185079875 22:48703757-48703779 CCTGCAGGGCAGGCTGTGAGAGG - Intronic
1185231351 22:49685989-49686011 CCTGGACGGGAGGCCCTGCGGGG - Intergenic
950257682 3:11519515-11519537 CATGAAAGGCAGGCAGTGAGAGG + Intronic
953736453 3:45498041-45498063 TATAGAGGGAAGGCCCTGAAGGG - Intronic
957268183 3:77994830-77994852 CAGGGAAGGCATGCCATGAGTGG + Intergenic
959946716 3:112133130-112133152 GACGGAGGGGAAGCCCTGAGAGG - Exonic
960253762 3:115488184-115488206 CATCCAGGGCAGGTCCTGTGTGG - Intergenic
961348221 3:126278624-126278646 CTTGGGGGGCATGCCCTGCGGGG + Intergenic
961372489 3:126440113-126440135 CATGCAGGGAAGGCCCTCTGTGG - Intronic
961465649 3:127079445-127079467 CATGGCGGACAGGTGCTGAGAGG + Intergenic
961869301 3:129976235-129976257 CACAGAGAGCAGGCCCTGGGTGG + Intronic
962967948 3:140371520-140371542 ACTGGAGGGCAGGGCCTCAGGGG - Intronic
963737965 3:149042572-149042594 AATGGATGGCATGCCCTGAGGGG + Intronic
965070172 3:163908749-163908771 CATGGAGGGAAGGGTTTGAGGGG - Intergenic
966881680 3:184354371-184354393 CAACCAGGGCAGGTCCTGAGTGG + Intronic
968047019 3:195630204-195630226 CGGGGAGGGGCGGCCCTGAGTGG + Intergenic
968149332 3:196324645-196324667 CATGGTGGGGAGGCCGTGAGGGG + Intronic
968307632 3:197659840-197659862 CGGGGAGGGGCGGCCCTGAGTGG - Intergenic
968648146 4:1749981-1750003 CCTGGAGGGAGGGGCCTGAGTGG - Intergenic
969153848 4:5193021-5193043 CAGGGAGGGAAGGCACTGGGAGG - Intronic
969423069 4:7108432-7108454 CATGCAGGGCAGCACCTGAGAGG + Intergenic
969516617 4:7651767-7651789 CTTGGAATGCAGGCCCTGCGGGG - Intronic
970425257 4:15940011-15940033 CGTGGAGGTCAGGGCCTCAGCGG - Intergenic
971343611 4:25792474-25792496 TATGGAGGGCAACCCATGAGCGG + Intronic
971346554 4:25816817-25816839 CAGGCAGAGCAGACCCTGAGAGG - Intronic
972286958 4:37658236-37658258 CCTGCATGGCATGCCCTGAGTGG - Intronic
972362904 4:38345401-38345423 CATGGAGGGCAGGACAGGGGTGG - Intergenic
975478768 4:74854426-74854448 TAAGAAGGGCATGCCCTGAGAGG + Intergenic
976144552 4:82029469-82029491 TTTGGAGGGCAGGCATTGAGTGG - Intronic
979531361 4:121772260-121772282 GATGGAGGGCTGGCCTGGAGTGG - Intergenic
985168202 4:187119954-187119976 CTTGGAGGCCAGGCCGTGATTGG + Intergenic
985638644 5:1052806-1052828 CATGGAGGACATGCCCTCACTGG + Intronic
985670599 5:1204659-1204681 CTGGGGGGGCAGCCCCTGAGGGG - Intronic
985724456 5:1508480-1508502 CAGGGAGGGACGGCCCTGTGAGG + Intronic
985744601 5:1638940-1638962 CGGGGAGGGGTGGCCCTGAGTGG - Intergenic
985990314 5:3552375-3552397 GTTGGAGGGCGGGGCCTGAGAGG + Intergenic
986208574 5:5648772-5648794 GATGGTGGGCAGGCCGTGCGTGG - Intergenic
986668982 5:10126809-10126831 CATGGAGGCCTGGCCATCAGTGG - Intergenic
991516747 5:67444739-67444761 CAAGGAGGGCAGGCAATAAGGGG - Intergenic
