ID: 1101759908

View in Genome Browser
Species Human (GRCh38)
Location 12:107649965-107649987
Sequence CAAAGCTCCCAGTTTCAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101759908_1101759915 27 Left 1101759908 12:107649965-107649987 CCTAATTGAAACTGGGAGCTTTG 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1101759915 12:107650015-107650037 TAATCCTCAGCAAAAGAGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101759908 Original CRISPR CAAAGCTCCCAGTTTCAATT AGG (reversed) Intronic
900741067 1:4331072-4331094 CAAGGTTCCCAGTTTCTGTTTGG - Intergenic
902540316 1:17149691-17149713 CCAAGCTCCCAGTTTCCTTATGG + Intergenic
903776840 1:25799275-25799297 CAAAGCCCCCAGTTACCATGGGG - Intergenic
904417409 1:30371801-30371823 CAAAGATTCCACTTTCAATGTGG - Intergenic
906028139 1:42692988-42693010 CAAAGGTCACAGTTCCCATTAGG + Intronic
907887089 1:58602679-58602701 CAATGCTCCCAGATTAAATCAGG - Intergenic
908678914 1:66636813-66636835 CAAAATTCTCAGTTTCCATTGGG - Intronic
909336427 1:74480222-74480244 CAAAGCTCCCAACTTCACTCTGG - Exonic
909900217 1:81125128-81125150 CAAAGCTCCCAGTTACATACAGG + Intergenic
910561867 1:88599766-88599788 AAAAGCTGCCAGTTTTAAGTGGG + Intergenic
914937308 1:151992836-151992858 CAGAGCTCCTGGTTTCACTTAGG + Intronic
915739040 1:158104115-158104137 CAAAGCTCCCTGGTTCAATTTGG - Intergenic
915811510 1:158918086-158918108 CAAAGATCACATTTTCAATTAGG + Intergenic
916837376 1:168561002-168561024 CAAAGCCCCTAGTTTACATTAGG - Intergenic
917753096 1:178072212-178072234 CAATGCTTCTACTTTCAATTGGG + Intergenic
918230856 1:182530126-182530148 CACAGCCCCCATTTTCAATCTGG - Intronic
920003182 1:202813006-202813028 CCAAATTCCCAGTTTCAACTGGG - Intergenic
920960880 1:210663116-210663138 CAATGCTCACAGTCTAAATTAGG + Intronic
921366907 1:214383031-214383053 CAAAGCTCAGACTTCCAATTGGG - Intronic
921672994 1:217946908-217946930 CAAAGCTCCCATCTTCAGCTTGG + Intergenic
923909871 1:238429438-238429460 CAACCCTCCTAGTTTAAATTAGG - Intergenic
924824634 1:247526492-247526514 CAAAGCTCCCAGTTTCCAGAAGG - Intronic
1063853133 10:10215949-10215971 CAAAGCTCATAGTTTACATTAGG + Intergenic
1063950046 10:11213746-11213768 CTAAGCTGACTGTTTCAATTTGG + Intronic
1065541239 10:26770065-26770087 CAAAGCTGGCAGATTCATTTGGG + Intronic
1065725318 10:28663147-28663169 CAATGCTGTCAGTTTCAGTTAGG + Intergenic
1068686889 10:59879776-59879798 CAAAGCCCCAAGTTTCCAATAGG + Intronic
1071156947 10:82700968-82700990 CAAATCTCCCATTTTTAAATAGG - Intronic
1071716298 10:88099703-88099725 CAAAGTGCCCAGTATAAATTTGG + Intergenic
1073555440 10:104446081-104446103 CAAGGCTTCAAGATTCAATTTGG - Intronic
1073990097 10:109252825-109252847 CACAGTTCCCAGTTTCCATATGG - Intergenic
1075419782 10:122292079-122292101 CAGAGCTCCCAGTTTGCACTGGG + Intronic
1076366127 10:129922058-129922080 CAAAGCTCCCTGAATCCATTGGG + Intronic
1082267044 11:50130279-50130301 CAAAGCTCTCATACTCAATTTGG + Intergenic
1082289045 11:50348289-50348311 CAAAGCTCTCATACTCAATTTGG - Intergenic
