ID: 1101755022

View in Genome Browser
Species Human (GRCh38)
Location 12:107614586-107614608
Sequence TCTGCTAGGTAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 331}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101755013_1101755022 2 Left 1101755013 12:107614561-107614583 CCTGTAGCTCCCAGAACCACCAC 0: 1
1: 0
2: 2
3: 20
4: 237
Right 1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG 0: 1
1: 0
2: 2
3: 34
4: 331
1101755015_1101755022 -8 Left 1101755015 12:107614571-107614593 CCAGAACCACCACCCTCTGCTAG 0: 1
1: 0
2: 2
3: 35
4: 400
Right 1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG 0: 1
1: 0
2: 2
3: 34
4: 331
1101755014_1101755022 -7 Left 1101755014 12:107614570-107614592 CCCAGAACCACCACCCTCTGCTA 0: 1
1: 0
2: 3
3: 26
4: 296
Right 1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG 0: 1
1: 0
2: 2
3: 34
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101755022 Original CRISPR TCTGCTAGGTAGAAGGAAGA AGG Intronic
902659592 1:17891881-17891903 TCTGCTGGGGAGCAGGAAAAGGG + Intergenic
903360576 1:22774431-22774453 GCTGCCAGGAAGAAGGAAGAAGG + Intronic
903957644 1:27036155-27036177 TCTGCCAGGGAGTAGGAAGAGGG - Intergenic
904491305 1:30861235-30861257 TCTGCTGGGAAGAAGGACCAAGG + Intergenic
905913529 1:41670010-41670032 TCTGCTAGCTATGAGGAAGAAGG - Intronic
906313106 1:44767951-44767973 ACTCTTAAGTAGAAGGAAGATGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907699083 1:56765785-56765807 TCTGAAAGGTAGAGAGAAGAAGG - Intronic
908324251 1:63007647-63007669 TCTGCCAGGAGGGAGGAAGAAGG + Intergenic
908755597 1:67466438-67466460 TGTGCTGTGTAGAAGGAAGATGG + Intergenic
909743663 1:79065565-79065587 TCAGCTGGGTAAAAGGATGAAGG - Intergenic
909750238 1:79150502-79150524 TTTACTAGTAAGAAGGAAGAAGG - Intergenic
910162305 1:84286889-84286911 TCATCTAGGCAGAAGGAAAAAGG + Intergenic
910173531 1:84403515-84403537 TCAGCTGAGCAGAAGGAAGAAGG + Intronic
910386757 1:86692563-86692585 TAGGCCAGGAAGAAGGAAGAAGG + Intergenic
910426351 1:87123170-87123192 GATTCTAGGTAGAAGGAACATGG + Intronic
911199698 1:95032241-95032263 TCAGCTAGGTGATAGGAAGATGG - Intronic
913424813 1:118716164-118716186 ACTGCTAGATAGAAGGAATAAGG + Intergenic
913575944 1:120175174-120175196 ACTGCTAAGGAGAAGGAAGAGGG - Intronic
914558258 1:148790745-148790767 ACTGCTAAGGAGAAGGAAGAGGG - Intergenic
914614577 1:149339485-149339507 ACTGCTAAGGAGAAGGAAGAGGG + Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
914708108 1:150188097-150188119 TGTGGTAGGGAAAAGGAAGAAGG + Intergenic
915326323 1:155082817-155082839 ACTGCTAGGGAGAAGGAGGGAGG + Intronic
915562822 1:156697381-156697403 CCTGCTAGGTACTAGGAACACGG - Intergenic
916335528 1:163666792-163666814 GCAGCCAGGTAGAAGGAGGAAGG - Intergenic
916921846 1:169477286-169477308 TCTGGCAGGTAGAAGGAATGTGG + Exonic
917081383 1:171259898-171259920 GCTGTCAGGTAGATGGAAGAAGG + Intronic
917474278 1:175354842-175354864 TCTGCTTGATAGAAGTAAGGAGG - Intronic
917812060 1:178668615-178668637 TCTGCAAGATAGAAGTAACAAGG + Intergenic
917844061 1:179005829-179005851 TCTGCCATGTATAAGGAAGAAGG + Intergenic
919574301 1:199287832-199287854 TCTGCCAGCTGTAAGGAAGAAGG - Intergenic
921350328 1:214228050-214228072 ACAGATAGGGAGAAGGAAGAAGG + Intergenic
922205300 1:223441197-223441219 TCTGTTAGGGAGAAGAAACAAGG + Intergenic
