ID: 1101769296

View in Genome Browser
Species Human (GRCh38)
Location 12:107733688-107733710
Sequence GCAGCTAGTAAGTTTAAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101769296_1101769298 20 Left 1101769296 12:107733688-107733710 CCTGCTTTAAACTTACTAGCTGC 0: 1
1: 0
2: 2
3: 11
4: 109
Right 1101769298 12:107733731-107733753 CTGTGTCCCAATCCATTCTGTGG 0: 1
1: 0
2: 1
3: 28
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101769296 Original CRISPR GCAGCTAGTAAGTTTAAAGC AGG (reversed) Exonic
904169536 1:28581832-28581854 GCAGCTAGTAAGTCGACACCGGG + Intergenic
905195834 1:36276558-36276580 GCATCAAGAAAGTGTAAAGCTGG + Intronic
905465562 1:38150644-38150666 GCTGCTAGTGATTATAAAGCAGG + Intergenic
907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG + Intronic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
910819390 1:91329490-91329512 GCAGCAAGGAAGTTTAAAAGGGG + Intronic
911392049 1:97257765-97257787 GCAGCTATTATGTTTGGAGCTGG + Intronic
911657433 1:100461100-100461122 ACAGCTAGTACCTTTAAGGCTGG + Intronic
914854001 1:151336866-151336888 CCAGCTAGAATGTTTAAAGTTGG + Intergenic
916948666 1:169757433-169757455 CCAGCTAGTAAGTTAGAATCTGG - Intronic
919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG + Intergenic
921904981 1:220486722-220486744 GCATCTAGTAGGTAGAAAGCAGG - Intergenic
922888928 1:229045749-229045771 GCAGATAGAAAGTTGAAAGGGGG + Intergenic
1062956888 10:1546413-1546435 GCAGGTGGTAATTTTAGAGCTGG - Intronic
1064825879 10:19400127-19400149 GGAGCTTGTGAGTTTAAAGTGGG + Intronic
1068106245 10:52620477-52620499 GCAGGCAGTAACTATAAAGCTGG + Intergenic
1074332940 10:112537808-112537830 GCAGATAGAAATTTTAAAACAGG - Intronic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1080319001 11:30984682-30984704 GCAGCTGTTTAGTTGAAAGCAGG + Intronic
1080647903 11:34200103-34200125 GCTGCTAATAAGTTGAAACCTGG + Intronic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1084102108 11:66956625-66956647 GCAGCTAGAAAGTTTTATTCTGG - Intronic
1086113072 11:83219476-83219498 GCGTATAGTAAGTTTAAAGGGGG + Intronic
1087902030 11:103651661-103651683 ACAGCTAGAAAGTTGAAGGCTGG - Intergenic
1090962417 11:131568855-131568877 GGAGCTATTAAGTATACAGCTGG - Intronic
1091317801 11:134627039-134627061 GCAGCTTGTAAATTTAAAGCTGG + Intergenic
1094534245 12:31306943-31306965 GAAGGTGGTAAGGTTAAAGCAGG - Intronic
1100439700 12:94605194-94605216 GAAGCCAGGAATTTTAAAGCAGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103967826 12:124651439-124651461 GAAGCTATTAAGTTTTAAGCAGG - Intergenic
1104510536 12:129373690-129373712 GCAGGAAGCATGTTTAAAGCAGG + Intronic
1106595818 13:31135470-31135492 GCAGCTAGAAATTATAAAGTAGG + Exonic
1119073611 14:71613264-71613286 GCAGTTAATATGTTTAAATCTGG + Intronic
1119827291 14:77668011-77668033 GCACCTTGGAAGTTCAAAGCAGG - Intergenic
1133182698 16:4070298-4070320 GCAGCTAGTAACTGGAAAACTGG + Intronic
1133630649 16:7617142-7617164 ACAGCTTGTTAGCTTAAAGCAGG + Intronic
1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG + Intronic
1138325661 16:56164819-56164841 GAAGATAGTAAGTTAATAGCTGG - Intergenic
1140441785 16:74993461-74993483 GCAGCTAGTAAGAGCAGAGCTGG - Intronic
1140746974 16:77989083-77989105 CCAGCTAGTAACTATACAGCTGG - Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1148336286 17:46843634-46843656 CCAGCTAGTAAGCTTAGAACCGG - Intronic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1154246128 18:12701463-12701485 ACATCTACTAAGTTGAAAGCTGG - Intronic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1160191422 18:76717279-76717301 GCTGCTAGCAAATATAAAGCAGG - Intergenic
1167320522 19:48794896-48794918 GCAGATAGTAAGTTCAGTGCCGG + Intergenic
1167698296 19:51027441-51027463 GCAGCCAGTAAGTGAACAGCTGG - Exonic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
932094928 2:68839174-68839196 GCAGGAGGGAAGTTTAAAGCTGG - Intergenic
932850689 2:75181984-75182006 AGAGCTAGTCAGTTTAGAGCTGG + Intronic
934552415 2:95270542-95270564 GCCGCTAGGAGGTTTGAAGCAGG + Intergenic
936594665 2:113836407-113836429 GTAGCTAGTAAGTGAAGAGCTGG - Intergenic
940171769 2:150836269-150836291 GCTGCTAGGAAATATAAAGCAGG - Intergenic
943561750 2:189472277-189472299 GCAGCTTGTAATTTTAAACAGGG + Intronic
944026231 2:195171724-195171746 GCAGCTTGTAAGTGGCAAGCTGG + Intergenic
