ID: 1101773691

View in Genome Browser
Species Human (GRCh38)
Location 12:107775085-107775107
Sequence CTGTCTTTGCAGAAGTTTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 399}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101773691_1101773693 -8 Left 1101773691 12:107775085-107775107 CCCAGAAACTTCTGCAAAGACAG 0: 1
1: 0
2: 2
3: 28
4: 399
Right 1101773693 12:107775100-107775122 AAAGACAGACCCACTGAGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101773691 Original CRISPR CTGTCTTTGCAGAAGTTTCT GGG (reversed) Exonic
900465494 1:2823247-2823269 ATGTCTGTGCAATAGTTTCTCGG - Intergenic
900688616 1:3965700-3965722 CAGTTTATGCAGAAATTTCTAGG - Intergenic
900787846 1:4659934-4659956 CGGTTTATGCAGAAATTTCTAGG - Intronic
901385091 1:8902905-8902927 CTGTCTGTTCAGACTTTTCTTGG - Intergenic
904407835 1:30305012-30305034 CAGAGTATGCAGAAGTTTCTAGG - Intergenic
904526400 1:31136982-31137004 GTGTCCCTGCAGCAGTTTCTGGG - Intergenic
904585548 1:31577792-31577814 CTGCCTTTGCTGAGGATTCTAGG + Intronic
904588303 1:31592539-31592561 CAGTTTATGCAGAAATTTCTAGG - Intergenic
904714386 1:32456241-32456263 CAGTTTGTGCAGAAATTTCTAGG - Intergenic
905492352 1:38354565-38354587 CTTTCTTTGAAGAAGTTTACAGG - Intergenic
905660016 1:39714630-39714652 CAGTTTGTGCAGAAATTTCTAGG - Intronic
909326873 1:74362657-74362679 CTGTCTTTGTAACAGTCTCTTGG + Intronic
909559902 1:76998681-76998703 CAGGTTTTGCAGAAGTCTCTGGG - Intronic
909596686 1:77413712-77413734 CTGTCTTTGCAGCAGATTTGAGG + Intronic
909872179 1:80755456-80755478 CTGCCTATGTAGAAATTTCTAGG + Intergenic
910187609 1:84560354-84560376 CTGTCTGTTCAGATTTTTCTTGG - Intronic
910292479 1:85612855-85612877 CTCTTTTTGGAGAAGTTTCCAGG - Intergenic
912474379 1:109926314-109926336 CTGGCTTGACAGAAGTTTATGGG - Intronic
912971404 1:114287076-114287098 CAGTTTATGCAGAAATTTCTAGG + Intergenic
914747009 1:150508479-150508501 GTTTCTTGGCAGCAGTTTCTAGG - Intronic
915052675 1:153092786-153092808 CTGTCATTTTAGAAGTTTATTGG - Intergenic
915132550 1:153705752-153705774 CGGGCTATGCAGAAATTTCTAGG - Intergenic
915909744 1:159907158-159907180 CTGTCTGTTCAGATTTTTCTTGG - Intergenic
916349143 1:163829225-163829247 CTGTATTTCCAGAATTTTCTGGG + Intergenic
916442423 1:164840819-164840841 CTGTCTTTTGAGTATTTTCTAGG + Intronic
919887565 1:201946092-201946114 CTCCCTCTGCATAAGTTTCTTGG + Exonic
920570584 1:207013935-207013957 AAGTCTGTTCAGAAGTTTCTGGG + Intronic
922054746 1:222030356-222030378 ATGTGTTTGCAGAAGGTTTTTGG + Intergenic
922284349 1:224155530-224155552 CTGTTTTTGCAAAAGTATATTGG + Intronic
923007094 1:230058745-230058767 CTGTCTTCCCAGAAATTGCTTGG - Intronic
1063188496 10:3671207-3671229 CTGTCTCTGGAGAACTATCTGGG + Intergenic
1064418509 10:15169946-15169968 CTTTTTTTGCAGAAGATACTAGG + Intergenic
1064620305 10:17208868-17208890 CTGTCTTTGCAGGAGTGATTGGG - Intergenic
1065053700 10:21821078-21821100 CTGTCTGTTCAGAATCTTCTTGG + Intronic
1065449867 10:25845734-25845756 CTGTTTTTTCAGATTTTTCTGGG - Intergenic
1066463461 10:35633013-35633035 CTGTCATTGCAGAGATTTCTGGG + Intergenic
1067103769 10:43351444-43351466 CGGGCATTGCAGAAGTTGCTGGG - Intergenic
1067568612 10:47355546-47355568 CTGTCATTCTAGAAGCTTCTGGG + Intronic
1067825981 10:49573194-49573216 GTGCCTTTACAGAATTTTCTGGG + Intergenic
1068267674 10:54674140-54674162 CTTTCTTTGCAGGATTTTTTAGG + Intronic
1068418402 10:56757022-56757044 CTGTGTTGGCTGTAGTTTCTGGG - Intergenic
1069412247 10:68165729-68165751 AGGTGTTTGCAGAAGATTCTGGG + Exonic
1070631019 10:78084761-78084783 CTGACCTTGCAGAACTTCCTTGG + Intergenic
1071179559 10:82967027-82967049 CTTTCTTTGCAGAATTTCATTGG + Intronic
1071208016 10:83306185-83306207 TTTTCTTTCCAGAAATTTCTAGG + Intergenic