992072208 5:73158505-73158527 CATGAAGGGCAGGCACTGGCAGG - Intergenic
992791816 5:80220687-80220709 CATGGAGGGCAGTGACTCAGAGG - Intronic
995846862 5:116502845-116502867 TATTGAAGGCAGCCCCTGAGAGG + Intronic
998167777 5:139854305-139854327 CATTTAGGCCAGGGCCTGAGAGG - Intronic
998374230 5:141680773-141680795 CAGGGTGGGCAGGAACTGAGGGG - Intronic
998381498 5:141729307-141729329 CATATAGGGCAGGCTTTGAGGGG + Intergenic
998452268 5:142244245-142244267 CATGGAAGGCAGGCACAGGGGGG - Intergenic
999279357 5:150354809-150354831 GATGGAGGGAATGCTCTGAGAGG - Intergenic
1002089539 5:176796331-176796353 CCTGCAGGGCAGCCCCAGAGTGG - Intergenic
1002411081 5:179076960-179076982 CAAAGAAGGCAAGCCCTGAGAGG - Intronic
1002742256 5:181442522-181442544 TATGGAGGCCAAGGCCTGAGTGG - Intergenic
1003017880 6:2482600-2482622 CATGCAGGGGAAGCCCTGAGTGG - Intergenic
1003445101 6:6176989-6177011 CAGGAAGCGCAGGCCCAGAGAGG + Intronic
1003790369 6:9539582-9539604 CATGGAGTGCATGGCCTCAGTGG + Intergenic
1004905050 6:20229832-20229854 CATTGAGGGCCTGCACTGAGAGG - Intergenic
1005039758 6:21590186-21590208 CATGGAGGGAGGGACCTGAATGG - Intergenic
1006116137 6:31777089-31777111 CAGGTAGGGGAGGGCCTGAGAGG - Exonic
1006374660 6:33665254-33665276 CATGAAATGCAGGCCCTGGGAGG - Intronic
1006375799 6:33671083-33671105 CGTGGAGGGCAGGCCAGGACTGG - Intronic
1006624674 6:35388923-35388945 CACAGAGGGCAGGCACTGAGAGG - Intronic
1007202224 6:40119412-40119434 CATTGATGGCAGGCCCAGTGTGG - Intergenic
1007715659 6:43854624-43854646 CATGGCGGTCAGCCCCAGAGGGG - Intergenic
1007817991 6:44538305-44538327 CAGGCAGGGCAGGCTCTGGGAGG + Intergenic
1009435460 6:63613130-63613152 CATTGTGGGCAGGGTCTGAGAGG - Intergenic
1011184360 6:84657923-84657945 CATGGAAGGCAGGTACTGAAAGG - Intergenic
1012118940 6:95339723-95339745 CATGAAGGGCAGGGCCAGACTGG + Intergenic
1013155477 6:107489077-107489099 CATGGAGGGCAGGCGCTAGCTGG + Intergenic
1015266304 6:131295194-131295216 CATGGTGCGCAGGCCATCAGAGG - Intergenic
1017757186 6:157539515-157539537 CGTGGAAGGAAGTCCCTGAGTGG + Intronic
1018397263 6:163387998-163388020 CATGAAGGGAAGGCCCTGGAAGG + Intergenic
1018685094 6:166298092-166298114 GAAGGAGGACAGGCGCTGAGGGG - Intergenic
1019247392 6:170718260-170718282 TATGGAGGCCAAGGCCTGAGTGG - Intergenic
1019721661 7:2575906-2575928 CATGGAGCGCAGGTGTTGAGTGG + Intronic
1019928242 7:4207144-4207166 CTTGCTGGGCAGGCCCTGACTGG - Intronic
1020021761 7:4873553-4873575 CCTGCAGGGCAGGCCCAGTGAGG - Intronic
1020084813 7:5304390-5304412 GATGCAGTGCAGTCCCTGAGGGG - Exonic
1022500776 7:30881217-30881239 CATGGAGGCCAGGCATTCAGGGG + Intronic
1024039797 7:45543208-45543230 CATGTAGTGCAGGCTCTGAGTGG + Intergenic
