ID: 1101758809

View in Genome Browser
Species Human (GRCh38)
Location 12:107642593-107642615
Sequence GAAGTTGGTGAGCCACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101758805_1101758809 19 Left 1101758805 12:107642551-107642573 CCTCTTGGATGAGGTCTTATGAG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1101758809 12:107642593-107642615 GAAGTTGGTGAGCCACAGGAAGG 0: 1
1: 1
2: 0
3: 27
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101758809 Original CRISPR GAAGTTGGTGAGCCACAGGA AGG Intronic
900887778 1:5427640-5427662 GAAGCTGTTGAGACACAGAAGGG - Intergenic
901957322 1:12795943-12795965 GACGGTGATGAGCCACAGGAAGG - Exonic
901965341 1:12861726-12861748 GACGGTGATGAGCCACAGGAAGG - Exonic
901973718 1:12928200-12928222 GACGGTGATGAGCCACAGGAAGG - Intronic
901980734 1:13032077-13032099 GACAGTGATGAGCCACAGGAAGG - Exonic
901988699 1:13095205-13095227 GACGGTGATGAGCCACAGGACGG + Intergenic
901993114 1:13131562-13131584 GACGGTGATGAGCCACAGGACGG - Intergenic
902001356 1:13196854-13196876 GACAGTGATGAGCCACAGGAAGG + Exonic
902011460 1:13273567-13273589 GACGGTGATGAGCCACAGGAAGG + Intergenic
902020593 1:13342559-13342581 GACGGTGATGAGCCACAGGAAGG + Exonic
903510979 1:23874742-23874764 GGAGTTGATGAGGCACAGCATGG + Exonic
904322849 1:29708029-29708051 GAAGTGGGGGAGCCAGGGGAAGG - Intergenic
905323047 1:37131278-37131300 GAAGTGGGTGAGGGACAGGCAGG - Intergenic
905355519 1:37381040-37381062 GCAGTGGGTGAGCCAAAGCAGGG - Intergenic
905465149 1:38147632-38147654 GACATTTGTGTGCCACAGGATGG + Intergenic
906581292 1:46937108-46937130 GAAGAAGCTGAGCCTCAGGAAGG + Intronic
906602429 1:47141787-47141809 GAAGAAGCTGAGCCTCAGGAAGG - Intronic
907570351 1:55477505-55477527 GAAGATGCTTAGCCAAAGGAAGG - Intergenic
907690573 1:56660715-56660737 GAAATTGGTGAGTGACAGGATGG - Intronic
909192882 1:72576687-72576709 GAAGTTGCTCAGCCACAAGCTGG + Intergenic
909314129 1:74194634-74194656 AAAGGTGGTGAGCCAGAAGATGG + Intronic
911040484 1:93587462-93587484 GAAGAAGGTGAGGCCCAGGAAGG + Intronic
913342117 1:117769121-117769143 GATGTTGGTGACCTACAGAAGGG + Intergenic
917462647 1:175245730-175245752 GACGTTTGTGTGCCAAAGGATGG + Intergenic
917716615 1:177744864-177744886 AACGTTGGTGTGCCCCAGGATGG + Intergenic
917981661 1:180273175-180273197 GAAGTTTGTGGGACAGAGGATGG + Intronic
920888875 1:209962829-209962851 GAACTTAGTGAGGTACAGGATGG - Intronic
922025199 1:221742936-221742958 GAAGTAGGTGAGCAGCAGGGCGG - Intergenic
922057160 1:222052266-222052288 GAAGTGGGAGAGGCTCAGGATGG - Intergenic
922956215 1:229602978-229603000 GATGGTGGTGATCCCCAGGAGGG - Intronic
923167180 1:231376974-231376996 GGGCTTGGTAAGCCACAGGAAGG + Intronic
923228421 1:231961047-231961069 GAAGATGGTGTGCCCAAGGAGGG - Intronic
923865341 1:237933505-237933527 GATTTTGCTGAGCCTCAGGAAGG - Intergenic
1063638595 10:7809612-7809634 ACAATTGGTGAGCCACAAGAGGG + Intergenic
1064698940 10:17998622-17998644 TAAGTTAGTGAACCACAGGAAGG + Intronic