1071478663 10:86046193-86046215 CGGTTTATGCAGAAATTTCTAGG - Intronic
1071596838 10:86934063-86934085 GTGTCACTCCAGAAGTTTCTGGG - Intergenic
1072496549 10:95966865-95966887 CTGTTTTTGCATAATGTTCTAGG - Intronic
1073790534 10:106935856-106935878 TTGTCTTTGCAAAAGTTTGAGGG + Intronic
1075285470 10:121181763-121181785 CTTTCTTTTCAGAGTTTTCTTGG + Intergenic
1075338119 10:121623460-121623482 ATGTCTTTGCTTAAGTTTCCTGG - Intergenic
1075956940 10:126532415-126532437 CTGTCTTCTCTGAGGTTTCTGGG - Intronic
1076747035 10:132519699-132519721 CTCTCTTTCCAGAAGGTTCCCGG - Intergenic
1076945548 10:133646783-133646805 CTGTCATTGCAGGATTCTCTCGG - Intergenic
1078554668 11:12312785-12312807 CTGTCTCTTCAGATCTTTCTTGG + Intronic
1079634017 11:22712692-22712714 CTGGCATTTCAGAAATTTCTTGG - Intronic
1079676426 11:23232560-23232582 CTGTCTGTTCAGATTTTTCTTGG + Intergenic
1079726324 11:23884465-23884487 CTGTATTTGGGAAAGTTTCTTGG + Intergenic
1080326950 11:31086091-31086113 TTTTCTTTGCATAAATTTCTAGG + Intronic
1081280206 11:41200552-41200574 CTGTTTTTGCAGAAGTAGGTAGG - Intronic
1081372023 11:42315883-42315905 CTGTCTCTGTATAAATTTCTGGG + Intergenic
1082827825 11:57593645-57593667 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1082929411 11:58584396-58584418 CTGTTTTGGCAGAAGTATTTTGG + Intronic
1083067108 11:59936177-59936199 ATGTCTTTTCAGAAGAGTCTTGG - Intergenic
1083444627 11:62699538-62699560 ATGTCTTTATAGAAGATTCTAGG + Intronic
1083699086 11:64462718-64462740 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1085318818 11:75562171-75562193 CCAACTTTCCAGAAGTTTCTCGG + Intronic
1085528816 11:77179723-77179745 CTGTCCTTGCAGATGCGTCTGGG + Exonic
1086534092 11:87822420-87822442 ATGTCTTTGCAGATGGTTCTTGG + Intergenic
1086837888 11:91648261-91648283 CTGTTTATGCAGAAATTTCTAGG - Intergenic
1088005911 11:104940053-104940075 CTGTCTTTGCAGCCCTTTGTCGG - Intergenic
1088437102 11:109826364-109826386 CTCTCTTTGCAAAAGTTACAAGG - Intergenic
1088751489 11:112845780-112845802 GTGTCTCTGCAGGTGTTTCTGGG + Intergenic
1091015579 11:132048292-132048314 CTCTCTTTGCAGGAGGCTCTTGG - Intronic
1091718626 12:2796250-2796272 CTGTCTTTGCACCAGATTATTGG + Intronic
1091938765 12:4455136-4455158 CTGTCTGTTCAGATTTTTCTTGG - Intergenic
1092507668 12:9120739-9120761 TTGTCTTTGACGAAGTATCTTGG + Intergenic
1093071691 12:14712114-14712136 CTGTATTTCTAGAAGTTGCTGGG - Intergenic
1093393600 12:18653054-18653076 TAGTTTTTGCAGAAGTTTCGAGG - Intergenic
1094819682 12:34214820-34214842 TTGTCTTTCCAGGAGTTTCACGG - Intergenic
1095095046 12:38142695-38142717 TTGTCTTTCCAGGAGTTTCACGG + Intergenic
1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG + Intronic
1095327963 12:40920847-40920869 CTGTCTTTGAAGAAGTTCACTGG - Intronic
1095791317 12:46170461-46170483 CTGTCTTTGGAAAAGATTCCTGG + Intergenic
1096673064 12:53211528-53211550 TTGTTTTTGCCAAAGTTTCTAGG - Exonic
1098989683 12:77051106-77051128 CTGCCTTTTCATAAGATTCTAGG + Intronic
1099307139 12:80971516-80971538 CAGTTTATGCAGAAATTTCTAGG + Intronic
1099612278 12:84889075-84889097 CTGTCTGTTCAGATTTTTCTTGG - Intronic
1099664001 12:85602619-85602641 TTGTCTTTGCATATATTTCTAGG - Intergenic
1100038256 12:90279995-90280017 CTGACTTTGCTGATTTTTCTGGG - Intergenic
1100249254 12:92799484-92799506 CTGTCTTTCAAGAATATTCTCGG + Intronic
1101478708 12:105076106-105076128 CTGTATTGGCAGAAGTAACTGGG + Intronic
1101773691 12:107775085-107775107 CTGTCTTTGCAGAAGTTTCTGGG - Exonic
1105306401 13:19172015-19172037 GTGTCCTTGCAGATCTTTCTTGG + Intergenic
1105404283 13:20120489-20120511 CTCTTTTTACAGAATTTTCTGGG + Intergenic
1107307108 13:39034427-39034449 CTTTCTTTGTAGAAGTTGGTAGG - Intronic
