ID: 1101745358

View in Genome Browser
Species Human (GRCh38)
Location 12:107537641-107537663
Sequence GTTGACACTCACTGTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101745358_1101745361 -7 Left 1101745358 12:107537641-107537663 CCCAGAGGACAGTGAGTGTCAAC 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1101745361 12:107537657-107537679 TGTCAACATGGCTCAGTTACTGG 0: 1
1: 0
2: 1
3: 9
4: 137
1101745358_1101745366 26 Left 1101745358 12:107537641-107537663 CCCAGAGGACAGTGAGTGTCAAC 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1101745366 12:107537690-107537712 CCCTTCAAACTACTTCTCTTTGG 0: 1
1: 0
2: 1
3: 13
4: 193
1101745358_1101745362 -6 Left 1101745358 12:107537641-107537663 CCCAGAGGACAGTGAGTGTCAAC 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1101745362 12:107537658-107537680 GTCAACATGGCTCAGTTACTGGG 0: 1
1: 0
2: 0
3: 13
4: 101
1101745358_1101745368 27 Left 1101745358 12:107537641-107537663 CCCAGAGGACAGTGAGTGTCAAC 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1101745368 12:107537691-107537713 CCTTCAAACTACTTCTCTTTGGG 0: 1
1: 0
2: 4
3: 22
4: 178
1101745358_1101745369 28 Left 1101745358 12:107537641-107537663 CCCAGAGGACAGTGAGTGTCAAC 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1101745369 12:107537692-107537714 CTTCAAACTACTTCTCTTTGGGG 0: 1
1: 0
2: 1
3: 30
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101745358 Original CRISPR GTTGACACTCACTGTCCTCT GGG (reversed) Intronic
900906873 1:5565382-5565404 GGTGACACTCACCCTGCTCTGGG + Intergenic
906158459 1:43628665-43628687 GTTAACAGTGACTCTCCTCTAGG - Intergenic
906943979 1:50279896-50279918 TTTGACCCTCACTCTCCTTTAGG + Intergenic
907363229 1:53938159-53938181 GTTGACCCTCACAGTAATCTTGG - Intronic
908797260 1:67843295-67843317 GATGAAACTCCCTGTCCTCATGG + Intergenic
909490464 1:76220677-76220699 GTTAACACTCACTCTCCTTCAGG - Intronic
912858304 1:113191495-113191517 GTTCTGACTCACTGTTCTCTAGG - Intergenic
916096625 1:161357246-161357268 GTTGTGACTCAGAGTCCTCTTGG + Intronic
916813270 1:168325207-168325229 GTTGACACTGAATGTTATCTGGG + Intergenic
918543454 1:185656857-185656879 GTTGAACCACACTGACCTCTGGG - Intergenic
919740046 1:200975773-200975795 GGTGACAGCCACTGCCCTCTGGG + Intronic
924385394 1:243494983-243495005 GGTGACACTGTCTGTCCTTTGGG + Intronic
924606079 1:245536774-245536796 GTTGATACTGGCTGTCTTCTGGG + Intronic
924738472 1:246780283-246780305 GGAGACACTCACTGTCCTGTTGG + Intergenic
1063587527 10:7366069-7366091 GTTGACACTGTCTGTGCTCATGG - Intronic
1064852266 10:19722102-19722124 GTTGATTCTTACTGTCTTCTAGG + Intronic
1065317592 10:24479390-24479412 ATTCAAACTGACTGTCCTCTAGG - Intronic
1065699455 10:28410731-28410753 GTTGACATTCACTGATTTCTAGG - Intergenic
1067280028 10:44864296-44864318 CCTGACACTCGCTGGCCTCTGGG + Intergenic
1069959699 10:72072548-72072570 CTTGTCCCTCTCTGTCCTCTAGG - Exonic
1070521993 10:77261990-77262012 GTTGCCACTCACTGTCACCAAGG + Intronic
1071948520 10:90676141-90676163 CTTGACATTGACTGTCCTCATGG - Intergenic
1073502923 10:103958091-103958113 GTTGACATTGACTGTCAGCTGGG + Intergenic
1073959905 10:108913476-108913498 GTTGACACTGGCTGTCAGCTGGG - Intergenic