1082680952 11:56169320-56169342 AAAAGCTCCTTGTTTTAATTAGG - Intergenic
1083945743 11:65921614-65921636 CCCAGCTCCCAGTTTCATGTGGG - Intergenic
1085122678 11:73977238-73977260 GAAAGCACCAAGTTTCATTTTGG - Intronic
1087173635 11:95075914-95075936 CAAAGCTCATAGTTTATATTAGG + Intergenic
1087772638 11:102227248-102227270 TAGAGCTGCCAGCTTCAATTAGG + Intronic
1088634381 11:111805777-111805799 CAAAGCCCACAGTTTACATTAGG - Intronic
1089138746 11:116269956-116269978 CAGGGCTCCCAGTTGCACTTTGG + Intergenic
1089962128 11:122625497-122625519 CAAAGCTCATAGTTTACATTAGG - Intergenic
1091981972 12:4871916-4871938 TAAAGCTTCCAGTTTCAATCTGG + Intergenic
1093299840 12:17440679-17440701 CAAAGTTCACAGTTTATATTAGG + Intergenic
1095074922 12:37907577-37907599 TAAATCTCCAAATTTCAATTTGG + Intergenic
1095835426 12:46632817-46632839 CAAAGCTCATAGTTTACATTAGG + Intergenic
1099013159 12:77315881-77315903 CAAAGTTCCTAGTTTTAAATGGG - Intergenic
1099655745 12:85488160-85488182 TTAAGCTCACACTTTCAATTTGG + Intergenic
1101759908 12:107649965-107649987 CAAAGCTCCCAGTTTCAATTAGG - Intronic
1103720422 12:122971774-122971796 CAAAGCTGGCAGTTTACATTAGG - Intronic
1107867204 13:44714423-44714445 CAGGGCTCCCTGTTTCACTTAGG - Intergenic
1108103387 13:46982542-46982564 CAAAGTTCACAGTTTATATTAGG + Intergenic
1112023004 13:95387960-95387982 CAGAGCTTCCAATTTCAATATGG - Intergenic
1112693487 13:101920543-101920565 CATAGCTGTCATTTTCAATTAGG - Intronic
1112705029 13:102059046-102059068 TACAGCCCCCAGTCTCAATTTGG - Intronic
1113544947 13:111141164-111141186 TAAAGTTCACAGTTTCCATTAGG + Intronic
1115659506 14:35478312-35478334 CAATGCTCCCAGTTTCATCGGGG + Intergenic
1116358990 14:43969012-43969034 GACAGCTCCATGTTTCAATTTGG - Intergenic
1116826762 14:49680372-49680394 CTAAGCTCCCAGTTTTAATAAGG + Intronic
1116917579 14:50540090-50540112 CATGGATCCCAGTTTCAATGTGG - Intronic
1119281299 14:73410911-73410933 AAAAGCTCCCAATTTTAATAGGG + Intronic
1119537581 14:75415314-75415336 CAAAGCTCACAGTTTCATTAGGG - Intergenic
1122723871 14:103737693-103737715 CAGTGCTCCCAGTTTCTATATGG - Exonic
1125323707 15:38515025-38515047 GGAAGCTCCCAGCTTCCATTTGG - Intronic
1126632739 15:50754285-50754307 CAAAGCTCATAGTTTACATTAGG + Intronic
1128777704 15:70336221-70336243 CTAAGTTCACAGTTTCTATTAGG - Intergenic
1129530902 15:76263681-76263703 CAAAAATTCCAGTTTCCATTTGG + Intronic
1129779178 15:78258640-78258662 TGTAGCTCTCAGTTTCAATTTGG - Intergenic
1130749495 15:86695306-86695328 CAACCCTCCCAGTTTAAATCAGG - Intronic
1131371068 15:91882366-91882388 CATAGCTCCCAGTTTAAGGTTGG + Intronic
1131858052 15:96620079-96620101 CATAGCAGCCAGTTTCAATGTGG - Intergenic
1134314457 16:13105661-13105683 CTAAGCAGCCAGTTTCATTTTGG + Intronic
1139499967 16:67354769-67354791 CAAAGTTCACAGTTTACATTAGG + Intronic
1149496840 17:57123895-57123917 CAAATCTCTAAGTTTCCATTGGG + Intergenic
1153814148 18:8778712-8778734 CCAACCTCCCAGTCTCATTTTGG + Intronic
