ID: 1101765193

View in Genome Browser
Species Human (GRCh38)
Location 12:107691525-107691547
Sequence AAATTAGGCCAGAAGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101765193 Original CRISPR AAATTAGGCCAGAAGCAATG AGG Intronic
900556006 1:3280874-3280896 AAATTTGGTCAGAAACAATGCGG + Intronic
900883584 1:5400079-5400101 GAATTAGGTCAGAAGGAATGGGG + Intergenic
902214918 1:14928479-14928501 AAAAGAGACCAGAAACAATGTGG - Intronic
902622749 1:17659970-17659992 AACTGAGGCCAAGAGCAATGTGG + Intronic
903178824 1:21595356-21595378 GGATGAGGCCAGAGGCAATGTGG - Intergenic
903546717 1:24128707-24128729 CAATTAAGGCAGAAGCAATGAGG - Intronic
904287523 1:29461809-29461831 AAATAAGGCCGGAAGCAGGGGGG - Intergenic
904370782 1:30046175-30046197 AAATAAGGCAGGAAGCAAGGCGG - Intergenic
906961179 1:50420309-50420331 AAATTAGGCCAGAGCCGTTGAGG - Intronic
909287242 1:73836016-73836038 AAATTCACCCAGGAGCAATGTGG + Intergenic
911886062 1:103301024-103301046 CAATCATGGCAGAAGCAATGGGG + Intergenic
913706667 1:121432021-121432043 AAATTAGGCATAAGGCAATGAGG + Intergenic
918368229 1:183832158-183832180 AAATTAAGGCAAAGGCAATGAGG + Intronic
921751982 1:218805593-218805615 AAATTAGAACAGAAGGACTGAGG - Intergenic
923037526 1:230294791-230294813 AATTTATTCCAAAAGCAATGTGG - Intergenic
924256479 1:242188278-242188300 AAATTAGGGAAGAAGCTATGAGG + Intronic
1063923071 10:10950637-10950659 AAAAGAGGGCAGCAGCAATGGGG - Intergenic
1064148270 10:12842320-12842342 AGAGTACGGCAGAAGCAATGGGG - Intergenic
1064699670 10:18006258-18006280 AAATGAGGCCATTAGCAATGAGG + Intronic
1064836866 10:19542756-19542778 AAATTAAGCCAAAAACAATAAGG - Intronic
1065318601 10:24487927-24487949 AAAATAGCCCAGATGCAATGGGG + Intronic
1068371418 10:56121050-56121072 AAATTACGCCAGAAAAAAAGTGG - Intergenic
1069767503 10:70874092-70874114 GAAATGGGCCAGAAGGAATGAGG + Intronic
1070600896 10:77865614-77865636 AAATTAGGTCAGGATGAATGGGG + Intronic
1071596440 10:86930716-86930738 AAATTAGGATATAAGCACTGAGG - Exonic
1075302729 10:121340104-121340126 ATGTTAGGCCACAAGAAATGGGG - Intergenic
1075661023 10:124196575-124196597 ACATTATGCCATAAACAATGGGG + Intergenic
1079323642 11:19473150-19473172 AACTGAAGCCAGAAGCTATGTGG + Intronic
1080122698 11:28695655-28695677 AAACTAGGCCAGAACCAAACAGG - Intergenic
1081659259 11:44877897-44877919 GTATTAGGCCAGGAGCAGTGGGG - Intronic
1083083509 11:60118217-60118239 GATATAGCCCAGAAGCAATGAGG + Intergenic
1086176481 11:83897305-83897327 ATATTAAGAAAGAAGCAATGAGG + Intronic
1086311663 11:85542248-85542270 AAATTACACCAAAAGAAATGGGG + Intronic
1086327493 11:85718937-85718959 CAATTAGTCAAGATGCAATGAGG + Intronic
1087212393 11:95457351-95457373 AAGTAAGGCCAGAAGCCATGGGG - Intergenic
1087338377 11:96871124-96871146 AAATGAGTCCAGAAACAAAGGGG + Intergenic
1087444563 11:98233672-98233694 AAGTTAGGCCACATGCAAAGGGG + Intergenic