1076650743 10:131985523-131985545 GGTGAATCTCACTGTCCTCTGGG + Intergenic
1077532847 11:3105378-3105400 GTCCACACACACTGTCCACTGGG - Intronic
1079510647 11:21205996-21206018 TTGGGCCCTCACTGTCCTCTCGG + Intronic
1079547208 11:21647046-21647068 TGTGAGACTCAATGTCCTCTAGG + Intergenic
1080376464 11:31718604-31718626 GTTGATGCTGACTGTCCACTGGG + Intronic
1080893707 11:36431540-36431562 GTTGACACCCAGTGTCCTAGAGG - Intronic
1081990670 11:47335865-47335887 GGGGACACTCACAGCCCTCTGGG + Exonic
1082677991 11:56132690-56132712 GTTGACAATGACTTTCCTCAGGG + Intergenic
1084376835 11:68783445-68783467 CTGGACACCCACTGTCCTCCTGG + Intronic
1085529526 11:77183260-77183282 GTGGACACTGTCTGTCCTCAGGG + Intronic
1088879271 11:113960805-113960827 GTTGCCACTGATTGTCCTCCTGG - Intergenic
1089388482 11:118083753-118083775 GTTAACAATTACTGTACTCTTGG + Intronic
1090157879 11:124460553-124460575 TTTGACAGTCATTCTCCTCTGGG - Intergenic
1090387607 11:126365826-126365848 ACACACACTCACTGTCCTCTGGG - Intronic
1090390172 11:126383024-126383046 ACACACACTCACTGTCCTCTGGG - Intronic
1092958362 12:13571326-13571348 GTTAACATACTCTGTCCTCTAGG - Intronic
1094509946 12:31090125-31090147 CTTGACTCTCACTGTGGTCTAGG + Intronic
1094853503 12:34392776-34392798 AGGGACACTCAGTGTCCTCTGGG - Intergenic
1095198942 12:39359430-39359452 GTTGATAATCCCTGTCCTTTAGG - Intronic
1095285661 12:40407460-40407482 CTTGACCCTGACTGTGCTCTTGG - Intronic
1096755858 12:53799006-53799028 TTTGACACTCACTCTCCTTCTGG + Intergenic
1100393922 12:94168382-94168404 GTCGACACTCTCTCTGCTCTGGG + Intronic
1101745358 12:107537641-107537663 GTTGACACTCACTGTCCTCTGGG - Intronic
1102935997 12:116897576-116897598 TTTGACATGCACTGTCCTCCAGG + Intergenic
1103318596 12:120076979-120077001 GATGGCTCTGACTGTCCTCTTGG - Intronic
1104545011 12:129702877-129702899 GATGTTATTCACTGTCCTCTTGG + Intronic
1106287736 13:28332407-28332429 GCTGCCACACATTGTCCTCTAGG - Intronic
1107296555 13:38915003-38915025 GGTAGCACTCACTGTCTTCTGGG + Intergenic
1107864025 13:44686189-44686211 GTGAAAACTCACTGACCTCTGGG + Intergenic
1113563769 13:111305014-111305036 GGCGACATTAACTGTCCTCTCGG + Intronic
1117059968 14:51952080-51952102 GTTGAGAACCACTGTCCTATGGG + Intronic
1118706649 14:68486365-68486387 ATTGCCACTGGCTGTCCTCTGGG + Intronic
1121880017 14:97491608-97491630 ATTGACTCTCACTGCACTCTGGG - Intergenic
1125317849 15:38451640-38451662 GTTGACATTAACAGTGCTCTTGG + Intergenic
1126314733 15:47357795-47357817 GTTAACACTCAGTGTCAACTTGG - Intronic
1128637673 15:69313703-69313725 GCTGACACTCAACCTCCTCTCGG - Intronic
1129739404 15:77982733-77982755 GTTGACACTCAGTGTCCTCAGGG + Intergenic
1129846505 15:78770354-78770376 GTTGACACTCAGTATCCTCAGGG - Intronic
1130255415 15:82323597-82323619 GTTGACACTCAGTATCCTCAGGG + Intergenic
1130599552 15:85266389-85266411 GTTGACACTCAGTATCCTCAGGG - Intergenic
1131302313 15:91210396-91210418 GTGGAAATTCCCTGTCCTCTAGG - Intronic
1141147856 16:81544175-81544197 GTTCACACTCACTGTGCACTAGG - Intronic
1145034549 17:19532194-19532216 GTTGACACTCTCAGTTCTTTTGG + Intronic
1147654431 17:42080761-42080783 GTTGACACAGCCTGTCCTCAGGG - Intergenic