923135066 1:231110216-231110238 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
923173486 1:231439829-231439851 TCTGCCAGCAAGAAAGAAGAGGG - Intergenic
923717514 1:236437572-236437594 TGTGGCAGGGAGAAGGAAGAGGG + Intronic
924206045 1:241712409-241712431 TCTGCTAAGAGGAAGGAAAAAGG + Intronic
1064723628 10:18255279-18255301 TCTACGTGGTAGAAGGGAGAAGG - Intronic
1065582404 10:27184878-27184900 TTTACTAGGTAGAAGGAAATAGG + Intronic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070613408 10:77950128-77950150 TCTGCTAAGGGGAAGGGAGAGGG - Intergenic
1072262688 10:93696140-93696162 TCTAAAAGGTGGAAGGAAGAAGG + Intronic
1072457260 10:95587786-95587808 TCTGAAAGGTAGGAGGAAGAGGG + Intergenic
1073514813 10:104066812-104066834 TCTGCTGTTTAGAAGGAATAGGG - Intronic
1074253511 10:111777450-111777472 TCAGCTAGATAGAGGGAACAAGG - Intergenic
1074384141 10:113003856-113003878 TGTGCTTGGTGGAAGGAAGCTGG + Intronic
1074837747 10:117314917-117314939 CGTGGTAGGTTGAAGGAAGATGG + Intronic
1074950513 10:118329747-118329769 TCTTCTATGTAGAAGGAACTGGG - Intronic
1075714032 10:124545581-124545603 GCTCCCAGGTAGCAGGAAGAAGG + Intronic
1077959229 11:7055708-7055730 TATTCTAGGTAGATGGAACATGG + Intronic
1078142880 11:8704340-8704362 TCTTCTAGGCAAAAGGAAGTAGG + Intronic
1078169489 11:8918391-8918413 TCTGCAAGGTAGGAGGAAGAGGG + Intronic
1078450906 11:11440170-11440192 TCTGCTATGTAAAATGTAGACGG + Intronic
1078541559 11:12217508-12217530 TCTGTGAGGCAGAGGGAAGAAGG - Intronic
1078622827 11:12924807-12924829 TCTGCTTGGCTGAATGAAGAGGG - Intronic
1081576707 11:44323168-44323190 GCTGCTGGGGAGAAGGGAGAAGG - Intergenic
1081625330 11:44652011-44652033 TTTGCAAGGAAGAAGGAAGGGGG + Intergenic
1085503839 11:77044439-77044461 TCTGAGAGGTTGAAGGAAGCAGG + Intergenic
1086244849 11:84740257-84740279 TCTGCTTGGAAGGAGGGAGATGG - Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086513237 11:87583565-87583587 TGTGCAAGGGAGAAGGAGGAAGG - Intergenic
1087370647 11:97279642-97279664 TCTCCTAAGCATAAGGAAGAAGG - Intergenic
1088117118 11:106325094-106325116 TCTGCTCAGTAAAAGGAGGATGG - Intergenic
1088277358 11:108101884-108101906 TCAGAGAGGAAGAAGGAAGAAGG - Intronic
1088725206 11:112628511-112628533 TCTGCTGGGGACAAGAAAGAAGG - Intergenic
1089120617 11:116132075-116132097 TGTGCTATGGAGAAAGAAGAAGG + Intergenic
1089120829 11:116133453-116133475 TGTGCTACGGAGAAAGAAGAAGG + Intergenic
1091005182 11:131946767-131946789 TCTTCTAGGTAAAAGAAACAAGG - Intronic
1091613559 12:2032072-2032094 GCTGCAAGGTAGAGGGAGGAGGG + Intronic
1091616928 12:2056492-2056514 TCTGCTAGAGACAAGGCAGAGGG + Intronic
1092279172 12:7086616-7086638 TGGGCTGGGGAGAAGGAAGAAGG - Intronic
1092578165 12:9812615-9812637 TCTGATAGATAGCAGGATGAGGG - Intergenic
1093673928 12:21911779-21911801 TATGCAAGGGAGAAGGATGATGG + Intronic
1095295953 12:40527733-40527755 GCTGTGAGGTAGAAAGAAGAGGG - Intronic
1095985308 12:47995403-47995425 TCTTCTATGAAGAAGAAAGATGG + Intronic
1096135747 12:49198968-49198990 TCTGCTTTGGAGAAGGAAGGGGG - Intronic
1096789905 12:54038168-54038190 GCTGCTGGGAAGTAGGAAGATGG + Intronic
1097419988 12:59364927-59364949 TCTTCTAGGGAGAATGAAGGGGG + Intergenic
1097533748 12:60839108-60839130 TCTGCATGGCAGAAGGCAGAAGG + Intergenic
1098116793 12:67187288-67187310 TCTGCTAGCAAGAAAGGAGAGGG + Intergenic
1098455957 12:70672973-70672995 TCTTCTAGGTAGAAGGGAGAAGG + Intronic