1064979028 10:21147844-21147866 GAATTTGGTTGGCGACAGGAAGG - Intronic
1065157119 10:22881639-22881661 GAAGTTGGTGACCTACAGATGGG - Intergenic
1065553990 10:26895698-26895720 GAAGTTGGTGAGTCACTTGAAGG + Intergenic
1065599327 10:27352916-27352938 GAATTTGGTGAGTCACTTGAAGG - Intergenic
1065948265 10:30626680-30626702 GTAGTTGGGGAGACACAGCAGGG + Intronic
1067430319 10:46238608-46238630 GGAGTTGGTGAACCAAAGGTAGG - Intergenic
1067564188 10:47325178-47325200 GACTGTGGAGAGCCACAGGAAGG + Exonic
1068239731 10:54289380-54289402 GATGTTGGTGACCCACAGATGGG - Intronic
1069798807 10:71069791-71069813 GAAGATGGTGAGGGACAGCATGG - Intergenic
1070219888 10:74430341-74430363 GAAGTGGGTGGGCAACATGAAGG - Intronic
1070510892 10:77159669-77159691 GAAATTTGTTAGCTACAGGAGGG - Intronic
1070735264 10:78859647-78859669 CGAGCTGGTGAGACACAGGATGG - Intergenic
1071771043 10:88728946-88728968 GATGTGGGACAGCCACAGGAAGG - Intronic
1072783916 10:98267959-98267981 CAGGTTGGTGAGCGACTGGAGGG + Intronic
1074491223 10:113941307-113941329 GAAGTTGGTGGGCCATCGGCAGG - Intergenic
1075038611 10:119089765-119089787 TGAGTTGGTGAACCACAAGAGGG - Intergenic
1075081228 10:119385195-119385217 GAAATGGGGGAGCCACTGGAGGG + Intronic
1075830949 10:125410294-125410316 GAAGGTTCTGAGCCAGAGGATGG - Intergenic
1075915248 10:126161126-126161148 CAAGAATGTGAGCCACAGGAGGG + Intronic
1076165206 10:128276265-128276287 GGAGTTGGGGAGCGAGAGGAAGG + Intergenic
1076658465 10:132039564-132039586 GAAGCCAGTGAGCCACAGGCAGG - Intergenic
1077118418 11:895883-895905 GAAGGTGGGGAGCTGCAGGAAGG - Intronic
1078533026 11:12151628-12151650 GAAGTTGGTGAGCCACAAGAAGG - Intronic
1079957563 11:26883176-26883198 GATGTTGGTGAGCTACAGATTGG - Intergenic
1080183729 11:29454374-29454396 AGAGTTGGTGAGACTCAGGATGG - Intergenic
1082682324 11:56190721-56190743 GAAGATGGTGACCCACATCATGG + Intergenic
1082965594 11:58963661-58963683 GAAGTTTGGGAGTCACAGAACGG + Intronic
1083003587 11:59320625-59320647 GAAGTTGGTGACCTACAGATGGG + Intergenic
1083565788 11:63714757-63714779 GAACTTTGGGAGGCACAGGAGGG - Intronic
1084029569 11:66473433-66473455 GGAGTGAGTGAGCCCCAGGAAGG + Exonic
1084041335 11:66544394-66544416 TAAATTGGAGAACCACAGGAGGG - Intronic
1084628013 11:70323773-70323795 GAAGTTGATTACCCACAGTAGGG + Intronic
1084873573 11:72114284-72114306 GGAGTTGGGGAGCCAGTGGAGGG + Intergenic
1085252196 11:75151259-75151281 GCAGCAGGTGAGCCACAGCAGGG - Exonic
1088550461 11:111007549-111007571 CAAGTAGGTGAGCCAGGGGAAGG + Intergenic
1089051370 11:115548894-115548916 GGAGATGGTGAGCCAGAGGAAGG + Intergenic
1091404438 12:200489-200511 GAACAGGGGGAGCCACAGGAAGG - Intronic
1091853599 12:3720968-3720990 CAAGTGGCTGAGCCACAGGCGGG - Intronic
1094417914 12:30236714-30236736 GAAGATGGTGAACACCAGGAAGG + Intergenic
1096330192 12:50705061-50705083 GAACTTGATGAGCCAGAGGATGG + Intronic
1097182410 12:57178932-57178954 GTAGTTGATGAGACACAGGTGGG - Exonic
