ID: 1101764207

View in Genome Browser
Species Human (GRCh38)
Location 12:107683258-107683280
Sequence CAGCTGAGACCCAGCCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101764207_1101764209 -4 Left 1101764207 12:107683258-107683280 CCATGATGGCTGGGTCTCAGCTG 0: 1
1: 1
2: 4
3: 33
4: 250
Right 1101764209 12:107683277-107683299 GCTGAGCAAGCTCAAACGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 102
1101764207_1101764210 13 Left 1101764207 12:107683258-107683280 CCATGATGGCTGGGTCTCAGCTG 0: 1
1: 1
2: 4
3: 33
4: 250
Right 1101764210 12:107683294-107683316 GCTGGGAGTGAATCAATGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 127
1101764207_1101764208 -5 Left 1101764207 12:107683258-107683280 CCATGATGGCTGGGTCTCAGCTG 0: 1
1: 1
2: 4
3: 33
4: 250
Right 1101764208 12:107683276-107683298 AGCTGAGCAAGCTCAAACGCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1101764207_1101764212 20 Left 1101764207 12:107683258-107683280 CCATGATGGCTGGGTCTCAGCTG 0: 1
1: 1
2: 4
3: 33
4: 250
Right 1101764212 12:107683301-107683323 GTGAATCAATGTCTGGGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 159
1101764207_1101764211 14 Left 1101764207 12:107683258-107683280 CCATGATGGCTGGGTCTCAGCTG 0: 1
1: 1
2: 4
3: 33
4: 250
Right 1101764211 12:107683295-107683317 CTGGGAGTGAATCAATGTCTGGG 0: 1
1: 1
2: 2
3: 17
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101764207 Original CRISPR CAGCTGAGACCCAGCCATCA TGG (reversed) Intergenic
900197054 1:1381763-1381785 AAGCTGAGACACAGGCAGCATGG + Intergenic
901083215 1:6595371-6595393 GAGATGAGACCCACCCATCATGG + Intronic
901212495 1:7534518-7534540 CAGCTGAGGCCCAGCCCTGTGGG + Intronic
901238763 1:7681022-7681044 CAGCTGGGGCGCAGCCATCCTGG + Intronic
901933076 1:12609396-12609418 CAGCTGGCACCCAGCCCTCAGGG - Intronic
902114392 1:14108902-14108924 CAGCACAGACCCAGCCATGATGG - Intergenic
903007384 1:20307653-20307675 AAGATGAGACCCAGCCCACATGG - Intronic
904769908 1:32875332-32875354 CAGCTGTGACCAAGACAACAGGG + Intergenic
905817889 1:40966094-40966116 CAGCTCAGGCCCTGCCACCAAGG - Intergenic
907161897 1:52376840-52376862 AAGCTAAGGCCCAGCCAACATGG + Intronic
907307600 1:53521970-53521992 CAGCTGAGAGTCAGCCCTGAGGG + Intronic
907407128 1:54260534-54260556 CTGCTGAGATCCAGACAGCAAGG + Intronic
910224565 1:84923192-84923214 CAGCTGTGCCCCAGCCATTTAGG + Intergenic
910379385 1:86609484-86609506 CAGCTGACACCCACCCATGAAGG - Intergenic
916740250 1:167641103-167641125 TAGCTGAGACCCAGGCACTAGGG - Intronic
919873611 1:201843892-201843914 GAGCTGAGAACCAGGAATCATGG + Intronic
919899584 1:202034265-202034287 CAGCTGGGACCCAGGCAGGATGG + Intergenic
920070111 1:203296631-203296653 CAGCTGAGAAGCAACCCTCAGGG + Intergenic
