ID: 1101746714

View in Genome Browser
Species Human (GRCh38)
Location 12:107547204-107547226
Sequence GAGAAGAAGGAGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5666
Summary {0: 1, 1: 8, 2: 113, 3: 871, 4: 4673}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101746702_1101746714 29 Left 1101746702 12:107547152-107547174 CCACTGCACTCCAACCTGGGTCA 0: 17
1: 3669
2: 101382
3: 259533
4: 236828
Right 1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG 0: 1
1: 8
2: 113
3: 871
4: 4673
1101746703_1101746714 19 Left 1101746703 12:107547162-107547184 CCAACCTGGGTCACAAAGTAAGA 0: 1
1: 14
2: 727
3: 12972
4: 102629
Right 1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG 0: 1
1: 8
2: 113
3: 871
4: 4673
1101746704_1101746714 15 Left 1101746704 12:107547166-107547188 CCTGGGTCACAAAGTAAGACCCT 0: 3
1: 117
2: 2897
3: 24053
4: 85446
Right 1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG 0: 1
1: 8
2: 113
3: 871
4: 4673
1101746706_1101746714 -4 Left 1101746706 12:107547185-107547207 CCCTGTCTTGAAGAAGAAGGAGA 0: 1
1: 1
2: 7
3: 52
4: 557
Right 1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG 0: 1
1: 8
2: 113
3: 871
4: 4673
1101746707_1101746714 -5 Left 1101746707 12:107547186-107547208 CCTGTCTTGAAGAAGAAGGAGAA 0: 1
1: 1
2: 6
3: 57
4: 466
Right 1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG 0: 1
1: 8
2: 113
3: 871
4: 4673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101746714 Original CRISPR GAGAAGAAGGAGAAGGGGGA GGG Intronic
Too many off-targets to display for this crispr