ID: 1101769298

View in Genome Browser
Species Human (GRCh38)
Location 12:107733731-107733753
Sequence CTGTGTCCCAATCCATTCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101769297_1101769298 -2 Left 1101769297 12:107733710-107733732 CCAAGTAGCACACTTATGCTGCT 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1101769298 12:107733731-107733753 CTGTGTCCCAATCCATTCTGTGG 0: 1
1: 0
2: 1
3: 28
4: 197
1101769296_1101769298 20 Left 1101769296 12:107733688-107733710 CCTGCTTTAAACTTACTAGCTGC 0: 1
1: 0
2: 2
3: 11
4: 109
Right 1101769298 12:107733731-107733753 CTGTGTCCCAATCCATTCTGTGG 0: 1
1: 0
2: 1
3: 28
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101769298 Original CRISPR CTGTGTCCCAATCCATTCTG TGG Exonic
903229711 1:21914398-21914420 CTGTTTTCCAAAACATTCTGAGG - Intronic
904586738 1:31584899-31584921 TCGTGTCTCAATCCATTCTCTGG + Exonic
905115007 1:35631050-35631072 GTGTGTCCCAACCAATTCTCTGG + Intronic
906920058 1:50054764-50054786 CCTTTTCCCAATCCTTTCTGTGG + Intronic
909251265 1:73359517-73359539 GTGTCTCCCAGTCCATTCTTTGG + Intergenic
911178624 1:94842046-94842068 CTGTGTCCAATTCTATGCTGAGG - Exonic
913167027 1:116197680-116197702 CTGTGTGCAAATACATTCAGAGG + Intergenic
913249418 1:116900058-116900080 ATGTGTCCCATTCCACACTGTGG - Intergenic
915315999 1:155029626-155029648 CTGTGGCCCATTCCAGTCTAAGG + Intronic
917747128 1:178021197-178021219 CTGGGTCCCCTTCCATCCTGTGG - Intergenic
920681577 1:208077163-208077185 CTGTGTCCCAAGCCACTCGGGGG - Intronic
921106566 1:211986733-211986755 CTGGCTCCCAATTCAGTCTGTGG + Intronic
921828321 1:219699336-219699358 CTGTGTAGCAAACCATCCTGAGG - Intronic
922766852 1:228160467-228160489 CTGAGTCCCTCTCCTTTCTGGGG + Intergenic
922902455 1:229147537-229147559 CTATCTCCAAATACATTCTGAGG + Intergenic
922948537 1:229538165-229538187 GTGTTTTCCAACCCATTCTGTGG + Intronic
1065353834 10:24819972-24819994 CTGTGTCCCAAGCTACTCAGAGG + Intergenic
1067244038 10:44521368-44521390 CTATCTCCAAATACATTCTGAGG - Intergenic
1070861141 10:79663369-79663391 TTCTGACCCAATCAATTCTGGGG - Intergenic
1070876114 10:79812228-79812250 TTCTGACCCAATCAATTCTGGGG + Intergenic
1071643047 10:87334361-87334383 TTCTGACCCAATCAATTCTGGGG + Intergenic
1071710571 10:88045196-88045218 CTGAGTCCCAACTCATTCTGGGG - Intergenic
1071751272 10:88478927-88478949 CTGTCTCTCAAGCCATGCTGAGG + Intronic
1073444644 10:103573482-103573504 ATTTGTCCCCACCCATTCTGGGG + Intronic
1076552849 10:131295174-131295196 CTGTGTCACAGTCCATTATTTGG + Intronic
1076743624 10:132500998-132501020 CTGAGTTAAAATCCATTCTGTGG - Intergenic
1076881705 10:133242551-133242573 CTGTTTCCCACTCTCTTCTGGGG + Intergenic
1077807416 11:5603742-5603764 CTGTCTCCCATTCCATCCTGGGG - Intronic
1080853784 11:36094039-36094061 CAGTTTCTCAATCCAGTCTGTGG + Intronic