1099379448 12:81937005-81937027 GATGTTTGTGTGCCAGAGGATGG - Intergenic
1100073813 12:90754639-90754661 GATGTTGGTGACCTACAGAAGGG + Intergenic
1101264055 12:103065625-103065647 GACGTTTGTGTGCCAGAGGATGG + Intergenic
1101594318 12:106150548-106150570 GAATTTCGTGAGCCAGAGAAAGG + Intergenic
1101758809 12:107642593-107642615 GAAGTTGGTGAGCCACAGGAAGG + Intronic
1103546954 12:121709028-121709050 GATGATGGTAAGTCACAGGAAGG + Intergenic
1103766374 12:123283127-123283149 GAGAATGGTGACCCACAGGAGGG + Intergenic
1104264627 12:127219999-127220021 GATGTTGCTCAGCCACAGGACGG - Intergenic
1104398185 12:128453432-128453454 AAAGCTGGTGAGACACAGGAAGG - Intronic
1105940252 13:25141454-25141476 GGAGTTGGTTAGCCACAGATGGG - Intergenic
1106347357 13:28892043-28892065 GGAGTTGCTGAGAAACAGGAAGG - Intronic
1107043420 13:35972190-35972212 GATGTTTGAGAGCCACAGAAAGG - Intronic
1107360003 13:39607582-39607604 GAGGATGGTGTGCCCCAGGAAGG + Intergenic
1108005379 13:45941140-45941162 GAAGTTGATGAGATACAGAATGG + Intergenic
1108455485 13:50609514-50609536 GAAGTTGGTGAGCAGGAGTAGGG - Intronic
1110279237 13:73673587-73673609 AAAGTTAGTAAGCCACAGGGTGG + Intergenic
1111774170 13:92638435-92638457 GAAGACAGTGAGCCTCAGGATGG + Intronic
1112068929 13:95826275-95826297 GAAGTTGGTCAACCACAGTAAGG + Intronic
1112819969 13:103321634-103321656 GAAGTTGGGGAGGGACAGGAGGG + Intergenic
1113528502 13:111001355-111001377 GAAGTAGGGGAGACAGAGGAAGG + Intergenic
1114551495 14:23535090-23535112 GAGATTGGGGAGCCCCAGGAAGG - Exonic
1116052762 14:39825185-39825207 GAAGTTGGTGACCTACAGATGGG + Intergenic
1118494739 14:66296778-66296800 GAAGTTGGTGACCTACAGATGGG - Intergenic
1119183041 14:72617202-72617224 GAAGTTGTAGAGCCACAGTTTGG + Intergenic
1120642503 14:87032190-87032212 CTAGTTGGGGAGCCAGAGGATGG - Intergenic
1121993407 14:98582983-98583005 GAGGAGGGTGAGGCACAGGAGGG - Intergenic
1122348681 14:101075701-101075723 GAAGTTTCTAAGCCTCAGGAAGG + Intergenic
1123058609 14:105584256-105584278 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123082940 14:105704490-105704512 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1124718349 15:32088561-32088583 GAGGATGGGGAGCAACAGGAAGG - Intronic
1124833922 15:33177118-33177140 GAAGAAGCTGAGGCACAGGAGGG + Intronic
1124967364 15:34445613-34445635 GAAGACTGTGAGCCTCAGGATGG + Intergenic
1125523229 15:40359463-40359485 CAAGAAGGTGAGACACAGGATGG + Intronic
1125676022 15:41503009-41503031 GAAGTCGATGAGCCACACGCCGG - Exonic
1127391620 15:58509625-58509647 GGAGTTGGTAAGCCATAGTATGG - Intronic
1127547312 15:60003496-60003518 GAATTTGGTTGGACACAGGATGG - Intergenic
1128550829 15:68596912-68596934 GCAGGAGGAGAGCCACAGGATGG - Intronic
1129876177 15:78977182-78977204 GAAGTTGGAGAGAAAGAGGAAGG - Intronic
1129919428 15:79307418-79307440 GAAGTTTGTGAGTCTCAGGAGGG + Intergenic
1130176844 15:81581831-81581853 GATGTTGGTGACCTACAGGTAGG - Intergenic