1155001805 18:21694985-21695007 CAGAACTCCCAATTTTAATTGGG + Intronic
1155746201 18:29358666-29358688 TAAAGATCCCAGTGTCAACTAGG - Intergenic
1158703303 18:59768903-59768925 CATGGCTCCCAGTTTCAAGTGGG + Intergenic
1159393284 18:67823205-67823227 CAAAGTCCACAGTTTCAATTAGG + Intergenic
1163328795 19:16622770-16622792 CAAAGCACCCAGTTTCCAGAAGG + Intronic
1163958145 19:20662858-20662880 CAAAGAGCCCAGTTGCAACTGGG + Intronic
1167804714 19:51772978-51773000 CAAAGCCCACAGTTTACATTAGG + Intronic
926761343 2:16281483-16281505 CATAGCCCGCAGTTTTAATTTGG + Intergenic
928269263 2:29841708-29841730 CAATTCTGCCCGTTTCAATTTGG - Intronic
929431581 2:41892194-41892216 CAAGGCAGCCAATTTCAATTTGG - Intergenic
930373568 2:50536044-50536066 CAAAGCCCCCTGTTTTAAATTGG + Intronic
931789515 2:65652156-65652178 AATAGCTCCCAGTTACATTTAGG + Intergenic
936770728 2:115909852-115909874 CAAATCTCGCATTTGCAATTAGG - Intergenic
937655936 2:124376398-124376420 CAAAGCACAGAGTTTCATTTGGG + Intronic
938841376 2:135168072-135168094 CAATGCCCCCACTTTTAATTTGG + Intronic
939209593 2:139156763-139156785 CAGAGCTCTCAGTGTTAATTTGG - Intergenic
943268780 2:185771497-185771519 CAAAGGGCCCAGGTACAATTTGG - Intronic
944160669 2:196656022-196656044 CAAAGCTCCCAGTTTCTGCCTGG - Intronic
945061963 2:205917030-205917052 CAAAGTCCCTAGTTTCCATTAGG - Intergenic
945778045 2:214131917-214131939 CAAAGCTCACAGTTTACATTAGG - Intronic
946570934 2:221023390-221023412 CAATCCTCCTAGTTTAAATTAGG - Intergenic
946667351 2:222064990-222065012 CCAGCCTCCCAGTTTCAATCTGG + Intergenic
1169780341 20:9302509-9302531 CACAGCCACCAGTTTCAAATTGG + Intronic
1170198806 20:13720101-13720123 AAAAGCTCTCAGTTCCTATTTGG + Intronic
1172608919 20:36234906-36234928 CAAAGCTCCCTGTTTCAGTTGGG - Intergenic
1173846691 20:46192992-46193014 CAAAGCTTCCAGTCTCCATGTGG - Intronic
1176998128 21:15579966-15579988 CAAAGCTGCCAGTTTGGAGTGGG + Intergenic
1180978981 22:19869847-19869869 AAAAGATTCCAGTTTTAATTAGG + Intergenic
1182464862 22:30508457-30508479 CAAAGTTCCTAGTTTACATTAGG + Intergenic
1184816147 22:46872656-46872678 CAAAGCTGCCTGTTTCATTAGGG - Intronic
1185171044 22:49294863-49294885 CACAGCTCCAAGTTTCACTTTGG - Intergenic
951639049 3:24813819-24813841 CAGAGATCCCAGTTCCAATGAGG - Intergenic
955073861 3:55594437-55594459 ATAATCTCCCAGTTTCTATTTGG - Intronic
956645883 3:71455655-71455677 TAAAGGCCCAAGTTTCAATTTGG + Intronic
957670774 3:83299606-83299628 CAAAGTTTACAGTTTAAATTGGG - Intergenic
957689216 3:83545800-83545822 CAAAGCTCCCAGTGTCTACCTGG - Intergenic
958478856 3:94621090-94621112 CAAAGCTCCCAGGTTTAGTTTGG + Intergenic
959165614 3:102774274-102774296 TAAACCACCCAGTTACAATTTGG + Intergenic
959230917 3:103649849-103649871 CAAAGCTCCAAGATTTAACTAGG + Intergenic
960904560 3:122586813-122586835 CAAAGCCCCTAGTTTATATTTGG + Intronic
961913608 3:130346534-130346556 CAAAGATCACAGTTTCGTTTGGG - Intronic
962187503 3:133275195-133275217 AAAAACTCCCATTTTCAATTGGG - Intronic
