ID: 1101761004

View in Genome Browser
Species Human (GRCh38)
Location 12:107659129-107659151
Sequence CTGAAGGCATGCTAGGAAAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101761004_1101761008 7 Left 1101761004 12:107659129-107659151 CCTATTTCCTAGCATGCCTTCAG 0: 1
1: 0
2: 2
3: 9
4: 196
Right 1101761008 12:107659159-107659181 TGCCAGACCCTAGATTGTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101761004 Original CRISPR CTGAAGGCATGCTAGGAAAT AGG (reversed) Exonic
900817317 1:4858505-4858527 CTGAATGCAGCCTAGGAACTTGG + Intergenic
903218916 1:21858077-21858099 CTGAAGGGAGGCCAGGAAGTGGG - Intronic
907200888 1:52726283-52726305 TTGAAGGGATGCTAGGATTTGGG + Intergenic
907495685 1:54842772-54842794 CTGAAGGCATACTAAGAACCTGG + Intergenic
912246858 1:107968675-107968697 GTGAAGGCAAGTTGGGAAATAGG + Intergenic
914250640 1:145918912-145918934 CTGGAGGCGTGCTAGGGAGTAGG - Intergenic
915537513 1:156546056-156546078 CTGAGGGCAGGCTTGGAAATGGG - Intronic
917199524 1:172500147-172500169 CTGACTGCCTGCTAGGAAAAGGG - Intergenic
917279815 1:173369916-173369938 CTATAGGGAGGCTAGGAAATGGG - Intergenic
920508088 1:206531254-206531276 CTGAATGCTTGCTAGTGAATGGG + Intronic
920512521 1:206561427-206561449 CTTAAGGCATGCTAGCTAAGGGG + Intronic
920607018 1:207398906-207398928 CTTAAGCCATGCTAGCAGATGGG - Intergenic
921789872 1:219277703-219277725 CTGAAGGCATTTTAACAAATTGG + Intergenic
922011068 1:221588059-221588081 CTGCATGCAGGCTAGGAACTTGG + Intergenic
924830650 1:247591011-247591033 CTGAAGGCTTCCTGGGAAAGTGG + Intergenic
1063984465 10:11487448-11487470 CTGAAGGTAAGCTATCAAATAGG + Intronic
1064891316 10:20177316-20177338 CTGGAGGCATGCTAGGGAAGAGG - Exonic
1065924038 10:30420028-30420050 CTAAAGACTTGCTAGAAAATAGG - Intergenic
1069344176 10:67447593-67447615 CTGAATACATGGGAGGAAATGGG - Intronic
1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG + Intergenic
1071426139 10:85554997-85555019 ATGAAGGGTTGCTAGGAAAAGGG + Intergenic
1071710898 10:88048145-88048167 CTGAAGGCTTCCTGAGAAATAGG - Intergenic
1074486220 10:113884000-113884022 CTGGAGGCATGATGGGAGATGGG + Intronic
1074808076 10:117073937-117073959 CTGCAGGCATTCTGGGATATAGG - Intronic
1080016614 11:27513612-27513634 CTAAAGGGAAGCTAGGAAAATGG + Intergenic
1082829193 11:57602851-57602873 TTGAAGGTATGCTAGGACTTTGG + Intronic
1083083764 11:60121323-60121345 CTGGTGGCCTGCTAGGAACTGGG + Intergenic
1083153159 11:60806242-60806264 CTGAACGGATGCAAGGCAATCGG - Intergenic
1085121735 11:73971719-73971741 CTGAAGGCATTCCATGGAATTGG - Intergenic
1085379643 11:76103013-76103035 CTGAAGGCCAGCAAGTAAATGGG - Intronic
1086755390 11:90555464-90555486 CAGAAGGCATGTTAGAACATGGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091573967 12:1715119-1715141 CTGTAGGAAGGCTAGGATATGGG + Intronic
1095808709 12:46349174-46349196 CTGAAGGCTTGGTCTGAAATGGG + Intergenic
1096202765 12:49697299-49697321 CTAAAGGTGTGCTAGGAAATGGG + Intronic
1096670527 12:53195832-53195854 CTGGAGGCTTGCTATGGAATAGG + Intronic
1099037125 12:77602565-77602587 TGGGAGGAATGCTAGGAAATAGG + Intergenic