1081671850 11:44946897-44946919 CTGTGTGCCAGTCCAGGCTGAGG - Intronic
1083212093 11:61194377-61194399 CTGTGTCCCAGTCCACGCTCCGG - Intergenic
1083938279 11:65881704-65881726 CTGTGTCCTAATCCAGCCTAGGG + Intronic
1084967251 11:72751212-72751234 CTGTGTCCCATTCCTGGCTGGGG - Intronic
1087053166 11:93906248-93906270 CTGTATCCCAATTCATTATTGGG + Intergenic
1087140571 11:94761550-94761572 CTCTCTCCCAATCCATACTTTGG + Intronic
1087323696 11:96695644-96695666 ATGTGTCCCAATACAATGTGTGG + Intergenic
1089712838 11:120328644-120328666 CTGTGTCCTAATCCCTTCTAAGG + Intronic
1089712843 11:120328727-120328749 CTGTGTCCTAATCCCTTCTAAGG + Intronic
1089712847 11:120328808-120328830 CTGTGTCCTAATCCCTTCTAAGG + Intronic
1089712851 11:120328883-120328905 CTGTGTCCTAATCCCTTCTAAGG + Intronic
1089712855 11:120328970-120328992 CTGTGTCCTAATCCCTTCTAAGG + Intronic
1089712859 11:120329045-120329067 CTGTGTCCTTATCCCTTCTAAGG + Intronic
1089846663 11:121464250-121464272 CTGTGACCCATTCTATTCAGTGG + Intronic
1090692066 11:129194383-129194405 CTGTGTAGCATTCCATTCTATGG - Intronic
1092318210 12:7441499-7441521 CTGTGTCCAAATATATTTTGTGG + Intronic
1094377424 12:29804875-29804897 TTGAGTCCCAAGACATTCTGAGG + Intergenic
1097393735 12:59047864-59047886 CTGTGTCTAAATACATTCAGAGG - Intergenic
1098494019 12:71113773-71113795 CTCTCTCCCAATCCATCCTGAGG - Intronic
1099424191 12:82502492-82502514 CTGTCAGACAATCCATTCTGTGG + Intergenic
1100347086 12:93742786-93742808 TTGTGTCCCGAGCCATTCCGCGG + Intronic
1101672780 12:106892240-106892262 CTGATTCCCAAGCCATTCTGGGG - Intergenic
1101769298 12:107733731-107733753 CTGTGTCCCAATCCATTCTGTGG + Exonic
1107403982 13:40095865-40095887 GTGTGTTCTAATCCCTTCTGTGG + Intergenic
1107720799 13:43246358-43246380 CTGTGACCAAATCCCTCCTGAGG + Intronic
1107954942 13:45502596-45502618 CTGTTTCCTAATCAATTCTCTGG + Intronic
1107960244 13:45550846-45550868 GTGTGCCCCAATCCAATATGGGG - Intronic
1111167125 13:84474128-84474150 CTGTGTCCAAAATCATCCTGAGG - Intergenic
1112379809 13:98878094-98878116 CTGTGTCCTAATCTCTTCTTAGG - Intronic
1113452830 13:110423915-110423937 CTGAGTCCTATTCCATTGTGTGG + Intronic
1114030604 14:18576291-18576313 GTGTGTTCTTATCCATTCTGTGG + Intergenic
1116614005 14:47110535-47110557 CTTTTTCATAATCCATTCTGGGG + Intronic
1117481691 14:56152143-56152165 CTTTGTCCCAAACCATTACGTGG + Intronic
1120417783 14:84242205-84242227 CTGTGGCCCATTCCATTATGTGG + Intergenic
1120446532 14:84604649-84604671 CTGTGTAGCAATGCATTCTATGG - Intergenic
1121426136 14:93853482-93853504 CTGTCTCCAAATACATTCTGAGG - Intergenic
1121866252 14:97365414-97365436 CTGTGTTCCAGGCCATTGTGTGG + Intergenic
1123727241 15:23115209-23115231 CTGTGTAGCCCTCCATTCTGGGG - Intergenic
1123758646 15:23416190-23416212 CTGTGAGACAATACATTCTGTGG + Intergenic