1024234396 7:47386956-47386978 CATGGAGGGCAGGGCATGTGAGG - Intronic
1025823731 7:64994453-64994475 CCTGGAGGGGAGGCTCTGGGAGG + Intronic
1030185799 7:106760475-106760497 CATGGAGAGCAGGCCCGAAAAGG - Intergenic
1030373138 7:108723482-108723504 CATGCATGGCAGGTGCTGAGAGG - Intergenic
1032193720 7:129778490-129778512 CATGAAGGGGCGGCCTTGAGCGG + Intergenic
1032316823 7:130845611-130845633 CCTGGAGGGCAGGGCATGCGGGG - Intergenic
1034724174 7:153319936-153319958 CAGAGAGGGCAGGCCCTGCAAGG - Intergenic
1035109779 7:156471428-156471450 CATGCAGGGGAGGCCCAGAGAGG - Intergenic
1035455730 7:159007432-159007454 CATGGAGGGCGGGTGCAGAGGGG + Intergenic
1035500745 8:89676-89698 TATGGAGGCCAAGGCCTGAGTGG + Intergenic
1035633699 8:1127589-1127611 CCTGGAGGCCAAGCACTGAGAGG + Intergenic
1035959603 8:4122658-4122680 CAGGAAGGGCAGACCCTCAGGGG + Intronic
1037769634 8:21790737-21790759 CAGGGAGGGCAGGCCTGAAGGGG - Intronic
1037981816 8:23259753-23259775 CAGGGAGGGCAGGCTAGGAGAGG - Intronic
1038752437 8:30308126-30308148 CAAGGAGTGCAGTTCCTGAGTGG + Intergenic
1039558689 8:38495852-38495874 CAGGGAGGGCAGGGCCTCAGGGG - Intergenic
1039941386 8:42094297-42094319 AAAGGAGGGCAGACCCTGATAGG + Intergenic
1041699162 8:60768529-60768551 GTTGGAGGGCAGGGTCTGAGCGG - Intronic
1044078107 8:87848021-87848043 CATTGAGGGAAGGCCGTGTGAGG - Intergenic
1045660113 8:104428552-104428574 AATGGAGGGCAGGCCCTCCGGGG + Intronic
1049221860 8:141432110-141432132 CATGGAGGGCATGGCCCCAGCGG + Exonic
1049360953 8:142212430-142212452 CATGGAGGTAGGGCCCTGAGAGG + Intronic
1049773912 8:144396072-144396094 TGTGGAGGCCAGGCCCTGCGAGG + Intronic
1050438603 9:5635677-5635699 TATGGAGGGCAGGACCTGGTAGG + Intronic
1051783614 9:20718083-20718105 CATGGAGGGAAGGGCTGGAGAGG + Intronic
1052653081 9:31327236-31327258 CATGGAGAGAAGGGCTTGAGGGG - Intergenic
1053268646 9:36734814-36734836 CATGGAGGGCACGCTCTTAAAGG - Intergenic
1053666949 9:40323479-40323501 CTGGGAGGTCAGGCCCTGCGAGG - Intronic
1055364867 9:75532391-75532413 CATGTAATGCAGTCCCTGAGTGG - Intergenic
1056472079 9:86915660-86915682 CATGGAGGTGAGCTCCTGAGAGG + Intergenic
1057308462 9:93926225-93926247 CATGAATGACAGGCCCTGATGGG + Intergenic
1057430286 9:94987787-94987809 CATAGAGGGCAGGATCTGTGAGG + Intronic
1057497985 9:95575269-95575291 CACGGAGGCCAGTCCCTGAGGGG + Intergenic
1057806077 9:98220800-98220822 CAGGACTGGCAGGCCCTGAGGGG + Intronic
1058554747 9:106155026-106155048 CATAGAGAGCAGGCCAAGAGAGG - Intergenic
1058707534 9:107649856-107649878 CTTGGAGGGCAGGCCGGGGGAGG - Intergenic
1058837275 9:108869356-108869378 CCTGGAGGCCCCGCCCTGAGAGG + Intronic
1059099755 9:111458842-111458864 CATGTAGGGCAAGGCCTGAGAGG - Intronic