1099248744 12:80225980-80226002 TCTGCTAGGGTGGAGGATGAAGG - Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101409668 12:104457841-104457863 TCTGCGAGGTAGCAGGGAAACGG + Intronic
1101730640 12:107424396-107424418 TCTCCAAGGGAGAAGGAATATGG - Intronic
1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG + Intronic
1101797255 12:107986579-107986601 TCTGCTAGTAATAAGAAAGAGGG + Intergenic
1102223203 12:111208772-111208794 TCTGCTTGTTGGAATGAAGAAGG - Intronic
1103215219 12:119196582-119196604 TCTGCTAGGAAGGAGGAAAGAGG + Intronic
1104056588 12:125235380-125235402 TCAGCCAGCTGGAAGGAAGAGGG - Intronic
1105561433 13:21495832-21495854 TCTCCTAAAAAGAAGGAAGAAGG - Intronic
1106576342 13:30979108-30979130 AATCCTGGGTAGAAGGAAGAGGG - Intergenic
1106923268 13:34587880-34587902 GCTGCTAGGTAAAAGGAAGTAGG - Intergenic
1107258998 13:38468119-38468141 TCTGAAAGGTAGAGAGAAGATGG - Intergenic
1107326691 13:39251291-39251313 TCTGTTATGTAGAAGGAAAATGG - Intergenic
1107953741 13:45488669-45488691 CCTGCTACGTAGAATGAATAAGG - Intronic
1108074741 13:46668126-46668148 TTTGCTTGGTAGCAGGAAAAAGG + Intronic
1108454528 13:50599575-50599597 TCTGCAAGAGAGAAGGAGGAAGG - Intronic
1109156228 13:58913465-58913487 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1109700503 13:66018739-66018761 ACTGCTATGAACAAGGAAGAAGG - Intergenic
1109811916 13:67524592-67524614 TCTCCCAGGTATAAGGAAAAAGG - Intergenic
1110408919 13:75183061-75183083 TCTGAAAGGTAGTAAGAAGAAGG + Intergenic
1110749728 13:79098665-79098687 TCTGTTAGCAAGAAAGAAGAGGG + Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1111424076 13:88056599-88056621 TCTGGAAGATAGAAGGCAGATGG - Intergenic
1112036736 13:95503817-95503839 GCTGCTAGGGAGAAGGGGGAGGG + Intronic
1112214170 13:97413002-97413024 TCTTCTAGGCAGAAGGAACATGG - Intergenic
1113119017 13:106906535-106906557 TCTGTGAGGTAGACGGAAAATGG + Intergenic
1116478318 14:45367030-45367052 TCTTCAAGGGAGAAGGGAGAAGG - Intergenic
1117014114 14:51501034-51501056 TATGCTAGGAAGGAGGAACAGGG - Intronic
1117953620 14:61106363-61106385 TCTTCTGGGTAGTAGCAAGATGG + Intergenic
1118113665 14:62750685-62750707 GCTGCTATCTAGAAGGAACAGGG - Intronic
1119381348 14:74230995-74231017 TCTTCTAGGATGAAGGAAGCTGG + Intergenic
1120154605 14:81079396-81079418 TCTGCTATGTCAAATGAAGATGG + Intronic
1120242663 14:81967208-81967230 TCTTCAAGGGAGAAGGATGAGGG - Intergenic
1120435028 14:84470720-84470742 ACTGCTGGGTACGAGGAAGATGG - Intergenic
1121823488 14:96990928-96990950 TCTGCTGGGGAGAAAGAAAATGG + Intergenic
1122448826 14:101787350-101787372 TTTGCCAGGTGGAAGGAGGAAGG + Intronic
1123839876 15:24237609-24237631 ACTGCTAGGTAGAGGGTAAATGG + Intergenic
1126579943 15:50233431-50233453 GCTGCTAGAAAGAAGGATGATGG + Intronic
1126897209 15:53271872-53271894 TTTGCTAGGTTGATGGTAGAGGG + Intergenic
1127720959 15:61698856-61698878 TCTGCTAGTGAGAAGGATCATGG + Intergenic
1128001356 15:64195667-64195689 TTTGCCAGGTAGAAGCAAGCAGG + Intronic
1128704827 15:69831376-69831398 TCTTCCAGGGAGAAGGCAGAGGG - Intergenic
1129201403 15:74003577-74003599 TCTGAAAGTGAGAAGGAAGAGGG - Intronic
1131750872 15:95506911-95506933 TTTGATAGATAGTAGGAAGATGG - Intergenic
1132002969 15:98198417-98198439 TCTGTTAAGTAGAAGAGAGAGGG - Intergenic
1132134477 15:99321773-99321795 TCTGCTAGGTGCTAGGAATATGG + Intronic