1131319885 15:91377208-91377230 GAAGCTAGTGTACCACAGGATGG - Intergenic
1131355586 15:91742955-91742977 GAAGTGGGTGAGCCAGAGCCAGG - Intergenic
1133200024 16:4198381-4198403 GAATTTGGGGAGCCCCAGGCTGG - Intronic
1133201480 16:4206952-4206974 GAAGGCGGGGAGCCCCAGGAAGG - Intronic
1133201486 16:4206970-4206992 GAAGGTGGAGCGCCACAGGAAGG - Intronic
1134052075 16:11144392-11144414 GAAGTTGTGGAGGTACAGGACGG - Intronic
1136506845 16:30709904-30709926 GAAGTTGAAGAACAACAGGAAGG + Exonic
1138391775 16:56675740-56675762 GAAGAAGGTGAGCAAGAGGATGG + Intronic
1138441384 16:57037104-57037126 CAAGCTGCTGAGCCACAGGGAGG + Intronic
1138511288 16:57509938-57509960 TAAGCTGGGGAGCCACAGAAGGG + Intergenic
1139344396 16:66293284-66293306 GAAGGTGGTGAAGCACAGCAAGG - Intergenic
1139610511 16:68053679-68053701 GGGGATGGTGAGCCTCAGGAGGG - Intronic
1140408951 16:74729908-74729930 GAAGTAGGGGAACCACAGGCAGG + Intronic
1142812778 17:2403018-2403040 GAACTTCGTGAACCAGAGGAAGG + Intergenic
1142988766 17:3714888-3714910 GAACTTGGAGAGCATCAGGAAGG - Exonic
1143595306 17:7910444-7910466 GGAGTTGCTGAGCGACATGAAGG + Exonic
1144785629 17:17830019-17830041 GGAGTTGGTGAGAGACAGGATGG - Intronic
1144862997 17:18317482-18317504 GAACTGGGTGAGACAGAGGAAGG + Exonic
1147998598 17:44375004-44375026 GAGGCTGGGCAGCCACAGGAAGG + Exonic
1148484428 17:47981607-47981629 GAAGATGGAAAGCCACAGGAAGG + Exonic
1153741765 18:8137491-8137513 GAAGTTGGGGAGCCATGGGAAGG - Intronic
1155270991 18:24140800-24140822 GAAGTAAGTGAGGCACAGAAAGG - Intronic
1158824144 18:61195452-61195474 GAGGTTGTGGAGCCACATGATGG - Intergenic
1159549935 18:69884314-69884336 GATGTTGGTGTTCCACAGAATGG + Intronic
1159673772 18:71255857-71255879 GAAGTTGGGGAGTCAGAGGCAGG - Intergenic
1161511113 19:4671622-4671644 GAGGGTGGTGAGCCCCAGGGAGG + Intergenic
1163815061 19:19460168-19460190 GAAGTGGGAGAGCCACTGAAGGG + Intronic
1164110199 19:22149353-22149375 GAAGTTGGTGACCTACAGATGGG - Intergenic
1164195184 19:22950501-22950523 GATGTTGGTGACCTACAGGTGGG - Intergenic
1165654125 19:37518460-37518482 GATATTGGTGAGCCACAGAATGG - Intronic
1167156326 19:47741452-47741474 GGAGCTGGGGAGCCACAGCAGGG - Exonic
1167429416 19:49446074-49446096 GCGGCTGGGGAGCCACAGGAGGG + Intergenic
1167646205 19:50706492-50706514 GAAGTTGGTGAGGGTCAGGGTGG - Intronic
1168588709 19:57615126-57615148 GAAATTGGTAAGTCACAGCAGGG + Intronic
925047618 2:785989-786011 GAGGTGGGAGAGCTACAGGAAGG + Intergenic
927008654 2:18879264-18879286 GACGTTTGTGTGCCAGAGGATGG + Intergenic
927059764 2:19406019-19406041 GAAGTTGCTGGGCACCAGGATGG - Intergenic
927560539 2:24069361-24069383 GAAGTTGGTGAGGTGAAGGAAGG - Intronic
929216514 2:39419894-39419916 GAAGATGGTGGAGCACAGGATGG + Intronic
930016260 2:46972909-46972931 GAAAGTGGTGAGCACCAGGAGGG + Intronic
931066471 2:58593598-58593620 GAAGGTGCTGGGCCACAGAATGG + Intergenic
931198764 2:60077194-60077216 GAAGTCTGTGAGCAACATGAAGG - Intergenic
