ID: 1101759356

View in Genome Browser
Species Human (GRCh38)
Location 12:107646123-107646145
Sequence GGGGGCCTCCGCGAAGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101759348_1101759356 7 Left 1101759348 12:107646093-107646115 CCGGACGCAGCTGAGGCTGCACC 0: 1
1: 0
2: 2
3: 24
4: 240
Right 1101759356 12:107646123-107646145 GGGGGCCTCCGCGAAGCTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1101759346_1101759356 17 Left 1101759346 12:107646083-107646105 CCGGCAAGGGCCGGACGCAGCTG 0: 1
1: 0
2: 2
3: 18
4: 272
Right 1101759356 12:107646123-107646145 GGGGGCCTCCGCGAAGCTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101759356 Original CRISPR GGGGGCCTCCGCGAAGCTGT GGG Intronic
900156541 1:1205517-1205539 GGGGGCCTCAGCCCAGCTGCTGG - Intronic
901218056 1:7565646-7565668 GGGGGCCTCAGCCATACTGTGGG + Intronic
904270874 1:29349329-29349351 TGGGGCCTCCAGGAGGCTGTTGG + Intergenic
905461775 1:38126969-38126991 GGTGGCCCCCTAGAAGCTGTGGG + Intergenic
906637264 1:47417532-47417554 GGGGGGCGCCGCAAAGCTGGGGG - Exonic
908759409 1:67498229-67498251 GGGGGCCACAGTCAAGCTGTTGG - Intergenic
910200040 1:84690214-84690236 GGGAGGCTCCGCGCGGCTGTTGG - Intronic
915469263 1:156115835-156115857 GGGGGCCACCGCCAAGCCCTTGG - Intronic
921127355 1:212189455-212189477 GGTGGCCTCGGGGCAGCTGTTGG + Intergenic
1063415571 10:5870247-5870269 GGGGGCCTCCGTGAAGGGGTCGG - Intronic
1063515271 10:6688916-6688938 GGGGTCCTTCCAGAAGCTGTGGG + Intergenic
1068344397 10:55754708-55754730 TGGGGCCTCTGGGAAGCTGGAGG + Intergenic
1074678478 10:115879842-115879864 GGGAGCCTCGGAGAGGCTGTGGG + Intronic
1076097678 10:127745162-127745184 GGGGGCCTCCGTGCAGGTGATGG - Intergenic
1076909315 10:133379327-133379349 CGGGGCCTCCCCGACGCTGCCGG - Exonic
1076979622 11:197600-197622 GGGGGCCCCACGGAAGCTGTAGG - Exonic
1077023759 11:430830-430852 GGGGGCTTCCGCGGGGGTGTGGG + Intronic
1077023790 11:430910-430932 GGGGGCGTCCGCGGGGGTGTGGG + Intronic
1077023823 11:430990-431012 GGGGGCGTCCGCGGGGGTGTGGG + Intronic
1077023856 11:431070-431092 GGGGGCTTCCGCGGGGGTGTGGG + Intronic
1077023889 11:431150-431172 GGGGGCTTCCGCGGGGGTGTGGG + Intronic
1077023921 11:431230-431252 GGGGGCGTCCGCGGGGGTGTGGG + Intronic
1077023938 11:431270-431292 GGGGGCTTCCGCGGGGGTGTGGG + Intronic
1077024032 11:431511-431533 GGGGGCTTCCGCGGGGGTGTGGG + Intronic
1077024065 11:431591-431613 GGGGGCTTCCGCGGGGGTGTGGG + Intronic
1077452965 11:2662012-2662034 CAGGTCCTCGGCGAAGCTGTTGG - Exonic
1083805221 11:65069487-65069509 GGGGCCCTCTGCAGAGCTGTCGG - Intronic
1090835279 11:130449334-130449356 GGGGGGCTCCGCGGAGCCTTTGG + Exonic
1092904937 12:13092471-13092493 GGGGACCTCCCTGAAGCAGTTGG - Intronic
1096805498 12:54138674-54138696 GGGGGCCTCCCTGAGGCTGGAGG - Intergenic
1098186084 12:67897530-67897552 GGGGCCCTCTGCTAAGATGTGGG + Intergenic
1100980226 12:100157527-100157549 GGGGGCCATGGAGAAGCTGTGGG - Intergenic
1101759356 12:107646123-107646145 GGGGGCCTCCGCGAAGCTGTGGG + Intronic
1106330465 13:28734717-28734739 GGGGGCCTCCAGGGAGCTCTGGG - Intergenic
1112305508 13:98269763-98269785 GGGGGTGTCAGCGAAGATGTTGG + Intronic
1112734367 13:102400527-102400549 GGGGGCGGCCGCGGAGCTGTGGG - Intronic
1117070495 14:52051565-52051587 GGCTTCCTCCGGGAAGCTGTGGG - Intronic
1125606354 15:40941893-40941915 GGGAGCCTCCGAGAAGCTCGCGG - Intergenic
1132534635 16:472001-472023 GGGGGCCGCCGGGAAGGTGGAGG + Intronic
1132542907 16:519637-519659 GGGCGCCACCGCGTTGCTGTTGG + Intronic