963107237 3:141657788-141657810 AAAAGCTCCCATTTTCAGGTGGG + Intergenic
963806691 3:149729764-149729786 AAAAGATCCCACTTTCATTTGGG + Intronic
964163775 3:153676505-153676527 GAAAGCTCTCATTTTCATTTTGG - Intergenic
964297643 3:155251672-155251694 CAAAGCTGCTAGTTTCTAGTGGG + Intergenic
966763506 3:183437798-183437820 AAAAGCTGCTAGTTTCAAGTGGG + Intergenic
967959719 3:194910739-194910761 CAAAGCTCATAGTTTACATTAGG + Intergenic
969958753 4:10920608-10920630 CAAAGCTCACAGTTTACATTAGG - Intergenic
970834038 4:20379139-20379161 CAAAGCCCACAGTTTACATTAGG - Intronic
972502567 4:39692148-39692170 AAAAACTGCCAGTTTCACTTTGG - Intergenic
973881027 4:55271202-55271224 CAAAGTTCACAGTTTACATTAGG - Intergenic
975573290 4:75839252-75839274 CAAAGCACCCAGTTGGTATTTGG + Intergenic
977187021 4:93951497-93951519 CTCAGCTCCCAGTTTCACCTAGG + Intergenic
977770640 4:100854108-100854130 CAAAGCAACCAGTTTAAATTTGG - Intronic
978824609 4:113006313-113006335 AAAAGCTCCCACATTCAATAAGG + Intronic
981735565 4:147946525-147946547 CAAAGCTTCCATTTTTAAATGGG - Intronic
987093248 5:14525841-14525863 CACAGCTCCCAGTTTCCCTTGGG + Intronic
987495657 5:18641058-18641080 AAAAGCCACCGGTTTCAATTAGG + Intergenic
991981423 5:72235482-72235504 CAAAGGTCCTAGTTTACATTAGG - Intronic
996037696 5:118776843-118776865 GAAAGCTCCCTGTCTCAGTTTGG + Intergenic
996546984 5:124690355-124690377 CAAAGCTCCTAGTTTATATTAGG - Intronic
996630673 5:125628372-125628394 CAAAGCTTGCATTTTCTATTAGG - Intergenic
999233346 5:150075858-150075880 CAAAGCTCCCAGTGCAGATTGGG + Intronic
1001728424 5:173928270-173928292 CAAAGTTCACAGTTTACATTAGG - Intronic
1001909907 5:175507287-175507309 CAAAGATCCCATTTCCAAATAGG + Intronic
1003712658 6:8610081-8610103 CAAAGCACACAGTTTACATTAGG + Intergenic
1010280297 6:74015523-74015545 AACAGCTCCAAGTTTCATTTAGG + Intergenic
1011007713 6:82666091-82666113 CAAAGCTCATAGTTTACATTAGG - Intergenic
1012147052 6:95697970-95697992 CAAAGTCCACAGTTTCCATTAGG + Intergenic
1012952305 6:105531190-105531212 CAAAGATCCCAGTAACTATTAGG - Intergenic
1013940778 6:115658968-115658990 CAAACCTCCTAGCTTAAATTAGG - Intergenic
1014608355 6:123507695-123507717 CAAATCACCCAGTTTTATTTAGG + Intronic
1014972926 6:127841079-127841101 CAAAGTTCACAGTTTATATTTGG - Intronic
1016197175 6:141358521-141358543 CAACCCTCCCAGTTTAAATCAGG - Intergenic
1018460308 6:163992616-163992638 GACAGCTCCCATTTTCCATTGGG + Intergenic
1018939850 6:168301856-168301878 CATAGCTCCCAGTTCCACCTGGG - Intronic
1019728799 7:2618493-2618515 AAAAGCTCACACTTTCAAGTTGG - Intergenic
1020424357 7:8046970-8046992 AAAAGTTACCAGTTTCAATGAGG + Intronic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1022580858 7:31552829-31552851 CCAAGCTCCCTGTCTCAGTTTGG - Intronic
1024594445 7:50920291-50920313 CAAAGCTTTCAGTTACAATCCGG - Intergenic
1025059699 7:55795220-55795242 CAAAGCCTCCAGCTTCTATTTGG + Exonic
1028951477 7:96640703-96640725 CAAAGCTCATAGTTTCCATTAGG - Intronic