920680877 1:208071637-208071659 CAGCTAAGACAGAGCCAGCAAGG - Intronic
923064021 1:230501489-230501511 CAGCTGAGGCCCAGACATCGGGG + Intergenic
923114001 1:230917323-230917345 TGGCTGAGTCCCAGCCAGCAGGG + Intronic
923879115 1:238084198-238084220 CAGCTGACACCCACCCACAAAGG - Intergenic
1064245022 10:13661395-13661417 CAGCTGGTACCCTGCCCTCAGGG - Intronic
1064255237 10:13737893-13737915 TAGCTCAGGCCCAGCCACCATGG + Exonic
1064650351 10:17502758-17502780 CAGTTGAGGACCAGCCTTCATGG + Intergenic
1065426997 10:25616109-25616131 CAGCTGACACCCGCCCATAAAGG - Intergenic
1067762992 10:49063804-49063826 CAGGTGACACCAAGCCTTCAGGG - Intronic
1068603021 10:58975364-58975386 AAGCTGTAACCCAGCCACCATGG + Intergenic
1069590982 10:69641700-69641722 CAGCTGGGTCCCAGGCACCAGGG + Intergenic
1069639414 10:69945199-69945221 CACCTGAGACAGAGCCAGCAAGG - Intronic
1069992114 10:72322410-72322432 CTCCTGAGACTCAGCCTTCAAGG + Intergenic
1070785713 10:79161094-79161116 CAGCTGAGCCCCACCCAACAAGG + Intronic
1071290852 10:84188007-84188029 CAGCTGTGACCCTGCAATCCTGG - Intergenic
1071495800 10:86167035-86167057 CAGAAAAGACCCAGCCAACAAGG + Intronic
1071571724 10:86700907-86700929 ATGCTGAGGCCCAGCCCTCAAGG + Intronic
1072555159 10:96509213-96509235 TAGCTGAGGCTTAGCCATCATGG + Intronic
1072624431 10:97101937-97101959 CAGCTGGGATCCTGCCCTCAGGG + Intronic
1075515826 10:123107450-123107472 CAGCAGAGACCCAGCCAAAATGG + Intergenic
1080897121 11:36456059-36456081 CAGCTGAGCCCCAGCTCTCGTGG - Intronic
1081213876 11:40370192-40370214 GAGCTGAGAGCCAGCCAGTAGGG + Intronic
1081783123 11:45727299-45727321 CAGCTGAGACCCAGGTCTTAAGG - Intergenic
1083492071 11:63020673-63020695 CAGCTGAGACCCAGGCTGCCTGG - Intergenic
1084564613 11:69921918-69921940 TAGCTGAAATCCAGCCACCAGGG - Intergenic
1084646225 11:70460202-70460224 CAGCTGGGAACCAGCCACCTGGG - Intergenic
1087106883 11:94418525-94418547 CAGCTCAGACTGAGCCAGCATGG + Exonic
1087471016 11:98574445-98574467 CAGCTGAGTCGCAGATATCATGG - Intergenic
1089350951 11:117821477-117821499 CAGCAGAGACTGGGCCATCATGG + Intronic
1089861192 11:121591252-121591274 CAGCAGAGTCCCAGACAGCAGGG - Intronic
1090256766 11:125289926-125289948 CAGGAAAGACCCAGCCCTCAAGG - Intronic
1093744132 12:22720912-22720934 CTGCTGATACCCTGCCTTCATGG + Intergenic
1098112238 12:67135032-67135054 CAGCTTAGCCCCAGGCATCAAGG - Intergenic
1099545178 12:83970372-83970394 CAGCTGTGCCCCAGCCACCTTGG - Intergenic
1099620766 12:85000430-85000452 AAGCTGAGTTCCAGCCATGATGG + Intergenic
1101764207 12:107683258-107683280 CAGCTGAGACCCAGCCATCATGG - Intergenic
1102167212 12:110816119-110816141 CAGATGAGATCCAGGCAGCAAGG - Intergenic
1102659185 12:114510812-114510834 CAGCTTAGTCCCAGACCTCAAGG + Intergenic