1100050826 12:90446321-90446343 CTATAGGGATGCTAGGATATGGG + Intergenic
1100209733 12:92388643-92388665 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1101761004 12:107659129-107659151 CTGAAGGCATGCTAGGAAATAGG - Exonic
1103346816 12:120256681-120256703 TTGAAAGCAGGCTATGAAATGGG - Intronic
1104306124 12:127612309-127612331 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1104655413 12:130570919-130570941 CTGAAGGCCTGCTACGCATTGGG + Intronic
1106081879 13:26507001-26507023 CTGAAGGCGGGTTAGGGAATAGG - Intergenic
1108001704 13:45910445-45910467 CTGAGGGCATCCAAGGAAGTGGG - Intergenic
1108608265 13:52061913-52061935 TTGAAGGCATTCCAGGAAACAGG - Intronic
1110693640 13:78461264-78461286 CTGAAAACATGCTATGAACTTGG - Intergenic
1113061867 13:106330916-106330938 ATGATGGCACGCTTGGAAATGGG + Intergenic
1114266779 14:21076941-21076963 CTGAAGACATTCTAGGAGAGAGG + Intronic
1114937789 14:27565534-27565556 GAGAAGGCAATCTAGGAAATGGG + Intergenic
1116956276 14:50926985-50927007 CTGAAGGTATTGTATGAAATAGG + Intronic
1117480135 14:56134870-56134892 CTGAAGTCAGGTTGGGAAATTGG - Intronic
1120333256 14:83120718-83120740 CAGAAGGCATGTTGGGAAAATGG - Intergenic
1120931752 14:89855772-89855794 GTGGGGGCATGCCAGGAAATGGG - Intronic
1121327614 14:93030656-93030678 CAGAGGGCATGATAGGAAAGGGG + Intronic
1202926393 14_KI270724v1_random:29866-29888 ATAAAGGCATTATAGGAAATGGG - Intergenic
1123669103 15:22636827-22636849 CTGACGGCCAGCAAGGAAATGGG + Intergenic
1124525073 15:30443302-30443324 CTGACGGCCAGCAAGGAAATGGG + Intergenic
1124773581 15:32564411-32564433 CTGACGGCCAGCAAGGAAATGGG - Intergenic
1126072125 15:44874363-44874385 CTGTAGGGAGGCTAGGATATGGG + Intergenic
1126710316 15:51447637-51447659 CAAAAGCCATTCTAGGAAATGGG - Intergenic
1130392940 15:83474885-83474907 CAGAAGGCAGGCTTTGAAATGGG + Intronic
1130770639 15:86920229-86920251 CTGACAGCTGGCTAGGAAATGGG - Intronic
1130838185 15:87672452-87672474 AGGAAGGCAGGCTGGGAAATGGG - Intergenic
1131831227 15:96355711-96355733 CTGAAGTCCTGCTAGGAAATTGG + Intergenic
1131875904 15:96806405-96806427 TTGAAGGCATGCTAGAAGCTGGG + Intergenic
1133732322 16:8588556-8588578 CTGAAAGCAAGAAAGGAAATGGG - Intronic
1135357921 16:21785417-21785439 CAGAAGGCAGATTAGGAAATAGG - Intergenic
1135456426 16:22601535-22601557 CAGAAGGCAGATTAGGAAATAGG - Intergenic
1137262970 16:46846024-46846046 CTGAAGGCTTGACAGGAACTAGG + Intergenic
1139310080 16:66020917-66020939 CTGAATGACTGCTAGGACATGGG + Intergenic
1145319036 17:21752536-21752558 CTGAAGGGATGCCAGGAAAAGGG - Intergenic
1148148159 17:45379053-45379075 CTGAAGGCATTCTAGGATGGAGG - Intergenic
1149073838 17:52575222-52575244 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1149112771 17:53053581-53053603 CTTAAGGAATGCTTGCAAATGGG + Intergenic
1150936046 17:69636869-69636891 CTGAAAGCAAGTAAGGAAATGGG - Intergenic
1159019512 18:63131812-63131834 CTGAAGCCATCCTGGGAAACCGG + Intronic
1159641664 18:70870428-70870450 CTGAAGGCAGTCAAGGAAAAAGG - Intergenic