1127077749 15:55344520-55344542 CTGTGTCCCATCCCACTATGAGG - Intronic
1128561757 15:68673201-68673223 ATGGATCCCAATCAATTCTGAGG - Intronic
1128880307 15:71236402-71236424 CTGGGTCCCTCTCCATTCTGAGG + Intronic
1131614946 15:94006261-94006283 CTGGGTCCCATTCCATGCTGTGG + Intergenic
1131672165 15:94631618-94631640 CTGTGGCCCTGTCCATTTTGGGG + Intergenic
1134457689 16:14406671-14406693 CTGTGAGACAATACATTCTGTGG - Intergenic
1134759458 16:16701157-16701179 CTCTCTCCCAATCCATTATCTGG + Intergenic
1134986612 16:18658037-18658059 CTCTCTCCCAATCCATTATCTGG - Intergenic
1135338889 16:21629714-21629736 CTGGGTCCCCATCCATGCTGAGG - Intronic
1137036235 16:35572316-35572338 CTATGTCATAATCCACTCTGAGG + Intergenic
1137388669 16:48063343-48063365 CTGTGTCCCTACCCATTCCCTGG - Intergenic
1141009323 16:80382582-80382604 CTGTGTTCCAGTGCCTTCTGGGG + Intergenic
1143597894 17:7926323-7926345 CTGTGTACCAAGCCCTGCTGTGG + Intronic
1143896512 17:10140938-10140960 CTGTGTCCCACTCCCTGCTTGGG - Intronic
1145271333 17:21406437-21406459 CTGTGTCCCCATCAGTTTTGAGG + Intronic
1145309538 17:21693841-21693863 CTGTGTCCCCATCAGTTTTGAGG + Intronic
1147425608 17:40344651-40344673 CTGTCCCCACATCCATTCTGGGG + Intronic
1150049454 17:61946509-61946531 ATGTCTCCCAATTCATTTTGTGG - Exonic
1150515028 17:65799383-65799405 CTGTCTCCCACTCAATTCTGGGG + Intronic
1150737142 17:67750735-67750757 CAGTTTCCCAATCCAGTCTGTGG - Intergenic
1152185808 17:78855792-78855814 CTGTGACCCAGTCCATCCAGAGG + Exonic
1154299405 18:13180100-13180122 CTGTGCCCCAACCCATTTAGTGG + Intergenic
1156625539 18:38903194-38903216 GTGTGTCCCGCTCCATCCTGTGG + Intergenic
1156735042 18:40245889-40245911 TTGGGTCCCATTCCATGCTGTGG + Intergenic
1157789112 18:50515138-50515160 CTGGATCCTCATCCATTCTGGGG - Intergenic
1158283485 18:55852783-55852805 CTGTGTCCATATCCAGCCTGTGG - Intergenic
1160142518 18:76338368-76338390 CTGTCTCCGAGTCCATTCTTTGG - Intergenic
1160709245 19:543396-543418 CTGTGTCACATCCCATTGTGTGG - Intergenic
1164099967 19:22045898-22045920 ATGTGTTACAATCCAATCTGTGG + Intergenic
1164193676 19:22934419-22934441 ATATGTCACAATCTATTCTGTGG - Intergenic
1164204361 19:23045522-23045544 ATGTGTCACAATCCAATTTGTGG + Intergenic
1164210994 19:23097227-23097249 ATGTGTCACAATGCCTTCTGAGG - Intronic
1164303689 19:23984609-23984631 ATATGTCACAATCCCTTCTGTGG + Intergenic
1164311404 19:24049507-24049529 ATATGTCACAATCCTTTCTGGGG - Intronic
1168309427 19:55452967-55452989 CTGTGGACCAAACCATTCTTGGG - Exonic
926009020 2:9393852-9393874 CTTTGTCTGAATTCATTCTGTGG - Intronic
927328156 2:21830754-21830776 GTGTGTTCTGATCCATTCTGTGG + Intergenic
927672533 2:25081182-25081204 CTTTTTCCCAATCATTTCTGAGG + Intronic
932412202 2:71554154-71554176 CTGTGTCCCACTGCACACTGGGG - Intronic
932652275 2:73571149-73571171 GTGTGTCCCACTCTACTCTGGGG + Intronic