1132708386 16:1256059-1256081 CCCGCTGGGTAGAAGGAACAGGG + Intronic
1132781096 16:1626071-1626093 TCTGGTGGCGAGAAGGAAGAAGG + Exonic
1133436807 16:5786837-5786859 TCTGAAAGGTAGAATGAAGCCGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1139287492 16:65828638-65828660 TGTGCTGGGCAGTAGGAAGATGG - Intergenic
1141987011 16:87586646-87586668 TCTGCCAGGAGGAAGGAGGATGG + Intergenic
1143846719 17:9777727-9777749 TATGGAAGGAAGAAGGAAGAAGG + Intronic
1144315525 17:14057281-14057303 TCATCTAGGGAGAAAGAAGAAGG - Intergenic
1146017051 17:29242170-29242192 TGTGCCAGGAAGAAAGAAGATGG + Intergenic
1146623695 17:34419873-34419895 TTAGCCAGGTAGAAAGAAGAGGG - Intergenic
1147639619 17:41987787-41987809 TCTGATGGGTAGGGGGAAGAGGG - Intronic
1148159124 17:45440082-45440104 TCAGCAAGGAAGATGGAAGAGGG - Intronic
1151271374 17:72998847-72998869 TCTGAGAGGTGGAAGGGAGATGG + Intronic
1155512936 18:26595517-26595539 TCTGCCAGCAAGAAGGAGGAAGG - Intronic
1155988759 18:32257579-32257601 TCTCCTAGGCAGATGGAGGAAGG - Intronic
1156544731 18:37953257-37953279 TCTCCTAGGTGGAAGAAAGATGG - Intergenic
1157015955 18:43713052-43713074 TCTTCAAGGAAGAAGGAAGAAGG + Intergenic
1157105005 18:44765824-44765846 TGTCATAGGTAGTAGGAAGAGGG - Intronic
1158740673 18:60138786-60138808 TCTACGAGGTTGGAGGAAGAGGG + Intergenic
1159842611 18:73417022-73417044 TCTGAAAGGTAGAAACAAGAAGG + Intergenic
1160367811 18:78343771-78343793 TTGGGTAGGTAAAAGGAAGAAGG - Intergenic
1160858419 19:1227571-1227593 GCTGCAGGGTGGAAGGAAGACGG - Exonic
1161040780 19:2109810-2109832 TCTGCAAGGTAGAGGGGAGGCGG + Intronic
1165320801 19:35084059-35084081 TGTTCTAGGGAGAAGGAACAAGG + Intergenic
924960145 2:27381-27403 TCTGTTAGGCAGAAGAAAGGTGG - Intergenic
926394839 2:12430348-12430370 TGTGTCAGTTAGAAGGAAGAAGG + Intergenic
926581013 2:14633000-14633022 TGTGCTGGGTAGGAGGGAGAGGG + Intronic
926936102 2:18087819-18087841 TCTGCTGTTTAGAAGGAATAGGG + Intronic
927095276 2:19743625-19743647 TCTGCTCTGTAGAATGGAGATGG - Intergenic
927458992 2:23281421-23281443 TCTCCTAGCCTGAAGGAAGAGGG - Intergenic
927945146 2:27131136-27131158 TCTGGTAGGCAGAAGAAAGGAGG + Exonic
928174828 2:29026517-29026539 TTTTCTAGGTGGAGGGAAGATGG + Intronic
928854274 2:35785368-35785390 AATGCAAGTTAGAAGGAAGAAGG - Intergenic
929961900 2:46503249-46503271 TCTGGAAGGTAGAAGGAGGCAGG + Intronic
931017067 2:57994560-57994582 TCAGCTAGGCATAAGGAATATGG + Intronic
931108428 2:59083468-59083490 CCTGCAAGGTAAAGGGAAGATGG - Intergenic
931553801 2:63477498-63477520 TCTGGGAGGTAGAAGGAAAATGG + Intronic
933177786 2:79195342-79195364 GCTGCTACCCAGAAGGAAGAAGG - Intronic
934577643 2:95413069-95413091 TCTTCTCGGTAGAAGGGAGAAGG + Exonic
934639934 2:96021772-96021794 TCTTCTCGGTAGAAGGGAGAAGG + Intergenic
934793712 2:97083623-97083645 TCTTCTCGGTAGAAGGGAGAAGG - Exonic
935095631 2:99941708-99941730 CCTGATAGGAAGGAGGAAGAAGG - Intronic
935438998 2:103069415-103069437 TCTGGAAGGTGGAAGGAAGGAGG - Intergenic
935938261 2:108209825-108209847 AGTGCCAGGAAGAAGGAAGAAGG - Intergenic
937768055 2:125685021-125685043 TCTAAAAGGTAGAAAGAAGAAGG + Intergenic
938859787 2:135356180-135356202 TCAGTTAGATAGAAGGAATAAGG + Intronic
938942135 2:136178630-136178652 TCTTCAAGGGAGAAGGGAGAGGG + Intergenic
939557172 2:143689854-143689876 TATTGTAGGTAGAAGGCAGAAGG - Intronic