1159688939 18:71460776-71460798 CATAAGGCATTCTAGGATATTGG + Intergenic
1162107859 19:8381513-8381535 CTGTAGGGAGGCTAGGATATGGG - Intronic
1163578081 19:18122331-18122353 CTGAGGGCATGGTCGCAAATGGG + Intronic
1165530937 19:36400801-36400823 ATGAAGGGAAGCTGGGAAATAGG - Intronic
1167107287 19:47437686-47437708 CTGAAGGCAAGCAAGGAAAAGGG + Intronic
1167581657 19:50347738-50347760 CTGAGGCCATGTTTGGAAATTGG - Intronic
929580487 2:43079045-43079067 TTGAGGGCATGTAAGGAAATGGG - Intergenic
930692500 2:54379123-54379145 ATGAAGCCAGGCTAGGAAACTGG - Intronic
931166793 2:59757464-59757486 CTGAATGTAAGCTAGGAAAAGGG - Intergenic
931199297 2:60081650-60081672 CTGAAGCATTGATAGGAAATAGG - Intergenic
932763265 2:74454402-74454424 CAGAAGGCTATCTAGGAAATTGG - Intergenic
935173071 2:100625884-100625906 CTGGAGCCATGCCAGGAAACAGG + Intergenic
935404709 2:102697075-102697097 CTGAGGGGATGCTAGGGAAAGGG - Intronic
935805950 2:106747810-106747832 CTGCAGGCTTGCTAGACAATGGG + Intergenic
939039950 2:137176694-137176716 CTGCAGTCTTGCTAGGGAATTGG + Intronic
939323726 2:140659054-140659076 CTGAAAACATGTTAGGCAATGGG + Intronic
939842944 2:147210736-147210758 TTGAAGGCCTGCTTAGAAATGGG - Intergenic
940811163 2:158244509-158244531 CTGATGGCCAGCAAGGAAATGGG - Intronic
940836745 2:158530325-158530347 ATGAAGGCATGCCAGAAAACTGG - Intronic
942561567 2:177225327-177225349 CTGAAAGCTAGCTAGGAAATGGG + Intergenic
947482457 2:230513092-230513114 CTCATGGCCTGTTAGGAAATGGG - Intronic
948021332 2:234736222-234736244 CAGAGGGCATGTTAGGAAAATGG - Intergenic
948414472 2:237792458-237792480 CTGGAGGCAGGCTTGGGAATAGG - Intronic
1170180349 20:13523155-13523177 TTGAAGGGTTGCTAAGAAATGGG + Intronic
1170683418 20:18547137-18547159 GTCAAGGCATTCTAGGAAAGAGG + Intronic
1171782204 20:29429375-29429397 GTAAAGGCATTATAGGAAATGGG + Intergenic
1172201936 20:33132726-33132748 CTGCAGGAATTCTAGGGAATTGG - Intergenic
1174007720 20:47423891-47423913 CTGAATTCATCCTAGAAAATAGG + Intergenic
1174439164 20:50535255-50535277 CTGAAGGCATGCCTGGATAAAGG + Intronic
1175008855 20:55714124-55714146 CAGAGGGGATGCCAGGAAATGGG + Intergenic
1178838866 21:36122336-36122358 ATGAAGGCATGGAAGGAAATGGG + Intergenic
1179342512 21:40526062-40526084 CAGAAAGTATCCTAGGAAATTGG - Intronic
1181261292 22:21599747-21599769 CTGACGGCATCCTGGGGAATGGG + Intronic
1181729416 22:24833795-24833817 ATGAAGGCATGCTAGACAGTGGG + Intronic
1182039393 22:27224731-27224753 CAGAAGGCTTGCCAGGAAGTGGG + Intergenic
1184975295 22:48057498-48057520 CTCAAGGCAGGAGAGGAAATAGG + Intergenic
1185167767 22:49272007-49272029 CTGAAGGCATGGGAGGTACTTGG - Intergenic
949272309 3:2233013-2233035 CTGAGTGCATGCAAAGAAATTGG + Intronic
950582447 3:13871504-13871526 CTAAAGGCCTGCTAGGAAGGAGG - Intronic
951833170 3:26952493-26952515 TTGAAGCCATGATGGGAAATGGG - Intergenic
952994690 3:38867953-38867975 CAGAAGGTATGCTAGGCACTAGG - Intronic
953216634 3:40924423-40924445 CAGAACCCATGCTAGGAATTTGG - Intergenic
955433301 3:58872130-58872152 CAGAAGGCTTTCTAGGTAATGGG - Intronic
955945576 3:64190621-64190643 CAGAGAGCATGCTAGAAAATTGG - Intronic