1088480035 11:110287656-110287678 AAATAAGGCCAAAAGCAAGAAGG + Intronic
1089568815 11:119388647-119388669 AAACTACGACAGAAGCAATGTGG - Intergenic
1091004427 11:131939842-131939864 AAATTAGGAGAGTAGCAAGGAGG + Intronic
1092685170 12:11035232-11035254 CAAATGGGGCAGAAGCAATGTGG - Intronic
1092687374 12:11065378-11065400 AAAATGGGCCAGAAGCATTGTGG - Intronic
1092689860 12:11096139-11096161 CAAATGGGGCAGAAGCAATGTGG - Intronic
1093902339 12:24650314-24650336 GAATTAAGGCAGCAGCAATGGGG + Intergenic
1093963131 12:25297464-25297486 AAATTAGGCCAGAGGAGGTGTGG - Intergenic
1094743674 12:33317815-33317837 ACATGAGGCAAGAATCAATGGGG + Intergenic
1095797749 12:46238802-46238824 AACTGAGGAGAGAAGCAATGGGG - Intronic
1096535691 12:52271255-52271277 AAAGGAGGCAAGAAGCAAGGAGG - Intronic
1097218821 12:57434894-57434916 GAGAAAGGCCAGAAGCAATGAGG - Exonic
1098001028 12:65943498-65943520 AAACAAGGCCAGCAGCAGTGAGG + Intronic
1098092007 12:66913229-66913251 TAATTAGCTCACAAGCAATGTGG + Intergenic
1099603694 12:84774293-84774315 AAATTACCCCACAAGCAATTAGG - Intergenic
1099770253 12:87043232-87043254 AAATTTCTCCAGAAACAATGCGG + Intergenic
1100306178 12:93352014-93352036 AAATTAAGCCAGGAGGAAAGAGG - Intergenic
1101765193 12:107691525-107691547 AAATTAGGCCAGAAGCAATGAGG + Intronic
1102023483 12:109699794-109699816 CAATTAGGCCAGAAGCCATCAGG - Intergenic
1102649647 12:114430368-114430390 AAACTGGGCCAGAATCACTGGGG + Intergenic
1103113741 12:118307148-118307170 CAATTGTGCAAGAAGCAATGAGG + Intronic
1103861821 12:124021469-124021491 AAATTAAACCAGAAGCATAGTGG - Intronic
1105725163 13:23156130-23156152 ATATTAGTCCAGAATCTATGAGG + Intergenic
1109175565 13:59151163-59151185 TAATTAGAGCAGTAGCAATGGGG + Intergenic
1109479609 13:62931910-62931932 AACTTTGGCCAGAAACACTGTGG - Intergenic
1110506370 13:76292396-76292418 AAATGTGGCAAGTAGCAATGAGG + Intergenic
1110832009 13:80042614-80042636 GAATTAAGCCAGAAGGAAGGAGG - Intergenic
1111485935 13:88898227-88898249 AAATAATGCAAGAATCAATGAGG - Intergenic
1112838671 13:103548355-103548377 AAATTAGGCCAGCAGAGAAGAGG - Intergenic
1115151388 14:30290037-30290059 AAATAAGGTGAGAAGCAATCAGG - Intergenic
1116602819 14:46948826-46948848 ATATTAGGCTGGAACCAATGAGG - Intronic
1117189959 14:53279737-53279759 AACTGAGGCCAGGAGCAGTGTGG + Intergenic
1120350390 14:83349989-83350011 AGATTAGTCCAGAAGAAATCTGG + Intergenic
1120523388 14:85549896-85549918 AAATTAGGCAAGATGTACTGTGG - Intronic
1121314825 14:92954709-92954731 AAATAAGGCTAAAAGCAGTGTGG - Intronic
1127320604 15:57841470-57841492 AAATTAGGCCAGAGGGAAGGAGG - Intergenic
1127336271 15:57988006-57988028 AAATTATGCCAGAAGGAAATGGG + Intronic
1127938685 15:63670569-63670591 AAATGAAGACAGAAGAAATGAGG + Intronic
1128291746 15:66483350-66483372 CATTTAGGGAAGAAGCAATGAGG - Intronic