940692013 2:156930079-156930101 TCTTCTAGGCAGGAAGAAGAGGG - Intergenic
940840281 2:158571917-158571939 TCTGAAAGCCAGAAGGAAGATGG + Intronic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
940950594 2:159668677-159668699 TAAACTAAGTAGAAGGAAGAAGG - Intergenic
942062960 2:172244742-172244764 ACTGCCAAGTTGAAGGAAGAGGG - Intergenic
942064714 2:172259864-172259886 TCTGAAAGGTAAAAGGCAGAAGG + Intergenic
942066816 2:172279342-172279364 TGTGCTAGGTAGAATGGAGGTGG + Intergenic
943272745 2:185828339-185828361 TCAGCTAGGAAGAGGGAACAGGG - Intronic
943822565 2:192345169-192345191 TCTGCTTGATGGAAGCAAGAGGG + Intergenic
944504629 2:200397968-200397990 TCTGATAGCTTGAAAGAAGAGGG + Intronic
945754797 2:213832556-213832578 TCTTCAAGGAAGAAGGGAGAAGG - Intronic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
946700471 2:222407714-222407736 TCAGCTAGACAGAAGGAATATGG - Intergenic
946959816 2:224972368-224972390 TCTGTTAGGTGGAAAGAATATGG - Intronic
947441714 2:230127784-230127806 TCTTCTTGGTAAAAGGAAAAAGG + Intergenic
1169448386 20:5691018-5691040 TCTGCTAGGGAAAGTGAAGAAGG + Intergenic
1169789158 20:9391603-9391625 TCTGCAAGTTCGAGGGAAGAAGG - Intronic
1169791183 20:9412435-9412457 TCTGCTTGATAAAATGAAGACGG + Intronic
1170485152 20:16807980-16808002 TCTGAGAGGAAGAGGGAAGAAGG + Intergenic
1170698947 20:18685858-18685880 ACTGCAGGGGAGAAGGAAGAGGG - Intronic
1171140461 20:22736452-22736474 TCTGCAAGCCAGAAGGAAGTGGG + Intergenic
1171360831 20:24585264-24585286 TCTGCTGGGTAGAAGGCACATGG + Intronic
1171386217 20:24770876-24770898 TCTGCCATGGAGAAGGAAGGGGG - Intergenic
1172057863 20:32166583-32166605 ACTGCTTGTGAGAAGGAAGATGG + Exonic
1173671616 20:44803060-44803082 TCTGCTAAGTGGAATGAAAATGG - Intronic
1173756288 20:45519303-45519325 TCTCTTTTGTAGAAGGAAGAAGG + Intergenic
1174413016 20:50348272-50348294 TCTGTTAGGAAGGAGGAAGTGGG - Intergenic
1175244284 20:57572286-57572308 GCTGCTAGGGAGAGGGGAGAAGG - Intergenic
1178054054 21:28779504-28779526 TCAGTTAGGCAGAAGGAATAAGG + Intergenic
1180262191 21:46679555-46679577 TCTGTTAGGAAGAAGAAAGGTGG + Intergenic
1181339332 22:22165762-22165784 TCAGCCAGGGGGAAGGAAGAGGG + Intergenic
1182047322 22:27285478-27285500 ACAGCTAGATAGAAGGAAGCAGG + Intergenic
1183102982 22:35595124-35595146 TCTGCCAGGGAGGAGGAAGGGGG + Intergenic
1183834414 22:40440521-40440543 TCTGCCAGGTGAAAGGAGGAGGG + Intronic
1183998012 22:41650606-41650628 TCTTCTAAGGAGCAGGAAGATGG - Intronic
1184046971 22:41977685-41977707 TCTTCAGGGTGGAAGGAAGAGGG + Intronic
952445381 3:33376455-33376477 TCTGCTTAGTAGAAGGAATTTGG + Intronic
952556380 3:34535797-34535819 AATGCTAGGTAGAAGGTTGATGG - Intergenic
953827024 3:46262246-46262268 TCTGCTGGATAGCAGGAAAAAGG - Intronic
954167524 3:48772093-48772115 TCTGAAAGGTGGAAAGAAGAAGG - Intronic
954286742 3:49624853-49624875 TCTTCTGGGCAGGAGGAAGAGGG + Intronic
954800996 3:53186779-53186801 TTTTCTAGGGAGAGGGAAGAAGG - Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955117601 3:56021274-56021296 TCTAGGAGGCAGAAGGAAGAAGG + Intronic
957219496 3:77363745-77363767 TCTTCAAGGAAGAAGGGAGAAGG + Intronic
957262556 3:77920523-77920545 TCTGCTGGAGAGAAGGAAAATGG + Intergenic
958433139 3:94065387-94065409 CCTCCTAGGTTGAGGGAAGAAGG + Intronic
960853553 3:122079944-122079966 AATGCTAGCTGGAAGGAAGAGGG - Intronic