955961563 3:64346238-64346260 GTGAAGGCATTCTAGGCAAAAGG + Intronic
956517307 3:70063350-70063372 CAGAAGGCATCACAGGAAATGGG - Intergenic
957911814 3:86628159-86628181 CTGAAAACATGCTGGAAAATGGG - Intergenic
959088280 3:101874702-101874724 CTGGATACATGGTAGGAAATGGG - Intergenic
962396444 3:135018810-135018832 CTGAAAACATGTTAGTAAATTGG - Intronic
962888101 3:139646727-139646749 ATGCAGGCCTGCTATGAAATTGG + Intronic
964830063 3:160874349-160874371 CTGAAGGGAGGCTAGGACACAGG - Intronic
965062672 3:163803632-163803654 CTGTAGGAAGGCTAGGATATGGG - Intergenic
966149942 3:176856739-176856761 CTGAAGGCATTCTTAGAAATGGG - Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
970923836 4:21427150-21427172 GTGATGTTATGCTAGGAAATGGG + Intronic
971443364 4:26714949-26714971 CTTGAGGCATTCTAGGATATTGG - Intronic
975362960 4:73493211-73493233 ATGCAGGCATGCTAAGTAATGGG + Intronic
976989959 4:91353856-91353878 CTGTAGCCATGTTTGGAAATTGG - Intronic
977267012 4:94867203-94867225 CTGGAGGCATGCTTGAGAATGGG - Intronic
978100881 4:104840199-104840221 GTGAAGACATGTTAGGAGATAGG + Intergenic
978932365 4:114330566-114330588 GTGAAGGCATGCTGGGGATTTGG - Intergenic
979399877 4:120236430-120236452 CTGAAGCTCTGCTAGGAGATAGG - Intergenic
979543210 4:121910248-121910270 CTGAAGGAAAGCTAGGAATCTGG + Exonic
983188989 4:164734559-164734581 CTGAAAGCCAGCAAGGAAATGGG - Intergenic
983701532 4:170601347-170601369 ATAATGGCAAGCTAGGAAATTGG - Intergenic
983835005 4:172375116-172375138 CTATAGGGATGCTAGGATATGGG + Intronic
984352919 4:178618897-178618919 CTGAAAGCCAGCTAGGAAATGGG + Intergenic
984826830 4:183932748-183932770 CTGAAGTTTGGCTAGGAAATGGG + Intronic
985501476 5:250352-250374 CTGTAGGTATGCTGGGAACTAGG - Intronic
989825335 5:45848081-45848103 CTGAAGTCAAGCTAGGATACTGG + Intergenic
992049282 5:72928368-72928390 CTATAGGGATGCTAGGATATGGG - Intergenic
995474242 5:112531914-112531936 CTGAAGCCATGTTTGGAAAATGG + Intergenic
996492424 5:124113816-124113838 CTGAAGGCATCTTATGAAAAGGG + Intergenic
997384745 5:133463842-133463864 CTGAAGGCAGGCTGGAGAATAGG + Intronic
997384913 5:133464978-133465000 CTGAAGGCAGGTTGGAAAATAGG - Intronic
1001543613 5:172556443-172556465 CCCAAGGCATCCTAGGAAAGGGG - Intergenic
1002210122 5:177593762-177593784 CTGGAGGCATGCTGGTAAGTGGG + Exonic
1002622638 5:180499393-180499415 CTGATGGTTTGCTAGGATATGGG + Intronic
1012616001 6:101281064-101281086 CTGACAGCAAGCAAGGAAATAGG - Intergenic
1015938900 6:138430168-138430190 CTAAAGGCATGGCAGAAAATAGG - Intronic
1017215663 6:151903045-151903067 CCAAAGGCTTGCTAGGAAAGTGG - Intronic
1022955838 7:35379346-35379368 TAGAAGTCATGCTAGGAACTGGG + Intergenic
1026134222 7:67645213-67645235 CTCAAGGGATGCATGGAAATAGG - Intergenic
1029204762 7:98863060-98863082 TTGAAGGCAAACTAGCAAATGGG + Intronic
1030422354 7:109323828-109323850 TTAAAGGCATGCTATGAACTAGG + Intergenic
1030513241 7:110511197-110511219 CTGAAAGCCAGCAAGGAAATGGG - Intergenic
1032713715 7:134486190-134486212 CTGATGCCAAGCTAGGAAGTTGG + Intergenic