1108256169 13:48613090-48613112 CTGTCTGTGCAGATTCTTCTTGG + Intergenic
1109419010 13:62085391-62085413 CGGTTTATGCAGAAATTTCTAGG - Intergenic
1109427257 13:62181307-62181329 CTCTCTTTTCTGTAGTTTCTAGG - Intergenic
1109978510 13:69873238-69873260 ATGTGTTTGCAGATGTTACTAGG - Intronic
1110276717 13:73649171-73649193 ATGTCTTGGAAGAAGTTGCTTGG + Intergenic
1110644983 13:77872194-77872216 CTGTCTTTACATAGTTTTCTTGG + Intergenic
1112582345 13:100687462-100687484 AAGTCTCTGCAGAATTTTCTGGG + Intergenic
1112665363 13:101565769-101565791 CTCTCTTCACAGAAGATTCTAGG - Intronic
1113171779 13:107512681-107512703 CAGTTTTTGCCGAAATTTCTAGG + Intronic
1113592152 13:111508544-111508566 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1113643361 13:111974032-111974054 CAGTGTTTGCAGGAGTTTTTCGG + Intergenic
1115791590 14:36885031-36885053 CTGTCTGGGCAGAGATTTCTGGG - Intronic
1116942649 14:50805771-50805793 CTTTCATTGCACAAGTCTCTGGG + Intronic
1117898904 14:60513578-60513600 CAGTGTTTGGAGAAGTTTGTTGG + Intronic
1117916078 14:60679563-60679585 CTGTCAGTGGAGAGGTTTCTTGG + Intergenic
1118349401 14:64962932-64962954 CTGGCATTTGAGAAGTTTCTTGG - Intronic
1118798971 14:69171852-69171874 CGGTTTATGCAGAAATTTCTAGG - Intergenic
1118860825 14:69661605-69661627 CTTTCTTTGGAGTAGCTTCTAGG + Intronic
1118956735 14:70489540-70489562 CTGTGTTTACACAAGGTTCTGGG - Intergenic
1119068595 14:71556849-71556871 CTGTCTATTCAGACTTTTCTTGG + Intronic
1119452406 14:74723162-74723184 CTGTCATTGCAAAAGTGTCCTGG + Intronic
1119864623 14:77962974-77962996 CTGTCTATCTAGATGTTTCTTGG - Intergenic
1120362408 14:83521964-83521986 CTGGCTGTACAGAATTTTCTAGG + Intergenic
1121064200 14:90946090-90946112 CTTTCTTTGCAGCATATTCTTGG + Intronic
1121552785 14:94814907-94814929 TTGTCTTTGCAAATGTTGCTGGG + Intergenic
1121604840 14:95233084-95233106 CTGTCTTTAAACAAGTTTATGGG + Intronic
1121827246 14:97020554-97020576 TTTTCTTTCCAGAAGTTTCCTGG + Intergenic
1121843108 14:97150979-97151001 CTGTTTTTGTAGAATGTTCTGGG + Intergenic
1122002553 14:98672508-98672530 AGGTCTGTGCAGAAGTCTCTTGG + Intergenic
1124802690 15:32849570-32849592 CGCTCTTTGCAGGAATTTCTGGG + Intronic
1125334116 15:38611020-38611042 CTATTTTTGCAGCAGTCTCTTGG + Intergenic
1125996923 15:44170663-44170685 CTTTCTTTGCAAAAGTCCCTGGG - Intronic
1126118548 15:45230788-45230810 CTCTATTTGCTGAACTTTCTGGG + Intergenic
1126492116 15:49248752-49248774 TTGTCTTTGCAGACGTTGTTTGG + Intronic
1129571713 15:76693150-76693172 ATGTCTTGGCAGAAGTTTTTTGG - Intronic
1130092437 15:80832066-80832088 ATGTGTTTGTAGAAGCTTCTAGG + Intronic
1130370561 15:83283305-83283327 CTGGCTTTGCCGGAGTTCCTCGG - Intronic
1130812542 15:87394977-87394999 CTGTATTGGTATAAGTTTCTGGG - Intergenic
1130864879 15:87924362-87924384 CTGTCTTTCTAGGAGTTTCTGGG + Intronic
1132064903 15:98722785-98722807 CTGCCTTTGCAGAGGTCTGTGGG + Intronic
1132371821 15:101304963-101304985 CTGGCTTTGGAGCAGCTTCTGGG - Exonic
1132642581 16:984546-984568 CTGACTTTGCTGGAATTTCTGGG + Intronic
1133065264 16:3201868-3201890 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1134437813 16:14277677-14277699 CTGTCTTTGTAGCTGTTTGTTGG - Intergenic
1135334814 16:21592440-21592462 CTGTTTATGCAGAAATTTCTAGG - Intergenic
1135793375 16:25419241-25419263 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1137405766 16:48188062-48188084 CAGTTTATACAGAAGTTTCTAGG - Intronic
1137886806 16:52113391-52113413 GTTTCTTTCCAGAAGTTACTGGG - Intergenic
1137891434 16:52166742-52166764 ATGTCTTTGCTGAAGTTAATGGG - Intergenic
1139042529 16:63015258-63015280 CTTTTTTTTCAGATGTTTCTTGG + Intergenic
1139080393 16:63511482-63511504 CTGCATTTGCAGAGGGTTCTAGG + Intergenic
