ID: 1101756267

View in Genome Browser
Species Human (GRCh38)
Location 12:107622876-107622898
Sequence GAGCACAAACCAATAATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101756267 Original CRISPR GAGCACAAACCAATAATGGT GGG (reversed) Intronic
905009581 1:34738463-34738485 GAACACAACCCAAAAAAGGTAGG + Intronic
907786101 1:57614335-57614357 GAGCACAAACCATTAACTGATGG - Intronic
909268354 1:73591386-73591408 GAAAACAAAACAATGATGGTAGG + Intergenic
912657034 1:111496031-111496053 GAGCAGAAAAAAATAATTGTTGG + Intronic
912665230 1:111572863-111572885 GAGCAGAAAAAAATAATTGTTGG - Intronic
915867829 1:159524099-159524121 GAGAGCAATACAATAATGGTGGG - Intergenic
916580145 1:166099807-166099829 GACAACAACACAATAATGGTAGG + Intronic
919321125 1:196039779-196039801 GACCCCAAAACAATAATAGTTGG - Intergenic
920624338 1:207581690-207581712 GAGGACAAAGCAATAATAGCTGG - Intronic
920746447 1:208633470-208633492 CAGCACCAACCAATAAAGTTGGG - Intergenic
924356308 1:243180270-243180292 GAGGACAAACCTATTATGTTAGG + Intronic
924386638 1:243504926-243504948 GTGCACAAATGAACAATGGTGGG + Exonic
1063832670 10:9972982-9973004 GTGGACTAATCAATAATGGTGGG + Intergenic
1068172910 10:53419593-53419615 GAGAGCAAAACAATAATAGTGGG - Intergenic
1072751479 10:97983502-97983524 GAGCACAACCCAATGAGGGGAGG - Intronic
1074037166 10:109751794-109751816 GACAACAAAACAATAATAGTAGG - Intergenic
1076700630 10:132270924-132270946 GAGCAACAGCCAATAAGGGTAGG + Intronic
1080222319 11:29920448-29920470 GAGCACAAGCCAAGAAATGTGGG + Intergenic
1080324337 11:31052384-31052406 GACCACAACACAATAATAGTGGG + Intronic
1083091995 11:60209356-60209378 GATGACAAACCAAGAAAGGTAGG + Intronic
1086729652 11:90232128-90232150 GTTTACAAGCCAATAATGGTGGG + Intergenic
1086825154 11:91487290-91487312 GACAACAACCCAATAATAGTGGG - Intergenic
1087889240 11:103517973-103517995 GAGAACAAACTAATACAGGTAGG - Intergenic
1090061045 11:123464429-123464451 TAGCAGAAATCAATCATGGTGGG + Intergenic
1094021989 12:25924655-25924677 GAGCACAAACCTTTGATGATGGG + Intergenic
1096946990 12:55417936-55417958 GATAACCAGCCAATAATGGTGGG - Intergenic
1097923175 12:65099107-65099129 GAGCACAGAACAATTATGCTGGG - Intronic
1101756267 12:107622876-107622898 GAGCACAAACCAATAATGGTGGG - Intronic
1101795069 12:107965515-107965537 GACCACAAACAAATTATGATTGG - Intergenic
1103422906 12:120803351-120803373 GAGCACAAATAAACAATTGTAGG + Intronic
1106199845 13:27527233-27527255 GAGCACACACCAATGCTGGGAGG + Intergenic
1106301076 13:28466027-28466049 GAACACAAAGCAATATTAGTAGG - Intronic
1111161659 13:84402616-84402638 GGCCACAAACCAAGAATGGAAGG - Intergenic
1111489822 13:88957838-88957860 GAGCACAAAACAATATGGATTGG - Intergenic
1112142541 13:96661246-96661268 GACCAAAATACAATAATGGTGGG - Intronic
1114444559 14:22778314-22778336 GACTACAGAGCAATAATGGTAGG + Intronic
1115476979 14:33824765-33824787 GACCCCAAAACAATAATAGTTGG + Intergenic
1115947816 14:38683137-38683159 GACCACAACACAATAATAGTGGG - Intergenic
1116734664 14:48673363-48673385 GAGAACCACGCAATAATGGTGGG + Intergenic
1117332950 14:54731965-54731987 CAGCAAAAAGAAATAATGGTTGG + Intronic
1124788432 15:32703620-32703642 GACCACAGACCAGTATTGGTTGG - Intergenic