934035060 2:88082360-88082382 CTGTGTCCCCATCCACTAGGAGG - Intronic
935084791 2:99834623-99834645 CTGTGGTCTAATCCATTGTGTGG + Intronic
935278647 2:101497965-101497987 CTATTTCCAAATGCATTCTGAGG + Intergenic
935941814 2:108246490-108246512 CTGTGTCCCCACCCATTATAAGG - Intergenic
938997631 2:136697379-136697401 CTTCGTCCCAATCCAGTCTCAGG + Intergenic
942656702 2:178221094-178221116 TTGTTTCCCCCTCCATTCTGGGG + Intronic
945287513 2:208097144-208097166 CTGTGTCTCACTCCATGTTGAGG + Intergenic
946776913 2:223152431-223152453 CTGTTTCCCAATGCATTGTATGG - Intronic
947252057 2:228118208-228118230 CTGAGTAGCATTCCATTCTGTGG + Intronic
948817501 2:240520156-240520178 CGGTGTCCAAATCCTGTCTGGGG + Intronic
1169691953 20:8342018-8342040 CTGTGTCCCCATGCTTTCTAGGG + Intronic
1173388627 20:42611553-42611575 CTGTATCCCAGTCCACTCTCAGG + Intronic
1174004899 20:47402766-47402788 CTATGTGCCAAGCCTTTCTGAGG + Intergenic
1174045777 20:47731665-47731687 CTGTGTCCCCCTCGGTTCTGAGG - Intronic
1174116522 20:48230185-48230207 CTGTGTCCCAGGCCACTGTGGGG + Intergenic
1179628692 21:42663745-42663767 CTGTGTCACACTCCACACTGAGG + Intronic
1180454718 22:15503347-15503369 GTGTGTTCTTATCCATTCTGTGG + Intergenic
1181784595 22:25217910-25217932 CTGTGTCTTGATCCAATCTGAGG - Intergenic
1183081725 22:35461116-35461138 CTGTGTCCTAATCTCTTCTTAGG + Intergenic
1183465027 22:37975419-37975441 CTGTGTCCAGTTTCATTCTGAGG + Intronic
1184090388 22:42290147-42290169 CTGGGCCCCAATCCTTGCTGGGG + Intronic
1185168522 22:49277130-49277152 GTGTGTCCTGATCCATCCTGGGG + Intergenic
949449293 3:4167239-4167261 CTGGGTCCCCTTCCATGCTGTGG - Intronic
950024951 3:9813820-9813842 CTGTGTCCCTCCCCACTCTGTGG - Intronic
954238918 3:49277978-49278000 CTGTGTTCCTCTCCATTCTTCGG + Intronic
955150935 3:56366535-56366557 CTGTGTCTGATTCCATTCTCTGG + Intronic
955854094 3:63254753-63254775 CTGTGTCCAAATACATTCCAAGG - Intronic
956516416 3:70053526-70053548 TAGAGTCCCAAGCCATTCTGAGG + Intergenic
956526597 3:70169950-70169972 CAGTGTCCCCCTCCTTTCTGGGG - Intergenic
959355249 3:105319279-105319301 CTGTGTGCCCATCTATTCTTAGG + Intergenic
960946391 3:122969669-122969691 CTGTGTCCCACTCACTGCTGCGG + Intronic
964129608 3:153272325-153272347 CTATGGCACAATCCATTCTGAGG - Intergenic
968881676 4:3303350-3303372 CTGTGTCCCCATCCAGTCGGAGG - Intronic
970047159 4:11867655-11867677 CAGTGAGCCAATCCATTCTTGGG - Intergenic
971805595 4:31354788-31354810 CTGTCTCCAAATACATTCTTAGG - Intergenic
972286624 4:37655343-37655365 CTATCTCCAAATACATTCTGAGG - Intronic
972309569 4:37867366-37867388 CGGGTTCTCAATCCATTCTGAGG - Intergenic
977561600 4:98538426-98538448 CTCTGTCCCTGTCCATCCTGTGG - Intronic
983247300 4:165303020-165303042 CTGTGTCATAAACCATTGTGTGG - Intronic
984988355 4:185352915-185352937 CTGTGGCCCACTGCCTTCTGGGG - Intronic