1140494902 16:75376880-75376902 CAGTTTATGCAGAAATTTCTAGG - Intronic
1140757343 16:78079649-78079671 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1141847320 16:86619633-86619655 CGGTTTATGCAGAAATTTCTAGG - Intergenic
1142162610 16:88566426-88566448 CAGTTTATGCAGAAATTTCTGGG - Intergenic
1143770399 17:9164878-9164900 CTGGCATTGCAGATGTTTCTCGG - Intronic
1147224157 17:38963164-38963186 CTGTATTTGCAAAAGATTTTTGG + Intronic
1149270745 17:54974886-54974908 CAGTTTATGCAGAAATTTCTAGG + Intronic
1150377815 17:64696527-64696549 TTCTCTTTGCAGAAGCCTCTTGG - Intergenic
1150486055 17:65544546-65544568 CTGTTTTGGAAGAAGATTCTTGG - Intronic
1150996893 17:70329123-70329145 CTCTCTTGGCACAAGTCTCTTGG - Intergenic
1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG + Intronic
1153671633 18:7417831-7417853 CTGTTCATGCAGGAGTTTCTCGG + Intergenic
1154042094 18:10865952-10865974 CTGTCTTTGCAGCATTTGATAGG - Intronic
1154485803 18:14870772-14870794 CTGCCTTAGCAGAAGATACTGGG - Intergenic
1154531309 18:15348454-15348476 CTGTCTCAGTGGAAGTTTCTTGG - Intergenic
1155110590 18:22710384-22710406 CTGTCTTTTCAGATGTGTCAGGG + Intergenic
1155142103 18:23053007-23053029 GTGACTTTGCAAAAGTTACTTGG + Intergenic
1155518993 18:26650598-26650620 CTGTCTGTGCTGTATTTTCTTGG - Intronic
1155765703 18:29629734-29629756 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1156722290 18:40084851-40084873 CTGTCTGTTCAGACCTTTCTTGG + Intergenic
1158573485 18:58616444-58616466 CTGTCTGTTCAGACTTTTCTTGG - Intronic
1161124770 19:2549664-2549686 GTGTCTCTCCAGAAGGTTCTGGG - Intronic
1161152118 19:2714938-2714960 CTGTCCTGGCAGTAGCTTCTGGG - Exonic
1162024085 19:7883995-7884017 CTGTCTTCTGAGAGGTTTCTTGG - Intergenic
1162116734 19:8434645-8434667 CTGTCCATGCAAATGTTTCTTGG + Intronic
1162473884 19:10888347-10888369 CTGTCTTTGGACCAGCTTCTGGG + Intronic
1163745163 19:19042517-19042539 CTGTATTTGCAGAAGTTCTAGGG + Intronic
1164296864 19:23918363-23918385 CAGTTTTTTCAGAACTTTCTGGG - Intronic
1164300024 19:23953892-23953914 CTGTCTTTACAGATGGTTCAAGG - Intergenic
1164897519 19:31890241-31890263 CTGTTTATGTAGAAATTTCTAGG + Intergenic
1164902883 19:31942998-31943020 CTGGGTTAGCAGAATTTTCTGGG + Intergenic
1164965401 19:32478878-32478900 CTGTCTGTACAGCAGATTCTTGG + Intronic
1165087933 19:33364303-33364325 TTTCCTTTGCAGAGGTTTCTGGG - Intergenic
1165406495 19:35634074-35634096 CTGTCTGTGTGGAAGTTCCTGGG - Intronic
1165763806 19:38337581-38337603 CTCTCTTTGCAGAAATACCTGGG + Exonic
1165962481 19:39546916-39546938 CGGTTTATGCAGAAATTTCTAGG - Intergenic
1166516147 19:43448473-43448495 CGGTTTATGCAGAAATTTCTAGG - Intergenic
925027106 2:618721-618743 TGGTTTTTGCAGAAATTTCTAGG - Intergenic
925769627 2:7269336-7269358 CTGTATTTGCAGAAGCTACTAGG - Intergenic
926049927 2:9738009-9738031 CTGTGTGTTCACAAGTTTCTGGG - Intergenic
926585241 2:14678785-14678807 CTGTCTTTGGAGAAGATTCTTGG - Intergenic
926830555 2:16957656-16957678 CTTTTTTTCCAGAAGATTCTCGG + Intergenic
926897717 2:17712754-17712776 CTGTGTTTGAAGAAATTTTTCGG - Intronic
927800350 2:26093218-26093240 ACCTCTTTGCAGAAGTTTATGGG + Intronic
928812940 2:35251090-35251112 TTGTCTTTACATAAGATTCTTGG + Intergenic
928908396 2:36392974-36392996 CTTTCTCAGCAGAAGTTTCCTGG - Intronic
928924261 2:36561467-36561489 AAGTCTTTGGAGAAGTTTTTGGG - Intronic
929617110 2:43319976-43319998 CTGACTTTCCACATGTTTCTTGG - Intronic
930845233 2:55896293-55896315 CAGCCTTTGCAGAAGTTGCAAGG - Intronic
931231042 2:60375131-60375153 CTGTCTTTCCAGATCTTTCATGG - Intergenic
932452979 2:71827579-71827601 CAGTCTTTGCTGGGGTTTCTGGG + Intergenic
935480330 2:103580169-103580191 CAGTTTATGCAGAAATTTCTAGG - Intergenic