1128404517 15:67321937-67321959 CACCACAAACCAACAATTGTAGG - Intronic
1128684530 15:69673941-69673963 TAGCACAAAATTATAATGGTAGG - Intergenic
1133478219 16:6144102-6144124 TAGTACAAACCAAAAATGGTAGG - Intronic
1137994719 16:53197960-53197982 GAGTTCAAACCAAAAATGCTAGG - Intronic
1140128333 16:72136345-72136367 GCTCCCAAAGCAATAATGGTGGG + Intronic
1142390197 16:89794571-89794593 GGGAATAAACCAATCATGGTGGG + Intronic
1149122152 17:53182470-53182492 GAGCACAAACCTATAATCTAAGG - Intergenic
1153404320 18:4719011-4719033 GAACACAAACCAAGACTGGAAGG + Intergenic
1155122198 18:22832736-22832758 GAACACAAGCCAAAAATTGTGGG + Intronic
1155843394 18:30674765-30674787 GACCACAAGCCAAGAATTGTGGG - Intergenic
1156214999 18:34989120-34989142 GAGCCCAAACCAAAAAAGGAAGG + Intronic
1157651597 18:49338162-49338184 CAGCACTAACCAACAATAGTAGG + Intronic
1160546823 18:79663262-79663284 GAGCACAGAGCAATAATGTAAGG + Intergenic
1166100997 19:40571282-40571304 GAGCCCAAACTAATGAGGGTAGG + Intronic
1166624337 19:44336410-44336432 GAGCAAAAACAAACAATGGTAGG + Intronic
1168449278 19:56451356-56451378 GACCACAATACAATAATTGTTGG + Intronic
1168676491 19:58281622-58281644 AAGCACAAATCAAAATTGGTGGG + Intronic
926716110 2:15925036-15925058 TAGAACAAGCCAATAATGGAGGG - Intergenic
926869868 2:17403478-17403500 GACCACAATACAATAATAGTTGG - Intergenic
927369198 2:22335096-22335118 GTGCACCAACCACTACTGGTAGG + Intergenic
930230438 2:48838255-48838277 GACCTCAAAACAATAATAGTTGG - Intergenic
932101354 2:68902300-68902322 GACCCCAATACAATAATGGTTGG + Intergenic
933297006 2:80502549-80502571 GAACACAAAATAATAATTGTAGG - Intronic
935093951 2:99925925-99925947 GATCAGGAACCAATAATGTTGGG + Intronic
936037934 2:109128080-109128102 CAGCACAAACCAGGATTGGTTGG - Intergenic
937454448 2:122029295-122029317 GAGCAGCAGCCAAAAATGGTTGG + Intergenic
939877445 2:147594009-147594031 GACCACAAGCCAAGAAAGGTAGG - Intergenic
941407999 2:165115894-165115916 GAGGCCAAACCAAGAATAGTTGG + Intronic
942489928 2:176479794-176479816 GAGCACAAATCACTAGTAGTGGG + Intergenic
943142960 2:184005784-184005806 GAGCACATACAAATAATAGGTGG - Intergenic
946706418 2:222462861-222462883 GAGCACAAAGCAAGCAGGGTCGG + Intronic
947040640 2:225915485-225915507 GAGCACAAAGTAAAAATGGATGG - Intergenic
1169987893 20:11467144-11467166 GAGTACAAAACAATAATAGTGGG - Intergenic
1170038066 20:12010983-12011005 GAGCCCCAACCACTAGTGGTGGG - Intergenic
1176231824 20:64036826-64036848 GAGCACAAAGCAGCAATGGCTGG - Intronic
1177781000 21:25622309-25622331 ACGCACAAAGCAATAATGCTGGG - Intergenic
1184931909 22:47687586-47687608 GAGCATAGACTAATAGTGGTGGG + Intergenic
951862687 3:27271654-27271676 GAGCAAAAACTAATATTGTTTGG + Intronic
952356513 3:32590043-32590065 GAGAAAATACCAATAATGTTGGG - Intergenic
956437549 3:69248280-69248302 GAGCACAAAACAGAACTGGTGGG + Intronic
957635317 3:82776341-82776363 GACCACAATACAATAATAGTTGG + Intergenic
961432754 3:126894638-126894660 GAGCACACACCCATCACGGTGGG + Intronic
964803705 3:160583390-160583412 GATCACAATACAATAATAGTGGG + Intergenic
966347760 3:178997881-178997903 GAGCTCAAACCACTTATGGGAGG - Intergenic