985202466 4:187497977-187497999 CTGTGACCTAATCCATCCTAAGG - Intergenic
985385333 4:189440520-189440542 CTGTGACCCAATCCATGCCTGGG + Intergenic
986049583 5:4076474-4076496 CTGTGACCCAACTCAATCTGGGG - Intergenic
986682700 5:10248667-10248689 CTGTGTTCCCATCTACTCTGGGG - Intronic
988737994 5:34041721-34041743 CAGTTGCCCAAACCATTCTGTGG - Intronic
989256176 5:39367668-39367690 CTCTGTCCCACTCCAGCCTGGGG + Intronic
990677620 5:58205481-58205503 CTGAGTCCCAAGCCACTATGTGG - Intergenic
991975949 5:72183862-72183884 CTGGGTCCCTATCCAGTGTGTGG - Intronic
993980317 5:94537111-94537133 CATCATCCCAATCCATTCTGAGG + Exonic
994449532 5:99924511-99924533 CTGTGTTGCCATTCATTCTGAGG - Intergenic
994606778 5:101977651-101977673 CTGTGTGCCAGTCACTTCTGAGG - Intergenic
996018319 5:118565778-118565800 CTGCGTCCCATTTCATTGTGAGG + Intergenic
996670071 5:126107334-126107356 CTGTGTCCTAATCTCTTCTAAGG - Intergenic
998531457 5:142889033-142889055 CTGTGGCCCACACCATTCTGGGG + Intronic
998761768 5:145440053-145440075 CTGTGTGCTAGTCCACTCTGAGG + Intergenic
1000313744 5:160069322-160069344 CTGTCTCCCACTGCATTCTTTGG - Intronic
1003268522 6:4587669-4587691 CCTTGTCCCCATCCATTCTTGGG + Intergenic
1004932200 6:20473659-20473681 CTGAGTCCCAATCCCTTCAAGGG - Intronic
1005114137 6:22317887-22317909 CTGGGTCCCCTTCCATGCTGTGG - Intergenic
1006765303 6:36499695-36499717 ATGTATCCCACTCCATTCTTGGG - Intronic
1007273711 6:40658164-40658186 CTGTGTCCAAATCCAGGCTGTGG + Intergenic
1007805232 6:44439201-44439223 CTGAGTACCATTCCATTGTGTGG + Intronic
1009275728 6:61676759-61676781 CTGTGTTCCAAACCCATCTGAGG + Intergenic
1009868214 6:69424339-69424361 CTGTGTCCCATTCTATTCTTGGG - Intergenic
1010752246 6:79628803-79628825 CTGTGTCCAAATGCATTCTGAGG - Intergenic
1010897087 6:81377932-81377954 CTGTGTCCGAATCCTTGCTTTGG - Intergenic
1014622839 6:123690941-123690963 CTGTGTGGCAATACACTCTGGGG - Intergenic
1016037704 6:139400350-139400372 CTCTGTCACAAGCCTTTCTGCGG + Intergenic
1020933355 7:14428379-14428401 TTGTGTCACTATACATTCTGAGG + Intronic
1021147044 7:17101776-17101798 CAGGTTCTCAATCCATTCTGAGG + Intergenic
1021258377 7:18422792-18422814 CTTTAACCCAATCCATTCTGAGG - Intronic
1021587498 7:22224768-22224790 CTGTCTCCAAATCGAGTCTGTGG - Intronic
1022192154 7:28026844-28026866 CTGTGGCATAAGCCATTCTGCGG - Intronic
1022992645 7:35724043-35724065 CTGTGTTCAAATACATACTGAGG + Intergenic
1023494303 7:40778078-40778100 CTGTGTCCCAGTCCTCTCTGTGG - Intronic
1023862201 7:44223514-44223536 CTCTGTCCCAACACATGCTGTGG + Intronic
1024709636 7:52000981-52001003 GTGTGACCCAATCAATTCAGTGG + Intergenic
1025761438 7:64399710-64399732 ATGTGTCACAATCCCTTCTGAGG - Intergenic
1025782430 7:64613715-64613737 ATGTTTCACAATCCAATCTGTGG - Intergenic
1028384469 7:90239139-90239161 CTATCTCCAAATACATTCTGAGG - Intergenic