961085153 3:124060844-124060866 TCTGCTAGGTGGAAGGGGTAGGG + Intergenic
962300450 3:134237362-134237384 TGTGCAAGGTAATAGGAAGATGG - Intronic
965887078 3:173459068-173459090 TCTGTTAAGAAGAAAGAAGAGGG + Intronic
966674678 3:182572343-182572365 TGGGCTTGGTAGAAAGAAGATGG - Intergenic
967217269 3:187221031-187221053 TGTGCTGGGGAGAAGGAAGGTGG - Intronic
967301363 3:188017358-188017380 TCTGATAGGTAGAAAAGAGAAGG - Intergenic
968224291 3:196963710-196963732 TCTGTTAGGAAGGAGGAAGGAGG + Intronic
970007760 4:11427624-11427646 TCTGCAAAGGAGGAGGAAGAGGG + Intronic
970344869 4:15143726-15143748 TCTGCCAGGTAAACAGAAGAGGG - Intergenic
971810527 4:31419833-31419855 TCAGTTAGGTAGAAGGAATAAGG - Intergenic
972177283 4:36423335-36423357 AATGCTAGGAAGAAGCAAGAAGG - Intergenic
972725993 4:41746696-41746718 TCTAATTGGTAGAAGGAAAAGGG + Intronic
973641564 4:52908062-52908084 TGAGCTCTGTAGAAGGAAGAGGG - Intronic
974220195 4:58958963-58958985 TTTGCTAGGTAAAGGGAAGAGGG - Intergenic
976018535 4:80590824-80590846 TGTGCTAGGTAGGAGGAGGTTGG + Intronic
976266529 4:83190584-83190606 TCTCCAAGGAAGAAGGGAGAAGG + Intergenic
977179546 4:93857207-93857229 TCTGCTTGGCACAATGAAGATGG - Intergenic
978084813 4:104637905-104637927 TTTGCTGGGGAGAAAGAAGAGGG + Intergenic
978410634 4:108421000-108421022 AATGCTAGTTAGAAGGAATAAGG + Intergenic
979198884 4:117952842-117952864 TCTGTTAGATAGAAGGAGGGAGG - Intergenic
980964418 4:139507007-139507029 TCTGCGAGGCAGAAGTCAGAAGG + Exonic
982709331 4:158744467-158744489 TCTTCTAGGGAGAAGAGAGAAGG + Intergenic
983037497 4:162885708-162885730 TCTCCTTGGTAGAAGGGAGCAGG + Intergenic
983848963 4:172556249-172556271 TCTCCTACCTAGAAGGAAAAAGG - Intronic
984448864 4:179873393-179873415 CCAGCTAGTTTGAAGGAAGATGG - Intergenic
988094847 5:26592497-26592519 TCTGCTAGCCAGAATGAAAATGG - Intergenic
988518435 5:31924849-31924871 TCTACTAGGCAGAAGGAATAAGG - Intronic
988536156 5:32071015-32071037 TCTGCTCTGTAGATTGAAGAAGG + Intronic
988903282 5:35756776-35756798 TCTCCCAGGGAGAGGGAAGAAGG - Intronic
989458955 5:41674212-41674234 TCTGCTATGTCGAAGGAATTGGG - Intergenic
990088093 5:52003908-52003930 TCTTCAAGGGAGAAGAAAGAAGG - Intergenic
990202051 5:53386604-53386626 TGTGCTAGGTAAAAGGAACTGGG - Intergenic
990444664 5:55882922-55882944 TCTGCTATATGGAACGAAGATGG - Intronic
990527160 5:56639232-56639254 CCTTCTAGGTGGAAGGAAGGAGG - Intergenic
990530516 5:56669162-56669184 TGTCCTAGGTGCAAGGAAGAAGG - Intergenic
991362606 5:65836552-65836574 TCTGTTAGGAAGGAGGAAAAAGG - Intronic
994660581 5:102649044-102649066 TGTGCCAGATAGAAAGAAGAAGG + Intergenic
995145773 5:108785896-108785918 TCTGGAAGGTGGAAAGAAGAAGG - Intronic
999394591 5:151219258-151219280 CATGCTAGGCAGAAGGAATATGG - Intronic
1000514338 5:162221000-162221022 TCTGCTTTGCACAAGGAAGAAGG - Intergenic
1000997800 5:167976149-167976171 TTTGCTGGGTAGATGGATGAAGG - Intronic
1001120185 5:168973735-168973757 AGGGCTAGGTAGGAGGAAGAGGG - Intronic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001228217 5:169963740-169963762 GATGCTAGGGGGAAGGAAGAGGG - Intronic
1001696609 5:173674928-173674950 CCTGCTAGCCAGAAGGAAGGGGG - Intergenic
1006418869 6:33921093-33921115 TGTGCCAGGTAGAAGCAGGAAGG + Intergenic
1007616044 6:43180225-43180247 GTTGCTAGGGAGAGGGAAGAGGG + Exonic
1007827842 6:44614731-44614753 TCTACTAGTTAGAAGCAAGTCGG + Intergenic