1059111078 9:111559098-111559120 CAGGGAGGTCAGAGCCTGAGGGG - Intronic
1060067212 9:120513200-120513222 CATGTAAGTCAGGCTCTGAGAGG - Intronic
1060374094 9:123103102-123103124 CATTGAGGGCAAGCCCTAAATGG - Exonic
1060596185 9:124850538-124850560 CCTGGAGGGCAGGCACGGCGCGG + Intergenic
1060881930 9:127123358-127123380 CATGGAAGGGATGCCCAGAGAGG - Intronic
1061042474 9:128148197-128148219 CAGGCAGGACAGGGCCTGAGGGG + Intergenic
1061216997 9:129227354-129227376 CATCGAGGGCAGTGCCTGAGAGG + Intergenic
1061244470 9:129394350-129394372 CATGCTGGGCAGGTCCTTAGGGG - Intergenic
1061965002 9:134008450-134008472 CCTGGAGGGCAAGGCCTGGGGGG - Intergenic
1062076446 9:134592594-134592616 CCTGGAGGCCAGGCCGGGAGGGG - Intergenic
1062091802 9:134682290-134682312 CCTGGAGGCCGGGTCCTGAGCGG + Intronic
1062283579 9:135763024-135763046 CAGGCAGAGCAGGCCCTGAGTGG + Intronic
1062357652 9:136172434-136172456 CATTGAGGGCTGGCACTGTGGGG + Intergenic
1062577171 9:137214194-137214216 CTTGGAGGGCAGGCTGTGGGAGG - Exonic
1062589478 9:137266918-137266940 CGAGGAGGGGAGGCCATGAGCGG - Intronic
1062621919 9:137426658-137426680 CCAGGAGGGCAGGCTCTGTGGGG + Intronic
1203608165 Un_KI270748v1:73737-73759 TATGGAGGCCAAGGCCTGAGTGG - Intergenic
1185622201 X:1457028-1457050 CATGGAGGGACGACCCTGTGAGG + Intergenic
1187389644 X:18877582-18877604 CATGGAGCGCAGTTGCTGAGGGG - Intergenic
1189155525 X:38752565-38752587 GATGGAGAGCAGGCTTTGAGTGG + Intergenic
1190341975 X:49304015-49304037 CATGGAGGGGAGGCGGTCAGGGG + Intronic
1190496455 X:51032167-51032189 CAGGGAGTGCAGGCCCTGCCTGG - Intergenic
1190509518 X:51161768-51161790 CAGGGAGTGCAGGCCCTGCCTGG + Intergenic
1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG + Intergenic
1191619512 X:63201261-63201283 TCTGGAGAGCAGGCCTTGAGTGG - Intergenic
1192260943 X:69505524-69505546 CATGGGGGGCCGGCCGGGAGCGG + Exonic
1192565644 X:72161186-72161208 AATGGAGGGAAGTGCCTGAGAGG - Intergenic
1192577168 X:72252357-72252379 CCTGGAGGCCAGGCACTAAGTGG - Intronic
1192589999 X:72351700-72351722 CAAGGAGGGCAGGCCTCGAGGGG + Intronic
1195107620 X:101616350-101616372 CACTGAGGACAGGCCCTCAGGGG - Exonic
1195664959 X:107420754-107420776 CAGGGAGGGTAAGCCCTGAACGG - Intergenic
1197715446 X:129703010-129703032 CAAGGAGGTCAGGCTCTGAGGGG - Intergenic
1197716089 X:129706961-129706983 CATGGAGAATAGGCCCTGAGAGG - Intergenic
1197752244 X:129973188-129973210 CATGGTGGGCAGGACTTGAGGGG + Intergenic
1199581772 X:149367660-149367682 CATGGAGGGCAGTCCATAATGGG + Intergenic
1200071265 X:153530632-153530654 CCTGCAGGGCAGCCCCGGAGGGG - Intronic
1200123185 X:153800811-153800833 CATGGGGGTGAGGCCCTGAGGGG + Intergenic
1200789210 Y:7284792-7284814 AATGGAGGGATGGCCCTGTGAGG - Intergenic