1107622101 13:42244117-42244139 AAGTTCAGACTCAGCCATCATGG + Intronic
1113529638 13:111012935-111012957 TAGCTGAGGCCCAGACATCATGG - Intergenic
1116749843 14:48869440-48869462 CAGGTGAGACCCAAGCCTCAAGG + Intergenic
1117606892 14:57439599-57439621 CAGCTAAGTCCCAGTGATCATGG - Intergenic
1119430666 14:74566475-74566497 CAGGGGAGACCAAGCCATCAGGG - Intronic
1121369914 14:93347397-93347419 GAGTTGAGGCCCAGCCATCATGG + Intronic
1121440210 14:93944146-93944168 CAGGTGGGGCCCAGGCATCAGGG + Intronic
1122005679 14:98701600-98701622 CAGAGGATACCCATCCATCATGG + Intergenic
1122012769 14:98765842-98765864 CAGCTGAAACTCAGGCATCTGGG - Intergenic
1124395623 15:29299338-29299360 CAGCAGAGGCCCAGACATCATGG - Intronic
1126352485 15:47759044-47759066 CAGCTGACACCAGGCCACCAGGG - Intronic
1126721891 15:51590430-51590452 CAGCTGAGCCTCAGTTATCAGGG - Intronic
1128449914 15:67799532-67799554 CAGATGAGACCCAGAAATGATGG + Intronic
1128661292 15:69502897-69502919 CAGCTGAGGACAAGCCAGCATGG - Intergenic
1128666017 15:69538941-69538963 CTGCTGAGACCCGCCCCTCAAGG - Intergenic
1129713684 15:77834670-77834692 CATCTGAGCCTCAGGCATCATGG + Intergenic
1129794073 15:78362781-78362803 CAGCTGAGGCCCAGGCCTCACGG + Intergenic
1130110506 15:80959934-80959956 CAGCTGAAAATCAGCCATGATGG - Intronic
1130541061 15:84821159-84821181 TAGCTGTGGCCCAGCCAGCAGGG + Intronic
1131473680 15:92717728-92717750 CAGCTGAAGCTCAGACATCATGG + Intronic
1132012032 15:98284579-98284601 CATCTGAGACACAGCCAGGAAGG + Intergenic
1132690836 16:1181160-1181182 CAGCAGAAACCCAGCCAGGAGGG - Intronic
1132993720 16:2811785-2811807 CAGCTGAGACACCGCCCTCTGGG - Intergenic
1135102347 16:19616949-19616971 CAGCACAGAGCCAGCCACCATGG - Intronic
1135412946 16:22248732-22248754 CTGCAGAGACCCATCCACCATGG - Intronic
1138886791 16:61090212-61090234 CTGCTGGGTCCCAGGCATCAAGG - Intergenic
1139950141 16:70664543-70664565 CAGCTGGGACTTAGCCATCCAGG - Intronic
1141000669 16:80304476-80304498 CAGTTGAGAGCCATCCAGCATGG - Intergenic
1141601028 16:85126533-85126555 CAGCTGAGGCCCTGCCCTCGTGG - Intergenic
1142032777 16:87846749-87846771 AAGCTGAGACCCACCCACCCAGG + Intronic
1142323048 16:89397232-89397254 CACGGGAGACACAGCCATCAAGG + Intronic
1142766152 17:2065352-2065374 CAGCTGAGGGCCAGCCACCATGG - Intronic
1142781928 17:2187994-2188016 CCGCTGTGGACCAGCCATCATGG - Intronic
1144067408 17:11637035-11637057 CAGCTGAGACCTTGGCATTATGG + Intronic
1144241996 17:13321616-13321638 CAGGTTAGTCCCAGACATCAGGG - Intergenic
1144720011 17:17462630-17462652 CAGCTGGGCCCCAGCCATGGTGG - Intergenic
1147323893 17:39661285-39661307 CAGCTGGAACCAAGCCACCAAGG + Intronic
1149401290 17:56298995-56299017 CATCTGAGTCCCAGCCAACAAGG + Intronic
1149793126 17:59496346-59496368 CAACTGAAAGCCAGCCAGCAAGG + Intergenic