1009416132 6:63418604-63418626 TCTGGGAGGTAGAAAGAAGGCGG + Intergenic
1009416216 6:63419185-63419207 TCTGGAAGGTAGAAATAAGAAGG - Intergenic
1009950299 6:70387548-70387570 TCGGCTAGAAAGAAGGGAGAAGG + Intergenic
1010253537 6:73733049-73733071 TCTGCAAGTTACAAGGAGGAAGG - Intronic
1010335889 6:74683201-74683223 GCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1012142037 6:95636508-95636530 GCTCCTGGGTAGAAGGAAGTGGG - Intergenic
1012212827 6:96544373-96544395 TTTGCTGGGGATAAGGAAGAGGG - Intronic
1013060656 6:106630455-106630477 TCTGCAAGATAGAATGAAGAGGG - Intronic
1013139073 6:107312736-107312758 TGTGGAGGGTAGAAGGAAGAAGG + Intronic
1013727702 6:113120052-113120074 TCTCATAGCTAGAAGGTAGAAGG - Intergenic
1014269393 6:119319868-119319890 TTTTCAAGGCAGAAGGAAGAGGG - Intronic
1016550199 6:145270991-145271013 TCTGCTATGTTGAAGATAGAAGG - Intergenic
1016903122 6:149121471-149121493 CCTGAAAGGTAGAAAGAAGAGGG + Intergenic
1017822691 6:158060686-158060708 GCTGCTAATTTGAAGGAAGAAGG + Intronic
1017857066 6:158359153-158359175 TTTTCTAGGTAAGAGGAAGAGGG - Intronic
1018112553 6:160549340-160549362 TGTGCTTGGCAGAAGGTAGAAGG - Intronic
1019611938 7:1941109-1941131 TCTGCTAAGTAGGAGGATGCTGG - Intronic
1020760272 7:12260798-12260820 TCAGCTAGGTAGAAGAAAAAAGG - Intergenic
1020775712 7:12451347-12451369 GCTCCTAGGTAGAAGGAACTTGG + Intergenic
1020940472 7:14527934-14527956 TCTGCTATATGGAAGTAAGATGG + Intronic
1021931680 7:25587079-25587101 TCTGCTAGGCACAGGGAATATGG - Intergenic
1022417613 7:30191454-30191476 TCTGCTAGCTCCAAGGAGGAGGG + Intergenic
1023297577 7:38731613-38731635 TTTGCAAGTTAGAAGGGAGATGG - Intronic
1023370212 7:39505585-39505607 TGAGCCAGGCAGAAGGAAGATGG - Intergenic
1024086146 7:45893460-45893482 TCAGCTAGTTTGAAGGAGGACGG + Exonic
1024195701 7:47056855-47056877 TCTGAAAGGTAGTAAGAAGAAGG - Intergenic
1026255443 7:68707276-68707298 CCTGCTAGGGAGAAGAGAGAGGG - Intergenic
1026937115 7:74263925-74263947 TCTGCTGGGTAGGAGCTAGAGGG + Intergenic
1027532341 7:79352521-79352543 TCTGCTAAGCAGAAGCATGAGGG + Intronic
1027606226 7:80302333-80302355 TCTGCTAGGTAGAATGTATCAGG - Intergenic
1027700850 7:81468632-81468654 TTTTCCAGGTAGGAGGAAGAAGG + Intergenic
1027869430 7:83687908-83687930 TCTTCAAGGGAGAAGCAAGAAGG + Intergenic
1027882478 7:83858827-83858849 TTTGCTAGGTAGTAGTAATAAGG - Intergenic
1027926322 7:84468293-84468315 TCTGCTAGGTCTTAGGAAGATGG - Intronic
1030285203 7:107819022-107819044 TGTGAAAGATAGAAGGAAGACGG + Intergenic
1030847250 7:114435348-114435370 AATTCTAGGTAGAAGGAAAAGGG + Intronic
1031214361 7:118871084-118871106 GCTGCTGTTTAGAAGGAAGAGGG - Intergenic
1031999298 7:128254385-128254407 ACTGCTATGCAGGAGGAAGAGGG - Exonic
1033600758 7:142886835-142886857 TGTGCTAGGGAGAAAGAAGTGGG - Intergenic
1034727465 7:153351026-153351048 TCTGAAAGGTAGAGGGGAGAAGG - Intergenic
1035969362 8:4229735-4229757 TATGCTATGTAGAAGCAGGACGG - Intronic
1036119785 8:6003310-6003332 TCTGCTAGGTAGAGGGAGTGGGG - Intergenic
1039505225 8:38047102-38047124 GCTGCTTGGAAGCAGGAAGATGG + Intronic
1040633991 8:49251011-49251033 TCAGTTAGATAGAAGGAATAAGG - Intergenic
1040862321 8:52012045-52012067 TCAGGAAGGAAGAAGGAAGAGGG - Intergenic
1041321526 8:56618740-56618762 TCTGAGAGACAGAAGGAAGAAGG - Intergenic
1042091312 8:65162615-65162637 TCTGCTTGGAACAAGGCAGAAGG + Intergenic