938725646 2:134106744-134106766 TTTTCTTTGCAGAAGTCTGTTGG + Intergenic
939162909 2:138610386-138610408 CTGTCTGTTCAGATTTTTCTTGG - Intergenic
939375321 2:141357983-141358005 GTGTCTTTGAAGAAGGTTCCTGG - Intronic
939448187 2:142336428-142336450 CAGTTTGTGCAGAATTTTCTCGG + Intergenic
940073629 2:149717146-149717168 CTGTGTTTTCAGAGATTTCTTGG - Intergenic
940576805 2:155518251-155518273 CTGTCTGTGCAGAAGTTAAATGG - Intergenic
941592090 2:167432419-167432441 CTGTCTTTGCAGAAACCTCTGGG - Intergenic
941714559 2:168749970-168749992 CAGTTTATGCAGAAATTTCTAGG + Intronic
942643565 2:178086859-178086881 TTGACTTTGGAGAAGTTTCTGGG + Intronic
943387236 2:187217105-187217127 CTGTCTATTCAGATTTTTCTTGG - Intergenic
943471962 2:188305422-188305444 CTGTCTGTTCAGACTTTTCTTGG + Intronic
944598063 2:201280432-201280454 TTCTCTTTCCAGAAGCTTCTAGG - Intronic
944958597 2:204841834-204841856 ATTTTTTTGCAGAAGTTTTTTGG + Intronic
944989736 2:205221812-205221834 CTGTCTTGGTAAAAGTTTCCAGG + Intronic
947738978 2:232476334-232476356 CAGCCTTTGCTGAAGTTTCGGGG - Intergenic
948319501 2:237058268-237058290 GTGGCTTTGCAGAACTTTCCTGG + Intergenic
948646585 2:239408849-239408871 ATGTCTTTCCACAAGTCTCTGGG - Intergenic
1168774391 20:435798-435820 CTGTCTGTCCAGATGCTTCTTGG + Exonic
1169310762 20:4537777-4537799 CTTGCTATGCAGAAGTTTTTGGG - Intergenic
1170772007 20:19341074-19341096 CTGTATTTTCAGAACTCTCTGGG - Intronic
1170781708 20:19431219-19431241 CTGTCTTGGCATCTGTTTCTCGG - Intronic
1171356459 20:24549570-24549592 CTGGCCTTGCAGTAGTGTCTAGG + Intronic
1171389889 20:24794623-24794645 CTCTCTGTGCAGAGGCTTCTGGG - Intergenic
1171783535 20:29442877-29442899 CTGTCGTTGCAGGATTCTCTCGG - Intergenic
1172329872 20:34068074-34068096 CTGACATTGCAGAAGTCTCTAGG + Intronic
1173186590 20:40844895-40844917 CCTTCTCTGCAGAAGTTTCTGGG - Intergenic
1174047963 20:47747396-47747418 CTCTGGTTGCAGAAGTTCCTGGG + Intronic
1174118171 20:48242245-48242267 CTGTAGTTGTAGAAGCTTCTGGG + Intergenic
1175056730 20:56205525-56205547 CTGTCTGTGCAGATTCTTCTTGG - Intergenic
1175181244 20:57149120-57149142 CTGCCTTCCCAGAAGTTGCTGGG + Intergenic
1175295805 20:57907970-57907992 CTGTCTTTGCCCATGTTTCTTGG + Intergenic
1175440551 20:58988128-58988150 CTGTCTTGGCAGCTGCTTCTTGG - Intronic
1175675431 20:60942692-60942714 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1176323474 21:5359492-5359514 CTCTCTTTGCAGAATCTTCAGGG + Intergenic
1176481234 21:7293494-7293516 CTCTCTTTGCAGAATCTTCAGGG + Intergenic
1176795525 21:13368697-13368719 CTGCCTTAGCAGAAGATACTGGG + Intergenic
1176870916 21:14082804-14082826 TTGTCTTTCCAGGAGTTTCATGG - Intergenic
1177194532 21:17889239-17889261 GTGTCTTTGCAGGTGTTTCTGGG + Intergenic
1177240254 21:18446418-18446440 ATTTCTTTGAAGAACTTTCTTGG - Intronic
1177245053 21:18512424-18512446 CTGTCTCTGAAGAAGTTGCAAGG - Intergenic
1180199825 21:46217640-46217662 TTGTCTTTGCTGGAGTTGCTTGG - Intronic
1181712667 22:24700429-24700451 CTGTCTTTTCAGAAGTCTAGGGG - Intergenic
1182111094 22:27724302-27724324 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1182889703 22:33807042-33807064 CTGTCTTTGTGGAAGTTGCATGG - Intronic
1182982807 22:34687323-34687345 ATGTCTTTGCTGAACTTTCCAGG - Intergenic
1183742490 22:39676622-39676644 CTGGGTTTGCAGAGGCTTCTGGG + Intronic
1183784700 22:40022662-40022684 CTCTCTCTGCAGCAGTCTCTGGG + Intronic
1183935793 22:41261446-41261468 CTGCCTTGGCAGAAGCTTTTAGG - Exonic
1184632477 22:45794020-45794042 CAGTTTATGCAGAAATTTCTAGG + Intronic
1184964066 22:47954238-47954260 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1185182962 22:49373509-49373531 CTGGCTTTGGAGCAGTTTCCTGG - Intergenic
1185403383 22:50630478-50630500 TGGTTTATGCAGAAGTTTCTAGG + Intergenic