1151886853 17:76927745-76927767 CAGCTGAGAGCCTCCCAACAAGG - Intronic
1152086295 17:78221003-78221025 AAGCTGAGGCCCGGCCATCCAGG + Intronic
1152325417 17:79633218-79633240 CAGCTAAGACTCAGCCACCTGGG + Intergenic
1156452911 18:37276642-37276664 CAGCTGAGGCCCAGACATCCTGG + Intronic
1157491851 18:48129094-48129116 CCGCTGAGACCCGCCCATCCAGG - Intronic
1157598365 18:48877645-48877667 TAGCTGAGTTCCTGCCATCAGGG - Intergenic
1158965862 18:62621741-62621763 CAGAAGGGACACAGCCATCACGG + Intergenic
1159102468 18:63971132-63971154 AGACTGAGACCCAGCCATCAGGG - Intronic
1162545329 19:11325621-11325643 CAGCTGAGACTCTGCCCTCAGGG - Intronic
1163191572 19:15680527-15680549 CATCTGGGACCCAGACTTCAAGG - Intronic
1163221807 19:15927182-15927204 CAGCTGGGACCCAGAGTTCAAGG + Intronic
1165021024 19:32924464-32924486 CAGCTGAGCCTCCTCCATCAGGG + Intronic
1165488422 19:36109317-36109339 AGGCAGAGACCCAGCCATGATGG - Intergenic
1166167673 19:41003845-41003867 CTGCTGGGACCCAGCAATTAAGG - Intronic
1166321937 19:42024009-42024031 CAGCTGTGCTCCAGCCATGATGG + Intronic
1167342250 19:48922755-48922777 CAGCTGAGGCCGAGCCACCTAGG - Exonic
925121788 2:1424108-1424130 AAGCTGTGCCCCAGCCATCTTGG - Intronic
926765457 2:16319555-16319577 CAGCTGTGGCCCTGCCCTCAGGG - Intergenic
927385242 2:22524830-22524852 CATCTGAGACCCAGTCTTCAGGG + Intergenic
932719539 2:74128906-74128928 CAGCTGAGCCCCAGAAGTCAAGG + Intergenic
933026676 2:77268468-77268490 CAGCTGAGACCAAGGCAGGATGG - Intronic
934111444 2:88747259-88747281 CAGCTGCCACACAGCCAGCAAGG + Intronic
934120220 2:88831237-88831259 CAGCAGAGACCCAATCATCATGG + Intergenic
937222714 2:120351007-120351029 CATGTGGGCCCCAGCCATCAGGG + Exonic
937846679 2:126585996-126586018 CATGTGAGACCCAGCATTCATGG + Intergenic
937892319 2:126948193-126948215 CAGCTGGGACACAGCCCTCCTGG + Intergenic
938160157 2:128978607-128978629 CAGCGGAGACCCAGCCACGTGGG + Intergenic
938288696 2:130138257-130138279 CAGCTGGGCCTCAGCCCTCACGG + Intergenic
938467837 2:131534675-131534697 CAGCTGGGCCTCAGCCCTCACGG - Intergenic
939244921 2:139610599-139610621 CAGCTGACACCCATCCATGGAGG - Intergenic
940356804 2:152752639-152752661 CAGATGAGAGGCAGCCAACAGGG - Intronic
941167861 2:162102912-162102934 CAGCTGAGCCCCAGATATCATGG - Intergenic
946134902 2:217637475-217637497 CAGCTGGAAGCCAGACATCACGG - Intronic
948858098 2:240740014-240740036 CAGCTCAGCCCCACCCACCAAGG + Intronic
949066458 2:241993644-241993666 CAGCAGAGTCCCAGCCCCCAGGG - Intergenic
1169317369 20:4603746-4603768 CAGATCAGCCCCAGCAATCACGG + Intergenic
1170601044 20:17841888-17841910 GAGCTGAGACCCAGCCATCACGG - Intergenic
1171255774 20:23688222-23688244 CAGCAGGGACTCAGCCATCCTGG + Intronic
1172278880 20:33696578-33696600 CAGCTGACATCCAGCCCACAAGG + Intergenic