1128609329 15:69061369-69061391 AAACTAGTCCAGAAGGACTGTGG + Intronic
1129233032 15:74207223-74207245 ACAGCAGGCCAGAAGGAATGGGG + Intronic
1130718895 15:86366699-86366721 AAGTTATGCCAGAAGCATTCAGG + Intronic
1130727818 15:86459290-86459312 AAATTAGGCCAGAGGAAAACTGG - Intronic
1132020954 15:98361964-98361986 AAATTATGCCAGAAGAAACATGG + Intergenic
1132391923 15:101445486-101445508 AAAATAGGGCAGAAATAATGAGG - Intronic
1134291645 16:12906398-12906420 TAATTAGCCCAGAAGCAAGCAGG - Intronic
1135696786 16:24595094-24595116 AAATTAGGCAAGAAAAAAAGAGG - Intergenic
1136028700 16:27487093-27487115 AAATTAAGGCAGAAGAAAAGTGG + Intronic
1137780949 16:51097432-51097454 AAATTAAGCCAGAAGAAAGAGGG + Intergenic
1139478828 16:67217027-67217049 CAACTAGGGCAGAAGCAGTGAGG - Intronic
1141344092 16:83229427-83229449 AAATTATGCCAGACTAAATGGGG - Intronic
1141936246 16:87240571-87240593 AAACCAGACCAGAAGAAATGAGG + Intronic
1144531426 17:16042826-16042848 AAGTTAGTCAAGAAGTAATGAGG + Intronic
1145358955 17:22195276-22195298 AACTGTGGCCAGAAGCACTGTGG + Intergenic
1146403210 17:32516618-32516640 AAATTTGGCAAGAAGCCATGTGG - Intronic
1150736383 17:67743528-67743550 TAATGATGCCAGAAGCAAAGAGG + Exonic
1151272095 17:73004749-73004771 AAAAGAGGCCACAGGCAATGGGG + Intronic
1152747217 17:82046650-82046672 AACTTAGGCCAAAAAAAATGGGG + Intergenic
1152973376 18:187568-187590 AAATAAGACCTGAAACAATGGGG - Intronic
1154285396 18:13051443-13051465 AAAGAAGGCCTGAAGCAATTTGG + Intronic
1155013303 18:21805698-21805720 AACTTAGGCAAAAAGAAATGTGG - Intronic
1155439641 18:25848543-25848565 AAATGAGGCAATAAGCCATGTGG - Intergenic
1156522104 18:37730555-37730577 AAATTAGGCCAGGAGGCCTGAGG - Intergenic
1159324854 18:66901658-66901680 AATTTACTCCAGAAACAATGTGG - Intergenic
1161899340 19:7106367-7106389 AAAGTAGGACAGAAACAAGGAGG + Intergenic
1165573919 19:36797754-36797776 AAATTATGTCAGCACCAATGCGG - Intergenic
1166295761 19:41888511-41888533 AAATTAGGAGAGAAGAAATTGGG - Intronic
925651419 2:6093561-6093583 AAAGTAGGCTAGAAAAAATGTGG + Intergenic
925771422 2:7286207-7286229 CAATTAGGTCAGAATCTATGTGG - Intergenic
925921587 2:8641731-8641753 AAATTAGCCCACTGGCAATGAGG - Intergenic
926603361 2:14870532-14870554 AAATTAGCCCAGAATAAAGGTGG + Intergenic
926665855 2:15522224-15522246 AAATTGGGTCAGAAGTAATGAGG + Intronic
930271769 2:49265690-49265712 AAATTAGTCCAGAGCCTATGGGG + Intergenic
930343224 2:50144209-50144231 TAATTCGGACAGTAGCAATGAGG + Intronic
930980262 2:57516643-57516665 GAATTAGGGCAAAAGAAATGGGG - Intergenic
932045226 2:68341815-68341837 AAATTAAGGAAGAAGCAATCAGG + Intergenic
932223126 2:70016385-70016407 CAATAAGGCCAGGTGCAATGTGG + Intergenic
933825944 2:86161135-86161157 AAATTAGGCCAGAATAAATTTGG - Intronic
934585641 2:95491951-95491973 AAATAAAGCCAGATTCAATGTGG - Intergenic