949564220 3:5230190-5230212 CTCTCTTTTCAGTAGTGTCTAGG - Intergenic
949737232 3:7187691-7187713 CAGTTTATGCAGAAATTTCTAGG + Intronic
950494360 3:13324726-13324748 CTGTGTTTGCAGAGGTTACCTGG - Intronic
950768656 3:15293079-15293101 CAGTCTTGGCTGAAGATTCTGGG - Intronic
951136346 3:19107839-19107861 CTGGCTCTGCAGCAGTTACTTGG + Intergenic
952738625 3:36714395-36714417 TGGTCTTTGCAGATGATTCTGGG - Exonic
953010872 3:39024305-39024327 CTGTCTGTTCAGAATCTTCTTGG + Intergenic
956272445 3:67462353-67462375 CTGTCTATACAGATGCTTCTTGG - Intronic
956483493 3:69696683-69696705 CAGTTTATGCAGAAATTTCTAGG - Intergenic
956551732 3:70468260-70468282 CTATCTTTTGACAAGTTTCTAGG - Intergenic
956930562 3:74038454-74038476 CTGTCTTAGGAGAATTTTCCTGG - Intergenic
957081935 3:75643685-75643707 CTGTCATTGCAGGATTCTCTCGG + Intergenic
957504085 3:81097150-81097172 CTGTCTTTGCATATGTTCATGGG + Intergenic
957884875 3:86273962-86273984 CTGATTATGCAGAAATTTCTAGG - Intergenic
958627025 3:96639535-96639557 TTGTCTTTGCTTCAGTTTCTTGG - Intergenic
958815186 3:98906237-98906259 CTGTCTGTGCAGAAACATCTGGG + Intergenic
958851124 3:99326776-99326798 GTGTCTTTGAAGGTGTTTCTGGG + Intergenic
960408461 3:117291714-117291736 CTGTCTTTGCAGAGATCTCTTGG + Intergenic
960923963 3:122778955-122778977 TTGTCTTTTCAGAAGTCTCATGG + Intronic
961941518 3:130642435-130642457 CTTTCATAGCAGAAGTTTCAAGG - Intronic
962525922 3:136237392-136237414 CTGTCTTGGCATCAGCTTCTTGG + Intergenic
963192110 3:142484244-142484266 CTGTCTGTTCAGACTTTTCTTGG - Intronic
963447403 3:145430596-145430618 ATTTCTTTGAAGAGGTTTCTAGG + Intergenic
964349905 3:155791964-155791986 CTGTGTTTGCTGAAGATCCTAGG - Intronic
967829824 3:193909382-193909404 CTGTCTTTGCAGGGGTTCCTGGG + Intergenic
967998976 3:195188425-195188447 CAGTTTATGCAGAAATTTCTAGG - Intronic
968476438 4:811849-811871 CTGTCTTTGCTGACGTATGTTGG + Intronic
970809575 4:20076352-20076374 CTGCCTCTGCAGCACTTTCTGGG - Intergenic
970894992 4:21092058-21092080 TAGACATTGCAGAAGTTTCTGGG - Intronic
972076709 4:35099224-35099246 CTGTCTTTTCTTAAGTGTCTAGG + Intergenic
972227814 4:37034013-37034035 CTGTCTGTTCAGATGCTTCTTGG - Intergenic
972413013 4:38811589-38811611 CAGTTTATGCAGAAATTTCTAGG - Intronic
975001426 4:69227237-69227259 TTATCTTTGCATTAGTTTCTTGG + Intergenic
975004015 4:69264847-69264869 TTGTCTCTGCATTAGTTTCTTGG - Intergenic
975012376 4:69373438-69373460 TTATCTTTGCATTAGTTTCTTGG - Intronic
975734615 4:77369203-77369225 CTTGCTTTGCAGAAGCTACTTGG + Intronic
975872414 4:78794991-78795013 CTGTGTATGCAGTAGATTCTTGG + Intronic
975997635 4:80335191-80335213 ATGTCTTTGCAGACCTTTTTTGG - Intronic
976266510 4:83190506-83190528 CTGTCTGTTCAGATTTTTCTTGG + Intergenic
976383524 4:84428245-84428267 CTGTCTTTTAAGAAGTCTTTAGG - Intergenic
976711981 4:88082231-88082253 CTGACTTTTCATAAGTTTCTCGG + Intergenic
977147740 4:93466530-93466552 CAGTTTATGCAGAAATTTCTAGG + Intronic
978701445 4:111651374-111651396 TTGTGTTTGCAGAACTATCTGGG - Intergenic
978733209 4:112055619-112055641 CTGTGTTTTCAGAAGCTGCTAGG - Intergenic
979350978 4:119644253-119644275 CTGTCTGTTCAGATTTTTCTTGG - Intergenic
980864305 4:138536460-138536482 CTGTCTTTACAGATTCTTCTTGG + Intergenic
981089818 4:140721017-140721039 CAGTCTTTGAAGAAGGTTCCCGG + Intronic
983444527 4:167833100-167833122 CTGTCTTTGCTGATGCTTCTGGG - Intergenic
983691454 4:170474002-170474024 CTGTCTGTTCAGATTTTTCTTGG + Intergenic
984548475 4:181133573-181133595 CTGTTTTTCCAGAAGTTTACAGG - Intergenic
984551976 4:181171359-181171381 CTGTCTTTGAGGAAGGTCCTTGG + Intergenic
985448935 4:190047295-190047317 CTGTCATTGCAGGATTCTCTCGG - Intergenic