1148149689 17:45389304-45389326 GCTGACCCTCCCTGTCCTTTGGG - Intergenic
1149539938 17:57461211-57461233 GTTGTCACCCACTCTTCTCTGGG + Intronic
1153357850 18:4157637-4157659 CTTGATGCTCACTGTCCTATTGG - Intronic
1153571557 18:6478271-6478293 GCTGGCACTCAATGTCCACTTGG + Intergenic
1153915664 18:9742063-9742085 GTTGACTGTCACTGTTGTCTTGG + Intronic
1155270421 18:24136558-24136580 ATTGACAACCACTGGCCTCTGGG - Intergenic
1155540478 18:26863796-26863818 GGTGAGACACACTGTCCTATAGG - Intronic
1156156702 18:34311675-34311697 CTTTCCACTCACTTTCCTCTTGG + Intergenic
1159361224 18:67405876-67405898 CTTGACACTTACTAGCCTCTTGG - Intergenic
1161280624 19:3443700-3443722 GATGTCACCCAGTGTCCTCTGGG - Intronic
1164161070 19:22625591-22625613 GTTCACCCTCCCTGTCCACTAGG - Intergenic
1166811187 19:45515485-45515507 GTTGACAGTTACTGAGCTCTCGG + Intronic
926539269 2:14154542-14154564 CTTGACAGACACTGTGCTCTTGG + Intergenic
927182997 2:20460431-20460453 ATTGACCCCCACTGTCTTCTGGG - Intergenic
927842504 2:26454617-26454639 CATGACAATCACTGTGCTCTTGG + Intronic
929199342 2:39218759-39218781 TTTGAAACTCTCTGTCCTCTGGG + Intronic
931075770 2:58709960-58709982 TTGGACACTGACTGTCTTCTTGG + Intergenic
932033302 2:68212835-68212857 GGTGGCACTGACTCTCCTCTTGG - Intronic
932878429 2:75476652-75476674 GTTGACACTAATTCTTCTCTAGG - Intronic
934930823 2:98421330-98421352 GTTGACGCTCACTCTGCTCAAGG - Intergenic
935777085 2:106483213-106483235 GTTGATGCTCACTTTCCACTTGG - Intergenic
937623993 2:124023812-124023834 GTTGACATTCACCATCTTCTGGG + Intergenic
938403046 2:131009827-131009849 GTTTACACTGACTTTTCTCTTGG + Intronic
939045342 2:137243423-137243445 GATGAGACTCACTGAACTCTGGG - Intronic
946490693 2:220146301-220146323 GTAGACTCTCATTTTCCTCTGGG - Intergenic
948741247 2:240047512-240047534 GGGGACACTCACTGTCCTGAGGG + Intergenic
1170163108 20:13336150-13336172 GTTGAAACTCATTCTCCTTTGGG - Intergenic
1170528683 20:17267295-17267317 GTTTACACCCGCTGACCTCTTGG - Intronic
1175791000 20:61739663-61739685 GCTGTCACTCACCCTCCTCTAGG - Intronic
1176031619 20:63015685-63015707 GCTCCCACTCACTGCCCTCTGGG + Intergenic
1180870557 22:19144404-19144426 GTTGACACTCCGTCTCCTCGTGG - Intronic
1181593282 22:23897345-23897367 GGTGACCCTCACTCTCCTCAGGG + Intronic
1181688321 22:24544068-24544090 CTTCACACTCACTGTGCTGTGGG + Exonic
1183027702 22:35078340-35078362 GATGACATTCACTGAGCTCTTGG + Intronic
1184177304 22:42795715-42795737 TTTGACACTCAGTGTCCTCAGGG - Intergenic
1185417046 22:50716047-50716069 GCTGCCACTCCCTGTCCACTGGG + Intergenic
1185417073 22:50716129-50716151 GCTGCCACTCCCTGTCCACTGGG + Intergenic
950112783 3:10430758-10430780 CTGGACACTCAGTGGCCTCTTGG - Intronic
950113151 3:10433322-10433344 CTGGACACTCAGTGGCCTCTTGG + Intronic
950155582 3:10719184-10719206 GCTCACACACACTGTCCTCTAGG - Intergenic
951499883 3:23373307-23373329 TGAGACACTCACTGTCCTGTGGG + Intronic
952229855 3:31418626-31418648 TTTCTCACTCACAGTCCTCTGGG + Intergenic
954108645 3:48422319-48422341 CCTGGCACTCACTGTGCTCTGGG + Exonic
959868797 3:111302935-111302957 GTTAACACTCAGTGTCAACTTGG - Intronic
960670469 3:120150927-120150949 GTTGACACTGGCTGTTGTCTGGG + Intergenic