934593826 2:95584808-95584830 AAATAAAGCCAGATTCAATGTGG + Intergenic
936707239 2:115089043-115089065 AATTTAGGACAGAAGATATGAGG - Intronic
937795084 2:126007931-126007953 GAATTAGATGAGAAGCAATGGGG - Intergenic
938138579 2:128778820-128778842 AAATTAGGCAATTAGCAACGAGG - Intergenic
939031486 2:137080597-137080619 AAATTAGGCCAGAAAAGGTGAGG - Intronic
939782824 2:146470351-146470373 AAATTTGGGCAGATGCTATGAGG + Intergenic
940298657 2:152156939-152156961 AAAACAGGCCAAAATCAATGAGG + Intronic
942193761 2:173497018-173497040 AACTTAGGACAGAAGGAATCTGG - Intergenic
942234890 2:173894468-173894490 AATTTAGGCAGCAAGCAATGTGG + Intergenic
942695002 2:178632178-178632200 AAATTAGAGTAGAAGCTATGGGG - Exonic
942752190 2:179300623-179300645 AAAATAGGCTAGAAAAAATGGGG + Intergenic
942819083 2:180089740-180089762 ACATTAGGTAAGAAGGAATGGGG + Intergenic
943086765 2:183321829-183321851 AAATTAAGGCAGTTGCAATGGGG - Intergenic
944179568 2:196874667-196874689 AAAATACCACAGAAGCAATGAGG - Intronic
945204276 2:207315136-207315158 AATTTAGGGAAGAAGCAGTGGGG + Intergenic
946254738 2:218434314-218434336 GCTTTAGGCTAGAAGCAATGGGG + Intronic
947073649 2:226318462-226318484 AAATTAGGCTAATGGCAATGTGG + Intergenic
947399923 2:229721178-229721200 AAAATAGGCCAGACGCACAGTGG + Intergenic
1169740104 20:8883177-8883199 AAATTAGGACAGAAATAATATGG + Exonic
1170211436 20:13849511-13849533 AAATCAGCCCAGGAACAATGAGG + Exonic
1172082450 20:32352840-32352862 AACTGAGGCCAGAAGCATTATGG + Intergenic
1172784894 20:37461665-37461687 AAAATAAGCCAGAAGCAAAAAGG - Intergenic
1173024423 20:39294732-39294754 AAAATAAGCCACAAGCAAAGAGG - Intergenic
1175039218 20:56030267-56030289 AACTTAGGCCAGAGGGAATTTGG - Intergenic
1177342784 21:19826597-19826619 CAATTATCCTAGAAGCAATGAGG - Intergenic
1181988750 22:26820680-26820702 AAATTAGTCCTGGAACAATGAGG + Intergenic
1184024660 22:41846282-41846304 AAAATGGGCCAGAACCAAGGAGG + Intronic
949185029 3:1179900-1179922 AAATTAGTAAAGAAGGAATGTGG - Intronic
949422229 3:3878329-3878351 AATTCAGGCCAGTAGTAATGAGG - Intronic
950575362 3:13828990-13829012 GAGGTAGGCCAGCAGCAATGAGG - Intronic
952392955 3:32896518-32896540 AAATTAGGGCAGAAGAGAGGTGG - Exonic
952502996 3:33981376-33981398 AAATCAGGCCAGAAACAAAGAGG - Intergenic
953403910 3:42650958-42650980 AAATTAGGCTGGAGGCATTGAGG - Intergenic
955207431 3:56909078-56909100 AAATTACTCCAGAAGCGAAGCGG - Intronic
955506277 3:59636275-59636297 AACAGAGGCCATAAGCAATGGGG + Intergenic
958124942 3:89343662-89343684 ATATGAGACCAGAAGCAAAGTGG - Intronic
959145188 3:102535510-102535532 CATTTAAGCCAGAATCAATGAGG - Intergenic
959449775 3:106484755-106484777 AAATGAGCCAAGAAGCATTGTGG + Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
961341590 3:126226140-126226162 AAATCTGGCCTGAACCAATGAGG - Intergenic
963236010 3:142957109-142957131 AAATTAGGACAGAGGCAAAAAGG - Intronic