1042455660 8:68999518-68999540 TCTGAAAGGTAGAGAGAAGAAGG - Intergenic
1043524779 8:81084148-81084170 TCTGAAAGGTAGAGGAAAGATGG - Intronic
1044084361 8:87925840-87925862 GCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1044288659 8:90441163-90441185 TCTGAGATGTAGAAGGAAAAAGG - Intergenic
1044894268 8:96873027-96873049 AGTGCAAGGAAGAAGGAAGATGG - Intronic
1046721836 8:117628865-117628887 TGTGCTAGGTAAATGGCAGAGGG - Intergenic
1048474173 8:134728281-134728303 TCTGCTAGGTAGCATGTACAGGG + Intergenic
1048528144 8:135223357-135223379 TCTGCTAGGGACAAAGAATAGGG + Intergenic
1048535354 8:135289212-135289234 TCTGATAAAAAGAAGGAAGAAGG + Intergenic
1048977872 8:139683103-139683125 CCTGATAGGAAGAAGGAAAAGGG + Intronic
1049274739 8:141714527-141714549 TATAGGAGGTAGAAGGAAGATGG + Intergenic
1049993005 9:1007646-1007668 GATACTAGGAAGAAGGAAGAAGG + Intergenic
1050070292 9:1804157-1804179 TCTGCTTGATAGAAGAAGGAAGG - Intergenic
1053164128 9:35832810-35832832 TGTGCTAAGTAGGAGGCAGAAGG - Intronic
1055397878 9:75892560-75892582 TCTGCCAGGGGGAAGGGAGAGGG + Intronic
1055417531 9:76099646-76099668 TCTGATATCTAGAAGGAAAAGGG - Intronic
1055496507 9:76860468-76860490 TCAGCCTGGTAGAAGCAAGATGG + Intronic
1055689273 9:78811730-78811752 TCTCCTAAGTACAAGGGAGAGGG + Intergenic
1058565261 9:106277243-106277265 TCAGCAAGGAAGAAGGGAGAGGG + Intergenic
1059771824 9:117434021-117434043 TCTGCTTGGTAGAGGGGAGATGG + Intergenic
1060171791 9:121467928-121467950 TCTCCTAGGAAAAAAGAAGAGGG + Intergenic
1060372900 9:123091401-123091423 TCTCCTAGGTAGAAAGACTATGG + Intronic
1061224935 9:129275920-129275942 TCTGCCAGGTGGATGGAGGAGGG - Intergenic
1061229075 9:129301952-129301974 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1061695801 9:132372482-132372504 TCTGCTTGGTGGAGGGAGGAGGG + Intergenic
1062656920 9:137608496-137608518 TCTGCAAGCTGGAAAGAAGAGGG + Intronic
1186239576 X:7552085-7552107 TAATCTAGGTAGAAGGAAAATGG - Intergenic
1186641855 X:11463944-11463966 TGTGCTAGGAAGATGGAGGAGGG + Intronic
1186933542 X:14421416-14421438 TCTGCAAGATAGATTGAAGATGG + Intergenic
1187479583 X:19643027-19643049 TCTTCTGGCCAGAAGGAAGAGGG + Intronic
1188446606 X:30259124-30259146 TCTTCCAGGAAGAAGGAAAATGG - Intergenic
1189227728 X:39427299-39427321 TGTGCTGGGGAGAAGGTAGAAGG + Intergenic
1189996248 X:46641546-46641568 TCTGCTACATAGAACAAAGATGG + Intronic
1190571316 X:51784967-51784989 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1190795442 X:53736941-53736963 TCTGAAAAGTAGAAAGAAGAAGG + Intergenic
1191880825 X:65842444-65842466 TCTGATAGGAAGGAGGAAGGAGG - Intergenic
1191910790 X:66147225-66147247 TCTGAAAGATAGAAAGAAGAAGG - Intergenic
1195641787 X:107183492-107183514 TCTGAAAGGTAGAGAGAAGAAGG + Intronic
1196097980 X:111819821-111819843 TCTGCTATGTGCAAGGAAGTAGG - Intronic
1196517403 X:116629688-116629710 ACAGTTAGGTAGAAGGAATAAGG - Intergenic
1197263859 X:124345971-124345993 TGCGTGAGGTAGAAGGAAGAGGG + Intronic
1197275910 X:124478772-124478794 TCTACTAAGTGGAAGGAAGAAGG + Intronic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1199179721 X:144839202-144839224 TCTGTTAGGAAGGAAGAAGAGGG + Intergenic
1199284041 X:146036681-146036703 TCTGGTAGGTATATGGAAGATGG - Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199511618 X:148629140-148629162 TCAGCGAGGTTGAAGGAATAGGG + Intronic