966739058 3:183215028-183215050 AAGCACAAACCAGCAATGGCAGG - Intronic
968330600 3:197866202-197866224 GGGCAGAAACCAACAAAGGTAGG + Exonic
970421298 4:15907826-15907848 GAGCACAAAGCAGTAATGTTTGG - Intergenic
971730448 4:30372042-30372064 GATAGCAAAACAATAATGGTAGG - Intergenic
973301040 4:48584706-48584728 GAGCAGAAAACAATAAAGCTTGG + Intronic
973857317 4:55026036-55026058 CAGCAAACACCAAGAATGGTGGG + Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
975763295 4:77639343-77639365 GAGTGCAATACAATAATGGTAGG - Intergenic
979178477 4:117694666-117694688 GATCACAGTACAATAATGGTGGG + Intergenic
979245507 4:118499359-118499381 GAGGACAAACCTATTATGTTAGG - Intergenic
981900908 4:149861509-149861531 GACTACAAAACAATAATAGTAGG + Intergenic
986291945 5:6407098-6407120 AAGAACAAAGCAATAATGGTGGG + Intergenic
987820628 5:22961673-22961695 CAACACAGACCAATAATGTTAGG + Intergenic
990032913 5:51283368-51283390 GAAAACGAACTAATAATGGTAGG + Intergenic
991466300 5:66915877-66915899 GAAGAGAAACCCATAATGGTAGG - Intronic
996521362 5:124429796-124429818 GACCACAATACAATAATAGTAGG + Intergenic
997729646 5:136158574-136158596 GAGCAGTAACCAATATAGGTTGG + Intronic
1007231149 6:40348397-40348419 GAGCACAAACCACAGATGCTTGG - Intergenic
1008369476 6:50715889-50715911 GAGGACAAACCAAAGATGGAGGG - Intronic
1010629909 6:78186884-78186906 TATCACAACACAATAATGGTTGG - Intergenic
1011864099 6:91799957-91799979 GAAAACAAACCAATAAAAGTTGG - Intergenic
1012208130 6:96486830-96486852 GAGCACAAACAAATAATCTAAGG - Intergenic
1016106930 6:140174606-140174628 GATTCCAAACCAACAATGGTTGG - Intergenic
1024050133 7:45614910-45614932 GACCACAAAACAATAATAATAGG + Intronic
1026386026 7:69848618-69848640 GAGCAGAGACCAATAATGACAGG - Intronic
1029379393 7:100202954-100202976 AAGCATAAATCAATACTGGTGGG - Intronic
1030186191 7:106764415-106764437 GATCATAAACCAATCATCGTGGG + Intergenic
1030661271 7:112221821-112221843 GGCCACAAACCAGTACTGGTTGG + Intronic
1030683839 7:112462541-112462563 GAGCAGAAACCAGTAGGGGTTGG + Intronic
1038050388 8:23804367-23804389 GCACACAAACCAAAAATTGTTGG + Intergenic
1044065751 8:87698351-87698373 AAGCACAAACCAATGTTGGTAGG - Intergenic
1044701657 8:94970684-94970706 AAGCACATACCAAAAATGCTTGG + Intronic
1046496188 8:115017055-115017077 GAGGACAATACAATAATAGTGGG - Intergenic
1048248954 8:132841841-132841863 GTACACAAACATATAATGGTAGG + Intronic
1186978117 X:14930149-14930171 GAGCAGAGAGCAATAATGGCTGG - Intergenic
1188014721 X:25095918-25095940 GACAGCAACCCAATAATGGTAGG - Intergenic
1188058431 X:25569382-25569404 GACAACAAAACAATAATAGTGGG - Intergenic
1189706806 X:43767118-43767140 AAGCACAAAGCCATAATGGTAGG + Exonic
1193227252 X:78998497-78998519 GGGCCTAAACCACTAATGGTGGG + Intergenic
1193954445 X:87842418-87842440 GATGACAACCCAATAATAGTGGG - Intergenic
1195694863 X:107659411-107659433 GAGCAGAAAGCAATGATGATGGG + Intergenic
1198444127 X:136694358-136694380 GATCACAAACAAAAAGTGGTAGG - Intronic
1199725544 X:150576395-150576417 GGGCACAAACAAACAATAGTAGG - Intronic
1201760660 Y:17534094-17534116 GACCACAATACAATAATGGCTGG - Intergenic
1201840893 Y:18371896-18371918 GACCACAATACAATAATGGCTGG + Intergenic