966954327 3:184858253-184858275 ATTGACACTCAAGGTCCTTTTGG + Intronic
974977002 4:68904436-68904458 GTTAACCCTCACTGTCCTGCAGG - Intergenic
975273777 4:72470160-72470182 GTTGATACTGGCTGTCCTGTGGG + Intronic
978862909 4:113471893-113471915 CTTGACACTTTTTGTCCTCTAGG + Intronic
979024760 4:115555171-115555193 GTCTTCACTCACTTTCCTCTTGG + Intergenic
979265645 4:118699047-118699069 CTTGAAACTCACTGTTCCCTTGG - Intronic
985241428 4:187934588-187934610 TTTGACAGTCACACTCCTCTAGG - Intergenic
990117905 5:52411882-52411904 ATTGAAACTCAGTGTGCTCTCGG + Intergenic
990531860 5:56682123-56682145 GTAGACACTCACTGACCTGCAGG - Intergenic
999954060 5:156681123-156681145 GGTGGCAGCCACTGTCCTCTCGG + Intronic
1002299103 5:178247602-178247624 GTGGCCACTCACTGGCCCCTGGG + Intronic
1003051434 6:2784268-2784290 CATGACACACACTGTCCTCCTGG - Intronic
1005962423 6:30703663-30703685 CTTGATAATCACTGTCTTCTGGG + Exonic
1007060666 6:38937617-38937639 CTTCACACCCACTGTCATCTTGG - Intronic
1010230311 6:73528778-73528800 GGTGAGACTCTCTGCCCTCTGGG - Intergenic
1011274080 6:85611651-85611673 CTGGACACTCACTGTCATCAAGG + Intronic
1012650039 6:101741135-101741157 GTTGACAACCAGTGTCCTCAGGG - Intronic
1013068713 6:106708775-106708797 GTAGACACTCACTCTGTTCTGGG + Intergenic
1018327854 6:162693150-162693172 GTTGCCAATGACTATCCTCTAGG + Intronic
1022577818 7:31515655-31515677 GTTGCCAATCCTTGTCCTCTGGG - Intronic
1025698469 7:63794257-63794279 GTTAGCACTCCCTGTCCCCTTGG + Intergenic
1026304779 7:69131345-69131367 GTTAACACTGACTGTCAGCTGGG + Intergenic
1028364134 7:90007289-90007311 GCTGACCCTCACTGTCTTCATGG + Intergenic
1033636564 7:143217570-143217592 GTTGAGAATCACTGCCCTTTGGG - Intergenic
1035827983 8:2664900-2664922 GATGACACACACTGACCTCCCGG - Intergenic
1037933869 8:22901403-22901425 GATGACTCTCTCTGCCCTCTTGG + Intronic
1038641729 8:29334278-29334300 GTTGAAACTCACTGACCTATTGG + Exonic
1039861808 8:41465691-41465713 CTTGACACTCGCTGTTCCCTTGG + Intergenic
1044790299 8:95840157-95840179 GCTGACACTTACTTCCCTCTGGG + Intergenic
1045605988 8:103776663-103776685 GTTGACATTTGCTGTCCACTAGG + Intronic
1048149097 8:131876032-131876054 GTTGATACTGGCTGTCATCTGGG - Intergenic
1048479861 8:134779197-134779219 GTTGAGACTCACTGTCCTGCGGG - Intergenic
1049494850 8:142924858-142924880 CCTAACACTCACGGTCCTCTTGG - Intergenic
1051764282 9:20505219-20505241 GTTTAAAATCACTGTCATCTTGG - Intronic
1053080874 9:35175485-35175507 CTTGAAACTCGCTGTACTCTAGG - Intronic
1056052574 9:82784839-82784861 GTTGACACTGGGTGTTCTCTGGG + Intergenic
1056878534 9:90364437-90364459 GTTGACACTCCCTGTCCTTCAGG + Intergenic
1058454627 9:105127657-105127679 GTGAGCACTCACTGTCTTCTAGG + Intergenic
1059598715 9:115752375-115752397 GTTGAGAGTCACTGCCCTCCAGG + Intergenic
1060222946 9:121774002-121774024 AGGGTCACTCACTGTCCTCTTGG + Intronic
1061408436 9:130405373-130405395 GTTGGCATTAACCGTCCTCTGGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185718242 X:2360721-2360743 TTTGTCACTCACTGCTCTCTTGG + Intronic
1193185460 X:78507278-78507300 GTAGGCACTCCCTGTCCCCTGGG + Intergenic
1198782469 X:140252340-140252362 GTAGACAGTGACTGCCCTCTGGG + Intergenic