931639963 2:64373341-64373363 GAAGGAGGTGAGCCAAAGAAGGG + Intergenic
932038857 2:68277201-68277223 GAAGTTGCTGAGCCAGAAAAAGG + Intergenic
932868615 2:75374042-75374064 GAAGTTGGTGACCTACAGATGGG + Intergenic
936377048 2:111949735-111949757 GGAGATGGTGACCCACTGGAAGG - Intronic
937182797 2:120011665-120011687 GAGGTGGGGGAGCCACTGGAAGG - Intergenic
937476880 2:122223546-122223568 GAAGTTGGTTGGACACACGATGG + Intergenic
937859982 2:126700122-126700144 GGAGTGGGTGAGCCCCAGGGTGG - Intergenic
937968959 2:127535429-127535451 GAAGATGCTGAGCCCCCGGATGG + Intergenic
938975151 2:136469680-136469702 GATGTTGGTGATCTACAGAAGGG - Intergenic
939787929 2:146539470-146539492 GAAGATGCAGAGCCACACGATGG + Intergenic
939788750 2:146546572-146546594 GACATTTGTGTGCCACAGGATGG - Intergenic
940528159 2:154844100-154844122 GATGTTGGTGAGCTACAGATGGG + Intronic
942780913 2:179641771-179641793 GAAGTAGCTGAGCTAAAGGAAGG + Intronic
942916390 2:181312854-181312876 GAAGATGGTGACCCAGAGCATGG - Intergenic
944161417 2:196664512-196664534 GAAGGTGGTTAGCCCCAGAAAGG - Intronic
944355057 2:198777975-198777997 GAAGTGGCTGTGCCAAAGGAAGG + Intergenic
944634403 2:201660809-201660831 GAAGTGTGTGAGACCCAGGAAGG - Intronic
946700203 2:222404638-222404660 GAAGTGGGTGCTCCACAGCAAGG + Intergenic
946894692 2:224311407-224311429 GAAGTTGGTGAGTCAGAGTGAGG - Intergenic
946955891 2:224929576-224929598 GCAGTGGGGGAGCCACAGAAGGG + Intronic
947531630 2:230912283-230912305 GAGGTGGGAGAGGCACAGGAAGG - Intronic
948372191 2:237496402-237496424 GAAGGGGGTGAGCCACAGACAGG - Intronic
1169194581 20:3676290-3676312 GAATTTGGAGAGTCCCAGGAGGG - Intronic
1169869507 20:10236122-10236144 GAAGATGTGTAGCCACAGGATGG - Intronic
1171937046 20:31285188-31285210 GAAGACGGAAAGCCACAGGAAGG - Intergenic
1172056388 20:32157531-32157553 GAAGTAGGGGAGGAACAGGAAGG - Intronic
1172328358 20:34055360-34055382 AAAGTTGGAGAGAGACAGGAAGG - Intronic
1174607171 20:51769045-51769067 GATGATGGTGACCAACAGGAGGG - Intergenic
1175115091 20:56676551-56676573 GAAGTTGGAGAGCAACGGGATGG + Intergenic
1175321478 20:58091219-58091241 GAAGTTGGTGTGTTCCAGGAAGG - Intergenic
1175491707 20:59384447-59384469 GAAGGAGGTGAGGCAGAGGAGGG + Intergenic
1175525460 20:59630630-59630652 GAAGTTGGGGAGACACCGGGTGG + Intronic
1175594653 20:60221444-60221466 GAGGTTTGTAAGCCACAGAAAGG + Intergenic
1175815433 20:61880982-61881004 GAGGGGGCTGAGCCACAGGATGG + Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1178891717 21:36525625-36525647 CAAGCTGGTGAGCAGCAGGATGG + Intronic
1178955470 21:37017998-37018020 GAAGCTGAAGAGCCAGAGGAAGG + Exonic
1179079735 21:38159655-38159677 GGAGCTGGTGAGTCACAGGGAGG - Intronic
1179633091 21:42690771-42690793 GAAGTTGGTGAGGCATAAGTTGG - Intronic
1182472101 22:30554986-30555008 GAGCTTGGTGACCCACAGGTTGG + Exonic
1183769169 22:39908616-39908638 GAAGTTGGAGACTCACAAGAGGG + Intronic
1185395700 22:50586531-50586553 GGAGTTGGTGAACAGCAGGATGG + Intronic