944520984 2:200566717-200566739 GCGGCTAGGAAGCTTGAAGCCGG - Intronic
946681238 2:222218948-222218970 GCAGCTGAAAAGTTCAAAGCCGG - Intronic
948100783 2:235371054-235371076 GCAGCTGGTAACTTTTGAGCTGG - Intergenic
1170273383 20:14554061-14554083 GCAGCTAGCAAATATTAAGCTGG - Intronic
1172915510 20:38440549-38440571 GCAACGAGTATGTTGAAAGCAGG - Intergenic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1177198739 21:17930326-17930348 GCTGCTAATAAGATGAAAGCAGG - Intronic
1177481950 21:21701489-21701511 GCAGCTGGTAAGATAAAAACAGG - Intergenic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1183212345 22:36458653-36458675 GAAGCTAGCAAGTTTGGAGCAGG - Intergenic
949641024 3:6036151-6036173 GCAGCCAGGAAGTTTAAAGTGGG - Intergenic
951519472 3:23597984-23598006 GCAGGTAGGAAGTTTAACTCTGG - Intergenic
953274902 3:41485259-41485281 TCATCTAGCAAGTTTAAAGTGGG + Intronic
953824843 3:46242313-46242335 GAAGCTAGTCTGTTTAAAACAGG + Intronic
959107168 3:102077656-102077678 ACAGCAAGTCATTTTAAAGCAGG - Intergenic
959362762 3:105414902-105414924 GCAGAGAGTGAGTTTAAAGCTGG + Intronic
960078681 3:113516729-113516751 GCACTTAGTAAGTGTAAAGTAGG - Intergenic
960364700 3:116757112-116757134 GCTGGTGGTAAGGTTAAAGCTGG - Intronic
967158797 3:186717578-186717600 GCTGCTACTAAGTTTAACCCAGG + Exonic
971059419 4:22950838-22950860 TCAGATAGTTAGTTTAAACCTGG + Intergenic
971560584 4:28075136-28075158 TCAGCTAGTAATTTAAAACCTGG - Intergenic
974313072 4:60238335-60238357 TCAGTTAATAAGTATAAAGCTGG - Intergenic
974431923 4:61809570-61809592 GCAGCTAGCAATTTTAAATAGGG - Intronic
975860037 4:78667406-78667428 GCAGCTAGAAAGTATTAAGTGGG - Intergenic
978893923 4:113862761-113862783 GCTGCTAGTGAATATAAAGCAGG + Intergenic
986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG + Intronic
991566026 5:68005260-68005282 GCAGATAGTAGGTATAAAGAAGG - Intergenic
993117029 5:83731959-83731981 ATATCTTGTAAGTTTAAAGCAGG + Intergenic
993413021 5:87595372-87595394 GCAGCCAGTGAATATAAAGCAGG - Intergenic
997316781 5:132943141-132943163 GCAGCTGGTGAATTTGAAGCTGG + Intronic
999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG + Intronic
1001006645 5:168057489-168057511 GCAGCTAGCTAGTTTTAGGCAGG - Intronic
1001859384 5:175040142-175040164 GCTGCTATTAAGTTGAAAGAGGG - Intergenic
1005303625 6:24494140-24494162 GCCACTAGTAAGATTAAAGTTGG - Intronic
1014763318 6:125382159-125382181 GCAGCTAGTAAGTAAAAAACTGG - Intergenic
1016493548 6:144633973-144633995 GCAGCTAGACATTTAAAAGCAGG - Intronic
1022240764 7:28510524-28510546 GCAGCTAGAAGTTTTAAAGGTGG - Intronic
1027835843 7:83240808-83240830 GCATCCAACAAGTTTAAAGCAGG - Intergenic
1030930976 7:115523157-115523179 GCTGCAAGCAAATTTAAAGCAGG - Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1033861834 7:145637915-145637937 GCAGCAAGTAAGATTTAAGGAGG - Intergenic
1038792894 8:30684352-30684374 ACAGCTGGCAAGTTTCAAGCTGG + Intronic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1042864939 8:73348929-73348951 ACGGCTAGTAAGTTTGGAGCTGG + Intergenic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1044614807 8:94129001-94129023 CCTGCTAGTAAGTTTATAGGAGG + Intronic
1047654611 8:126963505-126963527 GCTGCTAGTAAGTGTGGAGCGGG + Intergenic
1048619393 8:136115149-136115171 GCAGATATTAAGTTAAATGCTGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049524641 8:143117079-143117101 GCAGAGAGTAAGTGAAAAGCAGG + Intergenic
1050186461 9:2980239-2980261 GCAGTAAGTCAGTTTCAAGCAGG + Intergenic
1056313922 9:85370415-85370437 GCTGCTAGCAAATATAAAGCAGG - Intergenic
1056739286 9:89239479-89239501 TCAGCTAGTAAGTACAGAGCTGG - Intergenic
1058923116 9:109637063-109637085 AAAGCTAGTAAATGTAAAGCTGG + Intergenic
1059393018 9:114011114-114011136 GCAGCTATTAAGTGTCGAGCTGG - Intronic
1059870548 9:118569037-118569059 GCAGTTAGCAAGTTTAGACCTGG - Intergenic
1061560022 9:131395851-131395873 GCAGTTGGTCAGTTTAAGGCAGG + Intronic
1185653287 X:1664881-1664903 ACAGCTATTAACATTAAAGCTGG + Intergenic
1186318894 X:8402260-8402282 GCAGCCATTAAGTCTAAAGGGGG - Intergenic
1191015403 X:55804669-55804691 GCATCTAGAAAGTGTAAAGTTGG - Intergenic
1193053811 X:77128278-77128300 GCTGCCAGCAAATTTAAAGCAGG + Intergenic
1193433315 X:81438990-81439012 GCAGCCAGCAAATATAAAGCAGG - Intergenic
1197386819 X:125812596-125812618 GCTGCCAGTAAATATAAAGCAGG + Intergenic