1029149899 7:98472450-98472472 CTGTGTCTCCATCCTTCCTGTGG - Intergenic
1030379772 7:108799187-108799209 CGGTCTCCCAATGCATTCTGAGG - Intergenic
1030479925 7:110090424-110090446 CTGTGTTCCAGTCTATTATGAGG - Intergenic
1031732400 7:125315151-125315173 CTGGGTCCCCTTCCATGCTGTGG + Intergenic
1031946815 7:127850778-127850800 AAGTGTGCCTATCCATTCTGAGG + Intronic
1034037062 7:147836019-147836041 CTGTGAGCCAATACATTCTGTGG + Intronic
1035036357 7:155897794-155897816 CTGGGTCCCAGTCCATGGTGGGG - Intergenic
1035218334 7:157388510-157388532 ATGTGGTCCCATCCATTCTGGGG + Intronic
1036782979 8:11662754-11662776 CTGTGACCCAAGCCATTCAAGGG + Intergenic
1036837717 8:12089321-12089343 TTGGGTCCCCTTCCATTCTGTGG + Intergenic
1038950946 8:32413859-32413881 CTGTGTCCCAGTTCACCCTGGGG - Intronic
1039809127 8:41028894-41028916 CTGAGTCCAAATCCTTCCTGTGG + Intergenic
1041129765 8:54685608-54685630 CTGTGTTCAAATTCATTCTCTGG - Intergenic
1044013688 8:87025305-87025327 CTGGGTCCCCTTCCACTCTGTGG + Intronic
1045996951 8:108374170-108374192 CTGTTACCCAGTTCATTCTGTGG + Intronic
1050416919 9:5427992-5428014 CTGTGTCATACTCCCTTCTGGGG + Intronic
1053360780 9:37485451-37485473 CTGTGGCCCAATCAACACTGAGG - Intergenic
1055960740 9:81818038-81818060 CTTTCTCCAAATACATTCTGAGG + Intergenic
1056763771 9:89432274-89432296 AAATGACCCAATCCATTCTGTGG - Intronic
1057042283 9:91856440-91856462 CTGTCTCCAAATGCATTCTAAGG - Intronic
1058630144 9:106978173-106978195 CTATGTCCCAATAAAGTCTGGGG + Intronic
1058836292 9:108861132-108861154 CTGTGTCCCAGCACATCCTGGGG + Intergenic
1060983126 9:127804728-127804750 CTGTGTCCCAATGGACCCTGGGG + Intronic
1185981545 X:4785364-4785386 CAGTGTTCCACTCCTTTCTGCGG + Intergenic
1186124381 X:6397238-6397260 CTGTCTTCAAATGCATTCTGAGG + Intergenic
1187437280 X:19284193-19284215 CTGTCTTGCCATCCATTCTGTGG - Intergenic
1187566470 X:20454472-20454494 CTAGGTCCCAATCCATTTTGGGG + Intergenic
1187676096 X:21718069-21718091 CAGTGACCCGATCCATTTTGTGG + Intronic
1188171784 X:26936614-26936636 CAGAGTCCCAGTCCATTCCGAGG + Intergenic
1193527407 X:82610955-82610977 CTGTGTCCCAACCAAATCTCAGG + Intergenic
1194326583 X:92525932-92525954 TTGTATCCCAATTCATTCTTAGG - Intronic
1197513023 X:127395085-127395107 TTGTGTCCCCTTCCATGCTGTGG + Intergenic
1198055205 X:132987366-132987388 GTGTGTCCCAAACCCTGCTGTGG - Intergenic
1198374353 X:136023222-136023244 TAGTGTCCCATTCCCTTCTGTGG + Intronic
1200635297 Y:5645137-5645159 TTGTATCCCAATTCATTCTTAGG - Intronic
1200801334 Y:7389624-7389646 TTGGGTCCCATTCCATGCTGTGG - Intergenic
1202260512 Y:22965574-22965596 GTATGTCACAATTCATTCTGCGG - Intergenic
1202413499 Y:24599315-24599337 GTATGTCACAATTCATTCTGCGG - Intergenic
1202457283 Y:25070753-25070775 GTATGTCACAATTCATTCTGCGG + Intergenic