949494430 3:4618698-4618720 GACGGTGGTGAGGAACAGGAGGG - Intronic
949790508 3:7786978-7787000 GAAAGTGGGGAGCCATAGGAAGG - Intergenic
949866154 3:8549192-8549214 GAAGTTGGTGAGGTACAAGCTGG + Intronic
950648421 3:14392350-14392372 GAAGGTGTGCAGCCACAGGAGGG - Intergenic
950866204 3:16191105-16191127 GAAGATGGTGAACCAATGGATGG - Intronic
950881416 3:16325754-16325776 GATCCTGGTGAGCCAGAGGAGGG + Intronic
952073815 3:29671265-29671287 GATGATGGTGACCCACAGGTGGG - Intronic
952387802 3:32855460-32855482 GAAGTGGGGGAGCCTCTGGAGGG + Intronic
953986512 3:47447441-47447463 GAACTTGGTGAGGCAAAGGTGGG + Intronic
955929220 3:64038884-64038906 GAAGTTGGAGACACACAGTAAGG + Intergenic
961561316 3:127732380-127732402 CCAGTAGGTGAGCCACAGGGAGG + Intronic
962670877 3:137707520-137707542 GAAGATGATGAGCCACTGAAAGG + Intergenic
964701623 3:159574268-159574290 GATGTTGGTGACCCACAGATGGG + Intronic
964743580 3:159990726-159990748 GAAGCTGGTGGGCAGCAGGAGGG - Intronic
965163763 3:165168956-165168978 GATGTTGGTGACCTACAGGTGGG + Intergenic
968093461 3:195911778-195911800 GGAGTTGGTGAGGAACAGGGTGG - Intronic
968866690 4:3217448-3217470 GAGGCTGAGGAGCCACAGGATGG + Intronic
968906867 4:3457474-3457496 GACGTTTGTGTGCCAGAGGATGG + Intergenic
969577017 4:8042168-8042190 GAAGAGGGTGAGAGACAGGAGGG - Intronic
970227573 4:13875682-13875704 GAAGATGGAGAGCCAGTGGAAGG + Intergenic
971419484 4:26462381-26462403 GAAGAGGGTGTGCCACAGGTAGG - Intergenic
972630233 4:40836000-40836022 GAAGTTGATGAGCTCCAGGGTGG + Intronic
973013779 4:45110260-45110282 GATGTTGGTGAGCTACAGATGGG + Intergenic
973871256 4:55169260-55169282 GAGGTTGGTGACCTACAGGTGGG + Intergenic
975744547 4:77463750-77463772 GATGTTGGTGACCTACAGAAGGG + Intergenic
975823989 4:78300773-78300795 GGAGTTGGTGAGGCACAGTGGGG - Intronic
978148823 4:105409897-105409919 GATGTTGGTGAGCTACAGATGGG - Intronic
978341665 4:107726044-107726066 GACATTTGTGTGCCACAGGATGG - Intergenic
978791083 4:112664293-112664315 GAAGTTGGAGAACCTGAGGATGG + Intergenic
980868869 4:138587205-138587227 GAAGTTGATGAGAAACTGGAAGG + Intergenic
981254869 4:142649205-142649227 GATGTTGGTGACCTACAGGTGGG - Intronic
982883359 4:160747349-160747371 GATGTTGGTGAGCTACAGATGGG - Intergenic
986730431 5:10631311-10631333 GAGGTTGATGAGAAACAGGAGGG + Intronic
987076422 5:14386285-14386307 TGAGTTGGTGAGCCACAGCTGGG + Intronic
987418636 5:17692137-17692159 GAAGATGGTGAGCCCCAGCTTGG + Intergenic
988067316 5:26237669-26237691 GAAGCTGCTTGGCCACAGGAAGG - Intergenic
988326843 5:29779564-29779586 GAAGTTTGTCAGGCACATGAAGG + Intergenic
990943416 5:61226737-61226759 GACATTCCTGAGCCACAGGAAGG - Intergenic
991254913 5:64603105-64603127 GAGGTTTGGGAGCCACTGGAAGG + Intronic
993366643 5:87042187-87042209 GATGTTGGTGACCTACAGGTGGG + Intergenic
993591577 5:89801391-89801413 GATGTTGGTGACCTACAGGTGGG - Intergenic
994156442 5:96508699-96508721 GAAGTTGGAGGGTCTCAGGAAGG + Intergenic