1033161966 7:139005833-139005855 GTTAAGGCATTCTAAGAAATAGG + Intergenic
1033461255 7:141549502-141549524 CTGAATGCATCCTAGTAAAATGG + Intergenic
1034468729 7:151244865-151244887 CTGGAGGAAAGCAAGGAAATGGG + Intronic
1036589500 8:10155649-10155671 CTGAGGGCTTGCCAGGACATTGG + Intronic
1037858964 8:22391296-22391318 CAGAAGTCATGCTAGGTATTGGG - Intronic
1041184683 8:55286657-55286679 CTGAAGGCATGCTGTGAGAAAGG - Intronic
1044879189 8:96705307-96705329 CTGGAAGCATGCTAGGCACTAGG - Intronic
1045730270 8:105230694-105230716 GTGGAGGCAAGCTAGGAAACAGG - Intronic
1045858449 8:106790617-106790639 CTATAGGGATGCTAGGATATGGG - Intergenic
1046714933 8:117557157-117557179 CTGAAGACATGATGGGAAAGGGG - Intergenic
1046882224 8:119321535-119321557 TTCAAGGAATGTTAGGAAATTGG + Intergenic
1047090770 8:121573298-121573320 ATGAGTGCATGCTTGGAAATGGG - Intergenic
1050199148 9:3124075-3124097 CTGAAGGCATGCCAATAAACTGG - Intergenic
1051807891 9:21016559-21016581 CAGAAGGCATCCTAGGCAAAGGG + Intronic
1052466962 9:28840585-28840607 TTGAAAGCATCCTAGGATATAGG - Intergenic
1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG + Intronic
1055740143 9:79379326-79379348 CTGATGGCATTCGAGAAAATAGG + Intergenic
1056505806 9:87257220-87257242 CAGAAGCCAAGCAAGGAAATAGG - Intergenic
1056953898 9:91067245-91067267 CTGTAGGCCTGCTAGGCACTGGG - Intergenic
1058009869 9:99965045-99965067 CAGAAAGCATGCTAAGATATGGG - Intronic
1059722789 9:116977593-116977615 CTGAAGATATGCTAGGAAATTGG - Intronic
1060919668 9:127411115-127411137 GTGAAGGCATTCTAAGTAATAGG - Intergenic
1062520114 9:136954270-136954292 CTGCAGGCATGCTGGGCAGTAGG + Intronic
1185862869 X:3595273-3595295 CTGCAGGCAGGCAAGGAATTTGG - Intergenic
1186218695 X:7326544-7326566 GTGAAGACGTGCTGGGAAATGGG - Intronic
1186900931 X:14054996-14055018 GGGAAGACATGCTAAGAAATGGG + Intergenic
1186943846 X:14542696-14542718 CTGAAACCATGCTAGGCAAGGGG - Intronic
1188244770 X:27826208-27826230 CTGATGGTCAGCTAGGAAATAGG - Intergenic
1190792832 X:53715982-53716004 CTTACCACATGCTAGGAAATAGG - Intergenic
1194579930 X:95659457-95659479 CTGACAGCCAGCTAGGAAATGGG + Intergenic
1195759668 X:108232764-108232786 CTCAAAGCAACCTAGGAAATGGG - Intronic
1196700548 X:118663464-118663486 CTGAAGGCATCCTAAGAGACAGG + Intronic
1199824584 X:151486138-151486160 ATCAAAGCATGCTTGGAAATTGG + Intergenic
1200899790 Y:8417747-8417769 CAGAAGACAAGCAAGGAAATGGG + Intergenic
1201595303 Y:15661442-15661464 TACAAGGCATGCTAGGAAAATGG - Intergenic
1201680140 Y:16636805-16636827 CTGAGGCCATGTTTGGAAATTGG - Intergenic
1202163452 Y:21960087-21960109 CTGACACTATGCTAGGAAATAGG + Intergenic
1202227904 Y:22626281-22626303 CTGACACTATGCTAGGAAATAGG - Intergenic
1202242786 Y:22788211-22788233 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1202315253 Y:23569895-23569917 CTGACACTATGCTAGGAAATAGG + Intergenic
1202395773 Y:24421961-24421983 CTGTAGGGAGGCTAGGATATGGG - Intergenic
1202475012 Y:25248131-25248153 CTGTAGGGAGGCTAGGATATGGG + Intergenic
1202555548 Y:26100698-26100720 CTGACACTATGCTAGGAAATAGG - Intergenic