963883769 3:150556729-150556751 AAATTATACCAGAAGGAAAGAGG + Intronic
964044368 3:152305069-152305091 AATTTAGACCTCAAGCAATGTGG + Intronic
964168732 3:153740701-153740723 AAATAATACCAGAAGCAATCTGG + Intergenic
966369960 3:179240476-179240498 AAGTTAGGCTAGAAGCAAACTGG + Intronic
966409049 3:179630046-179630068 AGGTGAGGCCAGTAGCAATGGGG + Intergenic
967074172 3:185987337-185987359 AACATTTGCCAGAAGCAATGAGG - Intergenic
969668871 4:8578625-8578647 ATCTGAGGCCAGAAGCACTGGGG + Intronic
970219468 4:13796008-13796030 ATCTTATGCCAGAAGCAATAAGG - Intergenic
971058225 4:22937467-22937489 TAATTAGTCCACAAGCAATTTGG + Intergenic
971767217 4:30848499-30848521 AGATGAGGACAGATGCAATGAGG + Intronic
975717246 4:77216871-77216893 AAGTTTGGTCAGAAGCAAGGTGG + Intronic
978114486 4:105003074-105003096 AAATTCTGTCATAAGCAATGGGG - Intergenic
978229251 4:106378447-106378469 AAAGTAAGGCAGTAGCAATGGGG - Intergenic
980876804 4:138670031-138670053 AAATCAGACTTGAAGCAATGAGG - Intergenic
981319519 4:143375398-143375420 AGATACGGCAAGAAGCAATGGGG - Intronic
981902236 4:149880128-149880150 AGATTAGACCAGTGGCAATGAGG + Intergenic
983205684 4:164908432-164908454 AAAAGAGGTCAGAAGCAATCTGG - Intergenic
983717660 4:170805195-170805217 GAATTTGGCCAGAAGCAATCAGG + Intergenic
984369599 4:178846079-178846101 AAGATAGGCAAGGAGCAATGGGG + Intergenic
984480176 4:180290706-180290728 AAAATTTGCCAGAAGAAATGGGG - Intergenic
984636706 4:182118956-182118978 AAAATAGGCCATTAGCGATGTGG + Intergenic
984867701 4:184296341-184296363 CAATCAGGCCAGCAGGAATGAGG - Intergenic
984938003 4:184906514-184906536 AATTTAGGCCAGAAACAGTGAGG + Intergenic
985730131 5:1543118-1543140 AAATTAGGCCAGCAGCAACTGGG + Intergenic
985993583 5:3583909-3583931 AAGTTATGACAGAGGCAATGCGG + Intergenic
986211628 5:5678964-5678986 GAATTAGGGCAGCAGCCATGGGG + Intergenic
988625594 5:32871276-32871298 AGGTCAGGCCAGAGGCAATGAGG + Intergenic
989511086 5:42288443-42288465 AAAGTAGGGCAGCAGCAATGTGG + Intergenic
989971001 5:50523891-50523913 AAATTAGGCATAAGGCAATGAGG - Intergenic
992010165 5:72518009-72518031 AAATTAGGACTGAAGAAGTGTGG - Intergenic
992275124 5:75108061-75108083 AAATTAGAGAAGAAGCAGTGGGG - Intronic
992456491 5:76920881-76920903 AAATTAGGTAAGGAGCAGTGAGG + Exonic
993245438 5:85445780-85445802 AAATTAAACCAGAAGCCAAGGGG - Intergenic
993980452 5:94538326-94538348 AAATAAGTGCAGAAGCTATGGGG + Intronic
994716395 5:103326953-103326975 AAATTATTCCATTAGCAATGAGG + Intergenic
995317372 5:110791114-110791136 AAATTATGCTTGAAGCAAGGTGG - Intergenic
996115063 5:119609062-119609084 ACATGAGGCCAGAAGCAGGGCGG - Intronic
999630662 5:153567738-153567760 AAATAAGTGCAGAAGCAAGGTGG + Intronic
1001224814 5:169934518-169934540 CAATTAGGCTGGAAGAAATGTGG - Intronic
1001616145 5:173045172-173045194 AAATGAGGCCAGAGGCCATTTGG + Intergenic