985690907 5:1311757-1311779 CGGTTTATGCAGAAATTTCTAGG + Intergenic
987155298 5:15083124-15083146 GTGTCATTGCGGAGGTTTCTTGG + Intergenic
987819764 5:22947747-22947769 TGGTGTTTGCAGAAATTTCTAGG - Intergenic
988736727 5:34029684-34029706 CTTTCTTGGTAGAAGTTTCATGG + Intronic
990128573 5:52550442-52550464 CTGTTATTCCAGATGTTTCTCGG - Intergenic
991496586 5:67232798-67232820 CTGTCTTTGCAAAAGTATGATGG + Intergenic
994504117 5:100618335-100618357 CTGTCTTAGAATCAGTTTCTGGG - Intergenic
995156014 5:108914295-108914317 CTATCTTTTCAGAATTATCTGGG + Intronic
995435452 5:112129868-112129890 ATGTCCTGACAGAAGTTTCTGGG - Intergenic
995468963 5:112480075-112480097 CTGTCTTTGAGGAGTTTTCTAGG - Intergenic
995623418 5:114052801-114052823 GTATCTTTGGAGAGGTTTCTTGG + Intergenic
995823091 5:116260336-116260358 ATGACTTTGGAGAAATTTCTTGG + Intronic
996432166 5:123393462-123393484 CTGTCTTTCTGGAAGTTTCATGG + Exonic
997243483 5:132325971-132325993 CAGTTTATGCAGAAATTTCTAGG - Intronic
997982677 5:138478881-138478903 CTTTCTCTTCAGAAGTATCTTGG + Intergenic
998605748 5:143632887-143632909 CTGTCTGTTCAGACTTTTCTTGG + Intergenic
998805777 5:145916591-145916613 CTGTCTCTGAAGTATTTTCTAGG - Intergenic
1001979982 5:176031359-176031381 CTGCCTTGGCAGAAGGTACTGGG + Intronic
1002014316 5:176307034-176307056 GTATCTTTTCAGAAGTTTGTTGG - Intronic
1002237400 5:177812304-177812326 CTGCCTTGGCAGAAGGTACTGGG - Intergenic
1002724595 5:181286271-181286293 CTGCCTTAGCAGAAGATACTGGG - Intergenic
1004061264 6:12200278-12200300 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1004278262 6:14257120-14257142 CTGTCTGTTCAGACTTTTCTTGG + Intergenic
1004319325 6:14620506-14620528 CTTTCTATGCTGCAGTTTCTTGG + Intergenic
1004376012 6:15091397-15091419 CTGTTTTTTGAGCAGTTTCTGGG + Intergenic
1004840403 6:19577477-19577499 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1005111401 6:22285807-22285829 CTGGTTTTGCAGCAGCTTCTGGG - Intergenic
1005616569 6:27578751-27578773 CTGACTTTGCATAAGTTGCCAGG + Intergenic
1008077440 6:47159825-47159847 AAGTCTTTGCAGAAGTTTGTGGG - Intergenic
1008292973 6:49740498-49740520 CTATCTTTTCAGTATTTTCTTGG - Intronic
1010037543 6:71343855-71343877 CTGTCTTGGCATCAGCTTCTTGG - Intergenic
1010811389 6:80303695-80303717 CTCTCTTTACAGAAGTTTAAAGG - Intronic
1010908459 6:81522671-81522693 CGGTCTTTGCAGTCATTTCTTGG + Intronic
1012088520 6:94860242-94860264 CTGTATGTGCTGTAGTTTCTGGG - Intergenic
1012199857 6:96392413-96392435 CTGTTTTTACATAAGTATCTGGG + Intergenic
1014048459 6:116922922-116922944 CTGTCTTTGCTGATGTTTTAAGG - Intronic
1014592991 6:123295225-123295247 CAGTCTATGCAGACATTTCTAGG - Intronic
1016052946 6:139549315-139549337 CTGTCTCTTCAGGAATTTCTAGG + Intergenic
1016392290 6:143586667-143586689 CGGTTTATGCAGAAATTTCTAGG + Intronic
1016717220 6:147248594-147248616 CAGTCATTTCGGAAGTTTCTTGG + Intronic
1016849661 6:148604663-148604685 CTCTCTTTGCTGAATTATCTTGG + Intergenic
1017736485 6:157369491-157369513 TGGTCTATGCAGAAATTTCTAGG - Intergenic
1018158523 6:161013795-161013817 CAGTTTATGCAGAAATTTCTAGG + Intronic
1018735451 6:166684314-166684336 CAGTTTATGCAGAAATTTCTAGG - Intronic
1019002341 6:168764664-168764686 CTGTATTTGAAGAAGCTTGTAGG - Intergenic
1020178358 7:5901022-5901044 AGGCTTTTGCAGAAGTTTCTCGG + Intronic
1020232860 7:6333311-6333333 CTGTCCTTGCTGAAGCTTCTCGG - Intronic
1020304567 7:6823977-6823999 AGGCTTTTGCAGAAGTTTCTCGG - Intronic
1021175454 7:17444770-17444792 ATGTTTTTGCTGAAGTGTCTAGG + Intergenic
1023116805 7:36870579-36870601 TTCTTTTTGCAGTAGTTTCTGGG - Intronic
1023924868 7:44660557-44660579 CTGTCTTGGCATATGTTTCATGG + Intronic
1026116275 7:67498300-67498322 CTGTCCTTGTAGCATTTTCTGGG - Intergenic