1031033956 7:116766851-116766873 CAAAGCCACCAGTTTAATTTTGG + Intronic
1031113646 7:117642826-117642848 CAAGGCTCCCACTGTAAATTTGG - Intronic
1031338171 7:120563850-120563872 CAAAGCCACCAGATTGAATTAGG + Intronic
1031767547 7:125800993-125801015 CAATGCTCCCAGTTTCATCAGGG - Intergenic
1036493328 8:9247759-9247781 CACAGCTCCCGGTTGTAATTCGG - Intergenic
1038872171 8:31506695-31506717 AGAAGCTCCCAGGTTTAATTGGG + Intergenic
1048659681 8:136584337-136584359 CAAAGCTCACTGTTCCAATAGGG + Intergenic
1051062556 9:13061299-13061321 CACAGCTCCAAGTTTTAATAAGG - Intergenic
1051124264 9:13786316-13786338 CAAAGCAGCCAGTCTCACTTCGG - Intergenic
1051229017 9:14934380-14934402 CAAAGATCATAGTTTCAATTTGG + Intergenic
1052101050 9:24446650-24446672 CAAAGCTGCTAGTTTTAAATGGG - Intergenic
1052804192 9:32998216-32998238 CTAAGCTGACAATTTCAATTTGG + Intronic
1053521893 9:38789048-38789070 TAAATGTCCCAGTTACAATTTGG - Intergenic
1054194060 9:62013036-62013058 TAAATGTCCCAGTTACAATTTGG - Intergenic
1054644347 9:67575655-67575677 TAAATGTCCCAGTTACAATTTGG + Intergenic
1054996993 9:71403089-71403111 CAAAGTTCCCAGTCTGAGTTGGG - Intronic
1056070509 9:82981881-82981903 CAAAGCTCACTGCTTGAATTTGG - Exonic
1058410030 9:104721574-104721596 CTAAGCTACCAGTTTCAGCTAGG - Intergenic
1058926217 9:109666638-109666660 CCAGGCTCCCACTTGCAATTTGG + Intronic
1058941195 9:109814138-109814160 TGAAGCTCCCAGTTTCACATTGG + Intronic
1059171196 9:112126797-112126819 CAAAGCTCCAAATTTCATTTTGG + Intronic
1059343966 9:113615874-113615896 CAAAGCTCTCAGCTCCAATGAGG - Intergenic
1060183331 9:121548713-121548735 CAAATCTCCAAGTTTCCATCTGG - Intergenic
1060461664 9:123861236-123861258 CAAATATTCAAGTTTCAATTTGG + Intronic
1061265383 9:129501816-129501838 CAAAGCAGCCAGCTTCAATCTGG + Intergenic
1185821369 X:3207951-3207973 CAAATCTCTCTGTTTCTATTAGG - Intergenic
1186120778 X:6358676-6358698 CAAAGTTCACAGTTTACATTAGG + Intergenic
1187034089 X:15519404-15519426 CAAAGATCCTAGTTCCAATAAGG - Intronic
1187254826 X:17633105-17633127 CAACACTCACAGTTTAAATTGGG - Intronic
1187564775 X:20438397-20438419 CAAAGCTGACAGAGTCAATTAGG - Intergenic
1188042646 X:25387708-25387730 CAAAGCTCACAGTTTACACTGGG + Intergenic
1190739884 X:53281654-53281676 CAAAGTTTCCAGTTGCAATCTGG - Intronic
1192288901 X:69770552-69770574 CAAATCTCCCATTTTCTAATGGG + Intronic
1196925073 X:120625464-120625486 TCAAGCTCCCAGCTGCAATTTGG - Intergenic
1197058245 X:122146210-122146232 CAAATTGCCCAGTTTTAATTTGG - Intergenic
1197551330 X:127896325-127896347 CAGTGCTCCCAGCTTCATTTGGG - Intergenic
1197881091 X:131167454-131167476 GAAATCTTCCAGTTTTAATTGGG + Intergenic
1198610742 X:138396939-138396961 CACATCTCCCAGTTTTTATTTGG + Intergenic
1198616787 X:138466614-138466636 CAATCCTCCTAGTTTAAATTAGG + Intergenic
1198692374 X:139298296-139298318 CAAAGCTTCCAGTCTCAAATTGG - Intergenic
1199036748 X:143060080-143060102 AAGAGCTCCCAGTCTGAATTAGG - Intergenic
1201477265 Y:14396140-14396162 CAAAGTTCACAGTTTACATTAGG - Intergenic