1172992917 20:39049362-39049384 CAGCTGAGGCCCAGACATGCAGG + Intergenic
1173924427 20:46770291-46770313 CAGATGAATCCCAGCCCTCAAGG + Intergenic
1175384437 20:58585157-58585179 AAGCTGAGACACAGCCTTCCAGG + Intergenic
1176190010 20:63804085-63804107 CATCTCAGCCCCAGCCACCAGGG + Intronic
1176917453 21:14643942-14643964 CAGCTGATGCCCAGCCATAGAGG + Intronic
1176988751 21:15468557-15468579 CAGCTGAAACCCAGGAAGCAAGG + Intergenic
1177893015 21:26828981-26829003 CAGATGAGACCCATCCATACTGG - Intergenic
1178409628 21:32352632-32352654 CAGCTGTGGCCCAGCCAGCTGGG + Intronic
1178441647 21:32603349-32603371 CAGCTGAGCCCCTCCCAGCAGGG + Intronic
1178585408 21:33867013-33867035 CAGATGTGACTCAGCCAGCAGGG - Intronic
1180941003 22:19659441-19659463 CAGCTGATACCCAGGCCCCAGGG + Intergenic
1181021669 22:20106762-20106784 CAGCTGAGACCAAGCCACAGAGG - Intronic
1181108263 22:20587271-20587293 CAGCTGGGCCTCAGCCCTCACGG + Exonic
1181169001 22:20997882-20997904 CAGGTGAGACCCATACATCATGG - Exonic
1181235489 22:21445709-21445731 CAGCTGAGCGACAGCCAACATGG + Exonic
1182088379 22:27577162-27577184 CCGCAAAGATCCAGCCATCAGGG + Intergenic
1182883826 22:33756494-33756516 CAGCTGAGACCCAAGGATCTAGG + Intronic
1183649927 22:39148043-39148065 AAGCAGAGACCCAGCCATGGTGG + Intronic
1184089332 22:42284045-42284067 CAGCTGAGCCTCTGACATCACGG + Intronic
1184107385 22:42376088-42376110 CAGCTGAGTCCCAGGGATAAGGG - Intergenic
1184204264 22:42991308-42991330 CAGCTGAGACCCAGGGAACTGGG - Intronic
1184885900 22:47344269-47344291 CAGCTGTGACCCTGGCATCTAGG - Intergenic
950469414 3:13175174-13175196 CAGCTGGTACCTTGCCATCACGG - Intergenic
950962526 3:17120687-17120709 CAACTGGGTCCCAGCCATGATGG - Intergenic
951577312 3:24126996-24127018 CAGCTGAACTCCAGCCATCTTGG + Intronic
951819477 3:26791861-26791883 CAGCTGACACCCACCCATGGAGG - Intergenic
952113668 3:30154303-30154325 CAAATGAGACCTAACCATCATGG + Intergenic
952149117 3:30567314-30567336 CAGCTGACACCCACCCATAGAGG + Intergenic
952183258 3:30941743-30941765 CAGCTGCCACACAGCCAGCAAGG + Intergenic
952725647 3:36581903-36581925 CAGCTGACACCCATCCATGGTGG + Intergenic
953327315 3:42023487-42023509 CAGCTGGGTCTCAGTCATCATGG - Intronic
953880013 3:46686660-46686682 CAGCAGAGACCCAGAGAGCAGGG - Intronic
954554478 3:51507169-51507191 CAGCACAGACCCTGCCCTCAAGG + Intergenic
955207632 3:56911017-56911039 CAGTGGAGACGTAGCCATCAAGG - Intronic
955711940 3:61789181-61789203 CACCTGAGCCCGAGACATCAAGG - Intronic
956309239 3:67860660-67860682 CAGAAGTGACCCAGCAATCATGG - Intergenic
957738107 3:84227719-84227741 CCCCTGGGAGCCAGCCATCAGGG + Intergenic
957994913 3:87677094-87677116 AAACTAAGAACCAGCCATCAAGG - Intergenic
959101715 3:102017575-102017597 CCCCTGAGACCCAGGCATAATGG - Intergenic