994342294 5:98644908-98644930 GAAGTTGGTTAGCTACAGAGAGG + Intergenic
995858867 5:116621023-116621045 GAAGTTGGGTAGCCAGAGAAAGG + Intergenic
996266003 5:121541119-121541141 GATGCTGGAGAGCCTCAGGAAGG + Intergenic
996898119 5:128510342-128510364 GAAGCCTGTGAGCCACAGGTGGG + Intronic
997613909 5:135233277-135233299 GGAGAGAGTGAGCCACAGGAGGG + Intronic
999250346 5:150178691-150178713 GAGGTTGGAAAGCCACAGGTAGG - Intronic
999327316 5:150651148-150651170 GATGTGGGTGTGCCACAGGGAGG + Exonic
1000214383 5:159140527-159140549 GAAGTTGGTGACCTACAGATGGG - Intergenic
1001125090 5:169012239-169012261 CCAGTTGGTGAGACACTGGAAGG - Intronic
1001574435 5:172752854-172752876 TAAGATGGTAAGCCACTGGAAGG + Intergenic
1002441040 5:179264668-179264690 GAAGATGGCGAGGCAGAGGAGGG + Intronic
1002843529 6:925958-925980 GAAGGAGGTGAGCCTCAGCAGGG + Intergenic
1003081232 6:3023392-3023414 GAAGTGCGCGAACCACAGGAAGG - Intergenic
1003128411 6:3374502-3374524 CAAGTTGAGGAGCCAAAGGAAGG + Intronic
1004415310 6:15418000-15418022 GAAGTTATTGAGTCACGGGAAGG + Intronic
1007140628 6:39569802-39569824 GAAGGTGGTGTGCCACAGACAGG - Intronic
1008079434 6:47178880-47178902 GACGTTTGTGTGCCAAAGGATGG - Intergenic
1009393348 6:63167947-63167969 GATGTTGGTGACCTACAGGTGGG - Intergenic
1009930439 6:70171415-70171437 CAAGTTGATGAGTCACTGGAAGG - Intronic
1010667085 6:78643601-78643623 GAAGTTGGTGACCTACAGATGGG + Intergenic
1011848082 6:91590947-91590969 GATGTTGGTGACCTACAGAAGGG - Intergenic
1013535626 6:111060814-111060836 GAAGTTGGTTAACCACAGTCAGG - Intergenic
1013779528 6:113714599-113714621 GAGGTTAGTGACCCACAGCAGGG + Intergenic
1022673301 7:32476109-32476131 GCAGTAGGTGCTCCACAGGAGGG - Intergenic
1026310108 7:69175886-69175908 GCAGGAGGTGAGCCACAGGCAGG + Intergenic
1028141665 7:87281491-87281513 GATATTTGTGTGCCACAGGATGG + Intergenic
1029362134 7:100095537-100095559 GAAGTGGCAGAGCCAAAGGAGGG - Intronic
1029457961 7:100680438-100680460 GAAGTGGGTGAGCAATAGAAGGG + Exonic
1032586088 7:133147869-133147891 GAAGTTGACGAGTCCCAGGAAGG - Intergenic
1033215201 7:139488504-139488526 GAAATTGCTGAGCCAAAGGGTGG + Intergenic
1035571751 8:676903-676925 GAAGTTTGTGAGACACTGTAAGG + Intronic
1035599951 8:891510-891532 GCAGCTGCTGGGCCACAGGATGG + Intergenic
1037290242 8:17342633-17342655 GAAGTTGGAGAACCACAGAATGG + Intronic
1038178384 8:25202513-25202535 GAGGTGGGTTAGCCACAGTAAGG - Intronic
1039024034 8:33238339-33238361 GTAATTGTTGAGCCACTGGATGG + Intergenic
1039633965 8:39143365-39143387 GATGTTGGTGACCCACAGATGGG + Intronic
1041928712 8:63265017-63265039 GAGGTTAGTGAGCCACTGGCAGG + Intergenic
1041941738 8:63395863-63395885 GAATTTGTTGACCCACAGGAAGG - Intergenic
1041951610 8:63509903-63509925 GATGTTGGTGACCTACAGGTGGG + Intergenic
1044024693 8:87154372-87154394 GAAGCTGGTGAAGCAGAGGAGGG + Intronic
1044596936 8:93968966-93968988 GATGTTGGTGACCTACAGGTGGG + Intergenic
1044683315 8:94803266-94803288 GAGGTTGGGGAGGGACAGGATGG + Intergenic