1003396428 6:5756927-5756949 AAATTCAGCACGAAGCAATGGGG + Intronic
1007829512 6:44627706-44627728 AAATCAGGCAAGAGGCAAAGAGG - Intergenic
1008303117 6:49867073-49867095 AGATTTGTCCAGAAACAATGTGG + Intronic
1008362831 6:50642157-50642179 GAATGAGGTCAGAAGCATTGAGG + Intergenic
1016899243 6:149084838-149084860 AAGTTTGAACAGAAGCAATGTGG + Intergenic
1021698754 7:23297971-23297993 TAATTAGGCAAGAACTAATGAGG + Intergenic
1024387172 7:48765843-48765865 AAAATAGGAAAGAAGCAATCAGG - Intergenic
1024571374 7:50725314-50725336 AAATCATGGCAGAAGCAAAGGGG - Intronic
1027340421 7:77201806-77201828 AAAATAGGTGAGAAGAAATGAGG - Intronic
1027714479 7:81653024-81653046 GCATTAGGGCAGAAGCACTGGGG - Intergenic
1032336944 7:131034124-131034146 AAACTAGGCCAACAGCACTGAGG + Intergenic
1036424296 8:8629195-8629217 AAGATAGTCCAGAACCAATGTGG + Intergenic
1040001794 8:42583204-42583226 AAATTAGGCCTGACACAATCTGG - Intergenic
1040491926 8:47931673-47931695 AAGTTAGACAAGAGGCAATGGGG - Intronic
1045344641 8:101283090-101283112 AACTCAGGCCAGAAAAAATGAGG - Intergenic
1046014895 8:108592975-108592997 AAATTAAGGCAGAAGTAAAGAGG + Intergenic
1046817484 8:118600346-118600368 AAATTAGGACAAAGGTAATGAGG + Intronic
1051158136 9:14173879-14173901 TAATCAGGCTAGAAGCACTGTGG + Intronic
1051244361 9:15094321-15094343 AAATGAATCCAGAAGAAATGAGG - Intergenic
1051244670 9:15097821-15097843 TAATTAAGCCATCAGCAATGTGG - Intergenic
1051382679 9:16474344-16474366 AAAATAGGCAAGAGACAATGAGG + Intronic
1051406849 9:16746673-16746695 AAATTCGGCCAGGGGCAGTGTGG + Intronic
1052154255 9:25165221-25165243 AAAGTGGACCAGAAGCTATGGGG - Intergenic
1054461614 9:65468301-65468323 AAATTAGGTTAGAAGGAATATGG + Intergenic
1054887463 9:70214192-70214214 AAATTAGGGTATAAGGAATGAGG + Intronic
1056024548 9:82479623-82479645 ACATTAGGCCAGAAGCTGAGGGG + Intergenic
1056345599 9:85691228-85691250 AAATTATGCAAGAAACAATGGGG + Intronic
1057599103 9:96441651-96441673 AAATTTGGCCAGAGAAAATGTGG - Intergenic
1057994736 9:99810902-99810924 TATTTTGGCCAAAAGCAATGTGG - Intergenic
1058751793 9:108046217-108046239 AGATTATGCCAAAGGCAATGGGG + Intergenic
1059360094 9:113735415-113735437 AAATTGGGCCTGGAGAAATGAGG - Intergenic
1187100999 X:16191719-16191741 TAATTAGGCCACAAGCAACGGGG - Intergenic
1188953942 X:36412213-36412235 AAATGAGGCCATGAGCAATGAGG + Intergenic
1192112737 X:68381877-68381899 ACACTGGGACAGAAGCAATGTGG - Intronic
1194127097 X:90032285-90032307 TAGTTAGGCCAGAAGTGATGGGG + Intergenic
1196354240 X:114771233-114771255 AACTGAGGCAAGCAGCAATGAGG - Intronic
1199578044 X:149333764-149333786 AAACTATGACACAAGCAATGAGG + Intergenic
1199667916 X:150116351-150116373 CAATGATGCCAGAAGCAAAGAGG + Intergenic
1201251338 Y:12061234-12061256 AATTTTGGCCTGAAACAATGGGG - Intergenic
1201739190 Y:17305196-17305218 AAATAAGGCCCGAAGAAATATGG + Intergenic