959409144 3:105998318-105998340 CAGCTGACACCCACCCATGGAGG - Intergenic
960856958 3:122111658-122111680 CAGTTGACAGCCAGCCATTAAGG + Intronic
960881908 3:122353910-122353932 CAGCTGAGACCCATTAATGATGG - Intergenic
961790937 3:129376345-129376367 AAGCTGTGACCCAGCCACCTTGG - Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
962699135 3:137979670-137979692 CAGCTGACACCCACCCATGGAGG - Intergenic
963277935 3:143351469-143351491 CAGCTGAGACCCTTCCTTCTCGG - Intronic
963437989 3:145296260-145296282 CATCTGAGCCCCAGAGATCAAGG - Intergenic
964209497 3:154211366-154211388 CAGCTGATACCCATCCATGGAGG - Intronic
964644599 3:158945298-158945320 CAGCTGAAATACTGCCATCAGGG - Intergenic
964663216 3:159143896-159143918 AAGCTGAGACCAGGCCCTCAAGG - Intronic
966212299 3:177466043-177466065 CAGCAAAGACCCTGCCCTCAAGG + Intergenic
966688938 3:182724411-182724433 CTCCCGAGACCCATCCATCAAGG - Intergenic
967844050 3:194030603-194030625 CAGCTGAGCCCCAGACATGAGGG + Intergenic
968947640 4:3673960-3673982 CACCTCAGGCCCAGCCATGAAGG - Intergenic
969209806 4:5678082-5678104 CAGCTGAGGCCCAGCCCTACAGG - Intronic
969219909 4:5752747-5752769 CAGCTGAGAAGAAGCCACCAGGG - Intronic
972765656 4:42151121-42151143 GAACTGAGAGCCAGCCAGCATGG + Intronic
973801672 4:54484477-54484499 CAGATGAGACCCAGTCATGCGGG + Intergenic
974290619 4:59925487-59925509 CAGCAGAGACCAAGCCATGCTGG + Intergenic
975859808 4:78664586-78664608 CAGCTGTGCCCCAGCCACCTTGG + Intergenic
977681933 4:99806786-99806808 CAGCTGAGACTCAGCTATGCTGG - Intergenic
978196309 4:105976287-105976309 CAGGTGAGGCCCAGCAGTCAGGG + Intronic
978770499 4:112451726-112451748 CAGCTGATCCCCTGCCAGCAGGG + Intergenic
981089107 4:140714287-140714309 AAGCTGCAACCCAGCCACCATGG - Intronic
981816403 4:148835522-148835544 CAGATGAGAACCAGACTTCAGGG - Intergenic
983064607 4:163194081-163194103 CTCCTGAGACCTATCCATCAAGG - Intergenic
983075394 4:163319587-163319609 CACCTCATATCCAGCCATCAAGG - Intergenic
983127696 4:163974509-163974531 CAGCTGAAGCCCAGGAATCATGG + Intronic
984601084 4:181727452-181727474 GAGCTGAGAGCCAGGAATCATGG + Intergenic
985076790 4:186224188-186224210 CTGCAGGGACCCAGCCCTCATGG + Intronic
985658371 5:1143568-1143590 CAGCTGAGGCCCAGCCCCAACGG - Intergenic
985877558 5:2611776-2611798 CAGCTGAGCTCCCGGCATCAGGG + Intergenic
986124922 5:4875907-4875929 CAGCTGAGCCCCATCCATGGTGG - Intergenic
987414666 5:17650084-17650106 CTGCTCAGACACAGCCTTCAGGG - Intergenic
992320884 5:75611989-75612011 AAGCTGAAAACCAGCCAACAGGG - Intronic
992576544 5:78119059-78119081 CTGCTGATACCCAGGCAACAGGG + Intronic
992904416 5:81332096-81332118 CAGCTGACAACCAGCCATGGTGG + Intronic
995541561 5:113190992-113191014 CTGCTGAGATCCAGCTATCAGGG - Intronic