1136924787 16:34362057-34362079 GGATGCCTCTGGGAAGCTGTGGG - Intergenic
1136979786 16:35049749-35049771 GGATGCCTCTGGGAAGCTGTGGG + Intergenic
1138461935 16:57154293-57154315 GGGGGCCTCGAGGAAGGTGTTGG + Exonic
1138573454 16:57891021-57891043 GGGGGCCTCTGCACAGCTCTTGG + Intronic
1142259495 16:89036191-89036213 TGTGGCCTCAGCGAAGCTGGGGG - Intergenic
1144951497 17:18996826-18996848 GGTGGCCTCTGGGAGGCTGTGGG - Intronic
1148897114 17:50845448-50845470 TAGGGCCTCCAGGAAGCTGTGGG + Intergenic
1149994512 17:61399719-61399741 GGGGGCCTGGGAGAAGGTGTCGG - Intergenic
1152276802 17:79362740-79362762 TGGGGCCTCCGAGGAGCTCTGGG + Intronic
1152962780 18:89624-89646 CTGGGCCACTGCGAAGCTGTGGG + Intergenic
1160775387 19:852946-852968 AGTGGCCTCCGCGCAGCTGCAGG - Exonic
1160981720 19:1819348-1819370 TGGGGCCTCCGTGCAGCTCTGGG - Intronic
1161072691 19:2270504-2270526 GGGGGCCGCCGGGGAGCTGGGGG + Intronic
1161125683 19:2556036-2556058 GGAGGCTGCCGCGAAGCTGGAGG - Intronic
1162683648 19:12364809-12364831 GGCGGCCCCCGCGAGGCAGTGGG - Exonic
1162921165 19:13903999-13904021 GGAGGCCTCCTCTAAGCTGTGGG + Intronic
1168101710 19:54144895-54144917 CGGGTCCTCAGGGAAGCTGTGGG + Intronic
927970847 2:27305745-27305767 GGAGGCCTCCTCTAAGCTGGTGG + Exonic
928436557 2:31258270-31258292 GGGGTCCTCCAGGAAGCTTTAGG + Intronic
929225236 2:39505493-39505515 GGGGGCCTCTGAGAAGCTTTTGG + Intergenic
929539875 2:42811120-42811142 CGGGGCGTCCGGGGAGCTGTGGG + Intergenic
946366934 2:219254173-219254195 GAGGGCCTCCGCGGAGATGCAGG + Intronic
1169895905 20:10504675-10504697 GGGGGCCTCTGCGAGGCTTGTGG + Intronic
1175268167 20:57714976-57714998 GGGGGCCTCCGTGGAGCTGAGGG - Intergenic
1175312417 20:58020890-58020912 GGGGGCCTCCTCCAAGCAGGTGG + Intergenic
1175763582 20:61577959-61577981 GGGGGCCTCAGGGAAGGAGTGGG - Intronic
1178915693 21:36704617-36704639 GGGAGCCTCCGGGCGGCTGTGGG + Intronic
954655183 3:52190279-52190301 GGAGGCCTCTGCCAGGCTGTGGG + Intergenic
972561326 4:40231591-40231613 GGGGGCCTGGGAGAAGCTGCTGG - Intronic
987066336 5:14293438-14293460 GGGGGCCCCAGCAAAGCTGCTGG + Intronic
998390449 5:141783965-141783987 GGGGAGCTCTGTGAAGCTGTGGG - Intergenic
1002421044 5:179149176-179149198 GGGGGCCTTCGGGAAGCGTTAGG + Intronic
1002477624 5:179477276-179477298 GCTGGCCTCTGTGAAGCTGTGGG + Intergenic
1020268437 7:6577503-6577525 GGCCGCCTCCGCGGGGCTGTGGG + Exonic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1029133381 7:98350702-98350724 GGGGGCCTTAGGGTAGCTGTAGG - Intronic
1029417198 7:100450665-100450687 GGCGGCCGCGGCGAAGCTGGGGG - Intergenic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1033539818 7:142346028-142346050 GGGGCCCTCCAGGAAGCTGTGGG + Intergenic
1035456106 7:159010017-159010039 GGGGGCATCCGCCATGGTGTGGG - Intergenic
1038542697 8:28402452-28402474 GGCGGGCTCCACGAAGCTGGAGG - Intronic
1048580633 8:135727552-135727574 GGCAGCCTCCATGAAGCTGTGGG - Intergenic
1049575695 8:143388734-143388756 GGCGGCCTCCAAGAAGCTGCTGG + Intergenic
1061090016 9:128421113-128421135 GGGGCCATCTGCGAAGCTGGGGG - Intronic
1061187036 9:129060779-129060801 ACGGGCCTCCTCGAAGCTGTTGG + Intronic
1061878286 9:133555849-133555871 TGGGGCCTCGGAGGAGCTGTTGG - Exonic
1062174801 9:135155431-135155453 GGGGGGCTCCTGGAAGCTGCTGG - Intergenic
1062499807 9:136847516-136847538 GGGGGCCTGGGCGGAGCTGGAGG - Exonic
1062735359 9:138134494-138134516 CTGGGCCACTGCGAAGCTGTGGG - Intergenic
1197693134 X:129523486-129523508 GGGGGCCTGAGCGAAGGGGTTGG - Exonic