1044818985 8:96143428-96143450 GAAGATGGTGGGCCTCAGGGAGG - Exonic
1048869736 8:138787409-138787431 GAAGGAGCTGAGACACAGGAGGG - Intronic
1049672847 8:143877470-143877492 GAAGTGGGGAATCCACAGGAGGG - Intronic
1050335186 9:4583611-4583633 GAAGCTGGTAAGACACAGGACGG - Intronic
1054717040 9:68566995-68567017 GAAGATGGTGAGCTTCAGAAGGG - Intergenic
1056016243 9:82391326-82391348 GATGTTGGTGAGCTACAGATGGG + Intergenic
1056348371 9:85722830-85722852 GATGTTGGTGACCTACAGGTGGG + Intronic
1056618219 9:88187049-88187071 TAAATTGCTGACCCACAGGATGG + Intergenic
1057501623 9:95601125-95601147 GAAGTGGGTGGTGCACAGGAAGG - Intergenic
1060025579 9:120168079-120168101 GGACTTGGGGAGCCAAAGGAGGG + Intergenic
1060879927 9:127110995-127111017 CAAGATGGTGAGCCACTGGGGGG - Intronic
1060945160 9:127566259-127566281 GAAGTGGGTGGGCCACTCGATGG - Intronic
1061262382 9:129487453-129487475 GGACTGGGAGAGCCACAGGAAGG + Intergenic
1061777818 9:132977678-132977700 GAAGGTGGGGAGCCAGGGGATGG + Intronic
1062440388 9:136566996-136567018 AAAGCTGGCGAGCCACGGGAAGG + Intergenic
1203490854 Un_GL000224v1:103148-103170 GAAGTTGGGGATCCAGATGATGG + Intergenic
1203503478 Un_KI270741v1:45026-45048 GAAGTTGGGGATCCAGATGATGG + Intergenic
1187345670 X:18461233-18461255 GAAGTTGCTGGGCCACAGCATGG + Intronic
1188199755 X:27283645-27283667 GAAGCAGGTTACCCACAGGAGGG - Intergenic
1189960209 X:46317102-46317124 GAAGGTGGTGAGCATGAGGAAGG + Intergenic
1190168548 X:48093059-48093081 GAAGTTGCTGAGGCAAAGAAAGG + Intergenic
1191581250 X:62763944-62763966 CAACTTGCTGAACCACAGGAAGG + Intergenic
1192039530 X:67603792-67603814 GAAGGTGGTGAGGCAGAGGCTGG + Intronic
1192217506 X:69172950-69172972 GAAGGTGTGGAGCCACAGGCAGG + Intergenic
1192688396 X:73331965-73331987 GAAGTTGGTGACCTACAGATGGG - Intergenic
1193957214 X:87877732-87877754 GACGTTAGTGCGCCAAAGGATGG + Intergenic
1194973376 X:100368611-100368633 TTAGTTGGTGAGAGACAGGAAGG - Intronic
1195206073 X:102601282-102601304 GAAGATGGTGGGCAATAGGAAGG + Exonic
1195808462 X:108801807-108801829 GATGTTGGTGACCTACAGGTGGG - Intergenic
1196094608 X:111785397-111785419 GAAGTTGGTGACCTACAGATGGG - Intronic
1197380076 X:125728402-125728424 GAAATTTGTGTGCCAGAGGATGG - Intergenic
1197657857 X:129136953-129136975 GAATTAGGAAAGCCACAGGAGGG + Intergenic
1199170158 X:144726158-144726180 GTACTTGGAGAGCCAGAGGACGG + Intergenic
1199499836 X:148497548-148497570 GAAATTGGTGAGGCACTGGCAGG + Intergenic
1200077273 X:153557391-153557413 TCAGTGGGTGAGCAACAGGAAGG - Intronic
1200709455 Y:6470477-6470499 GAAGTTGTTGAGCCAGACCAAGG + Intergenic
1200910968 Y:8531091-8531113 GAAGTTGTTGAGCCAGACGTGGG - Intergenic
1201024657 Y:9694231-9694253 GAAGTTGTTGAGCCAGACCAAGG - Intergenic
1202147458 Y:21814721-21814743 GAAGTGGGAGAGCCTCAAGAGGG + Intergenic
1202343194 Y:23890459-23890481 GAAGTTGGTGATCTACAGATGGG - Intergenic
1202527574 Y:25779626-25779648 GAAGTTGGTGATCTACAGATGGG + Intergenic