997299577 5:132792734-132792756 CAGGTGAGATCCTGCCTTCAAGG + Intronic
1003150674 6:3546284-3546306 CAGATGAGACCCACCCATCTTGG + Intergenic
1004306764 6:14508327-14508349 CAGCTGATTCCCATCCCTCAGGG + Intergenic
1004910576 6:20278907-20278929 AAGCTGTGACCCAGCCATCGTGG + Intergenic
1006683610 6:35814577-35814599 CACTTGAGTCCCAACCATCAGGG - Exonic
1007363609 6:41374997-41375019 CAGCTGAAACCCAGCAATTATGG + Intergenic
1007512040 6:42381194-42381216 CAGCACAGCCCCTGCCATCAGGG - Intronic
1008913177 6:56758560-56758582 TAGCTGAGGCCCAGACATCATGG - Intronic
1009771321 6:68145810-68145832 CAGCTGACACCCACCCATAGAGG - Intergenic
1010358607 6:74965766-74965788 CAGCTCACACACAGCCAGCAAGG + Intergenic
1010975888 6:82313193-82313215 CAGCTCCCACACAGCCATCAAGG - Intergenic
1013479152 6:110538407-110538429 GAGCTGAGATCCAGGCCTCATGG + Intergenic
1014964169 6:127726045-127726067 CAGCCCAGACCAAGCCAGCAAGG - Intronic
1015650350 6:135450741-135450763 CAGCCAAGACCCTGCCATTATGG + Intronic
1017518378 6:155179045-155179067 CAGTTGGAACCCAGCCATTATGG + Exonic
1018260780 6:161968448-161968470 AAGCTGAGTTCCAGCCATGATGG - Intronic
1018260896 6:161969587-161969609 AAGCTGAGTTCCAGCCATGATGG - Intronic
1018968561 6:168508545-168508567 CAGCTGAGATGCAGACTTCAAGG + Intronic
1020261942 7:6535782-6535804 CAGCTGTGAACCACCCAACAGGG - Intronic
1021375841 7:19905811-19905833 CTACTGATACCCAGCCAACAGGG - Intergenic
1022301779 7:29108481-29108503 GACCTGAACCCCAGCCATCAAGG - Intronic
1023163855 7:37323992-37324014 CACTGGAGACCCAGCCACCAGGG + Intronic
1024222769 7:47301411-47301433 CAGCTGAGACACAGCATCCAGGG + Intronic
1024565567 7:50677099-50677121 CAGCTGAGACGCAGCAAGCAGGG + Intronic
1025758990 7:64372784-64372806 CTGCTTGGACCCAGCCAACAGGG + Intergenic
1025781345 7:64604521-64604543 CAGCACAGCCCCTGCCATCAGGG + Intergenic
1026385429 7:69842853-69842875 CAGCAGAGAGCCAGCCATTAGGG - Intronic
1028576168 7:92353837-92353859 CAGCTGAGACAGAGACTTCATGG + Intronic
1029381229 7:100216103-100216125 CAGCTGAGGTCCAGGGATCAGGG + Intronic
1029400606 7:100343054-100343076 CAGCTGAGGTCCAGACATCAGGG + Intronic
1029965613 7:104736706-104736728 CATCTGAGTCCCAGCCATCAGGG - Exonic
1030125981 7:106152943-106152965 TAGCTGAGTCTCCGCCATCACGG - Intergenic
1032026096 7:128443906-128443928 CCACTGTGACCCACCCATCAGGG - Intergenic
1033407498 7:141084531-141084553 CAGATGGGGCCCAGCCATCCAGG - Intronic
1033499796 7:141936475-141936497 CAGCTGATACCCACCCATGGAGG + Intronic
1037294556 8:17386611-17386633 CTGCTGAGAGCCAGCAATGAGGG - Intronic
1038042135 8:23732476-23732498 CAGCCAAGACCCACACATCATGG - Intergenic
1039640898 8:39219481-39219503 CAGCTGACACCCATCCATAGAGG - Intronic
1040509967 8:48084801-48084823 CAGCTCACCCCCAGCCCTCAGGG - Intergenic
1040825683 8:51618404-51618426 CAACTGGGAACCAGGCATCATGG + Intronic
1043366748 8:79542302-79542324 CAGCTGACACCCATCCATGGAGG + Intergenic
1044959143 8:97512908-97512930 CAGCTGAGATCCAGACATCATGG + Intergenic
1045679957 8:104648274-104648296 AAGCTGAGACCAGGTCATCAGGG - Intronic
1046514204 8:115237438-115237460 CAACTTAGACCCAGCTACCATGG - Intergenic
1049599876 8:143502792-143502814 CAGCAGAGCCTCAGCCTTCAGGG + Intronic
1050388533 9:5113512-5113534 CAGCTGAGACCAGCCCACCAGGG - Intronic
1050913849 9:11107347-11107369 CAGCTGACACCCATCCACAAAGG + Intergenic
1053152632 9:35752781-35752803 CAGCTGGGACCTGCCCATCAAGG + Exonic
1055421836 9:76151390-76151412 CAGCTGACACCCAGCAATCATGG + Intronic
1055623288 9:78147893-78147915 CAGCTGAGACCCAGATATCATGG - Intergenic
1056942434 9:90966985-90967007 CAGCTGAGGCCCAAGCATCATGG - Intergenic
1058866274 9:109164914-109164936 CAGGTGGGCCACAGCCATCAAGG - Intronic
1059335531 9:113566323-113566345 CAGCTGAGACCCATCAGGCAGGG + Intronic
1060230558 9:121822407-121822429 CAGGTGAGAACCAGCCAGCCTGG + Exonic
1061948443 9:133921821-133921843 CAGCAGAGCCCCATCCGTCATGG + Intronic
1062033595 9:134372917-134372939 GGGCTGAGACCCAGCCTTCCTGG + Intronic
1062181093 9:135191710-135191732 CAGCTGAGACCCAGGCCACTGGG - Intergenic
1062218875 9:135403772-135403794 CTTCTGAGACACAGCCATCCTGG + Intergenic
1189224627 X:39402490-39402512 CAGCTGAGGCTAAGTCATCAGGG + Intergenic
1189430099 X:40938687-40938709 CAGCTGAGGTCCAGACATCGTGG + Intergenic
1191149974 X:57209909-57209931 CAGCTGACACCCACCCATGGAGG - Intergenic
1191807952 X:65155563-65155585 CAGCTGGGAGCCAGGCATGATGG + Intergenic
1192676092 X:73198689-73198711 CAGCTGACACCCAGCCATGGAGG + Intergenic
1193218731 X:78897925-78897947 CAGATGAGAAACAGCCAGCATGG - Intergenic
1195821284 X:108947377-108947399 CAGCTGACATCCAGCCACAAGGG - Intergenic
1196551114 X:117026662-117026684 TAGCTGTGACCCAGACATCCTGG + Intergenic
1197167241 X:123391837-123391859 CAGGTGAGTCCCAGCCATGGTGG + Intronic
1197593175 X:128434446-128434468 AAACTGAGACCCAGTCATGATGG + Intergenic
1198611880 X:138411051-138411073 CAGCTGACACCCACCCATGGAGG + Intergenic
1198724937 X:139667316-139667338 CAGGTTAGTCCCAGTCATCAGGG + Intronic
1198725051 X:139667943-139667965 CAGGTTAGTCCCAGTCATCAGGG - Intronic
1199227390 X:145394023-145394045 CGGTTCAGACCCACCCATCATGG - Intergenic
1200266721 X:154650083-154650105 CAGCTGTGACAGAGCCCTCAAGG + Intergenic
1202086267 Y:21140047-21140069 TTCCTGAGACCCATCCATCAAGG + Intergenic
1202246709 Y:22827667-22827689 CAGCTTGGACCCAACCAACAGGG + Intergenic
1202399698 Y:24461415-24461437 CAGCTTGGACCCAACCAACAGGG + Intergenic
1202471082 Y:25208671-25208693 CAGCTTGGACCCAACCAACAGGG - Intergenic