1026407460 7:70081753-70081775 ATGTATTTGCAGAAGTTTATAGG + Intronic
1026527899 7:71171638-71171660 CTTTATTTACAGAAGATTCTGGG + Intronic
1026537837 7:71254889-71254911 CTGTCTGAGGAGAAGATTCTGGG + Intronic
1028106296 7:86882883-86882905 TTGGCTTTGGAGAAGATTCTTGG - Intronic
1028344765 7:89765738-89765760 CTGTCTTGGCAATAATTTCTTGG - Intergenic
1028621239 7:92832096-92832118 CCCAATTTGCAGAAGTTTCTAGG + Intronic
1029197767 7:98818350-98818372 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1029903471 7:104067107-104067129 GTGTCTGTGCAGACTTTTCTAGG + Intergenic
1030345408 7:108427805-108427827 CTGTATTTGGTGGAGTTTCTTGG - Intronic
1030381418 7:108815726-108815748 CTGTCTTTTCAGGAGACTCTCGG + Intergenic
1031594277 7:123630217-123630239 CTGTATTTCCAGAATTATCTGGG + Intronic
1032025731 7:128440748-128440770 CTGTTTTTGTAGAATCTTCTAGG + Intergenic
1032436467 7:131905025-131905047 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1032878273 7:136061421-136061443 ATGTCTTTGATGAACTTTCTTGG + Intergenic
1033506686 7:142010053-142010075 CTTTCTCTGCAGATGATTCTTGG + Intronic
1034640570 7:152598717-152598739 CTGTCTTTCAAGATGTTTCTTGG + Intergenic
1035250976 7:157596670-157596692 CGGTCTCTGCAGATGCTTCTGGG - Intronic
1036100621 8:5779598-5779620 TTGTTTATGCAGAAATTTCTAGG + Intergenic
1036474991 8:9085018-9085040 CTGAATTTATAGAAGTTTCTAGG - Intronic
1036739110 8:11345997-11346019 CGGTTTATGCAGAAATTTCTAGG + Intergenic
1038126213 8:24675625-24675647 CTGTGTTTGAAGTAGTTTCTGGG - Intergenic
1038625612 8:29190238-29190260 CTGTCTGTTCAGACTTTTCTTGG - Intronic
1038681777 8:29675199-29675221 CTGTGTTTGAAGAAATTTCCTGG - Intergenic
1038905365 8:31896282-31896304 CTTTCTGTGCAGAAATTTCAAGG + Intronic
1039327357 8:36500236-36500258 CTGTCTTATCAGAGGTTTGTGGG - Intergenic
1039509412 8:38078966-38078988 CAGTCTCTGCTGAAGCTTCTGGG - Intergenic
1039749516 8:40464138-40464160 CTGTCTTGGCATCTGTTTCTCGG + Intergenic
1040939587 8:52818575-52818597 TGGTCTATGCAGAAATTTCTAGG - Intergenic
1041631726 8:60096316-60096338 TTATCTTTTGAGAAGTTTCTGGG - Intergenic
1042262449 8:66873037-66873059 CTGCCTTTCAAGAAGTTGCTAGG - Intronic
1043594987 8:81874736-81874758 CTGTGTTTTCAGAAGTTGTTTGG + Intergenic
1044741441 8:95331252-95331274 CTGTATTTTTAAAAGTTTCTTGG - Intergenic
1045231525 8:100310665-100310687 CTGTCTTTGCAGAGGCTGTTAGG + Intronic
1046306508 8:112373823-112373845 CTGTATTCGCTGGAGTTTCTGGG + Intronic
1047280695 8:123442974-123442996 CAGTTTATGCAGAAATTTCTAGG - Intronic
1049186496 8:141257391-141257413 CAGTCTTTGCAGACATGTCTGGG - Intronic
1050716633 9:8535365-8535387 TTGGCTTTGCAGAGGTTACTTGG - Intronic
1050993068 9:12176066-12176088 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1051071703 9:13176331-13176353 CTGTCTTTGCAGGAGATTCTGGG + Exonic
1051800485 9:20927663-20927685 GTGTCTTTGTAGAAGTATTTTGG + Intronic
1051887232 9:21905852-21905874 CTCCCTTTGCAGTATTTTCTAGG - Intronic
1053728892 9:41032408-41032430 ATGAATTTGCAGAAGTTCCTTGG - Intergenic
1053886732 9:42649647-42649669 CTGCCTTAGCAGAAGATACTGGG - Intergenic
1054225751 9:62457097-62457119 CTGCCTTAGCAGAAGATACTGGG - Intergenic
1054935027 9:70677546-70677568 CTGTCTTATCAGATGCTTCTTGG - Intronic
1057219573 9:93248731-93248753 CTGTATGTGCAGAAGATACTAGG - Intronic
1057878648 9:98776701-98776723 CTGTCTTTAAGGAAGTTTCTTGG - Intronic
1061305727 9:129732004-129732026 CAGTTTATGCAGAAATTTCTAGG - Intergenic
1061333288 9:129911356-129911378 CTGTCTGTGCAGATTCTTCTTGG - Intronic
1061812277 9:133169251-133169273 CTGTCTGTGCAGATTCTTCTTGG + Intergenic
1185476586 X:419223-419245 CGGGGTTTGCAGACGTTTCTCGG - Intergenic
1185505387 X:629761-629783 CTTTATTTGCAGAAGGTCCTTGG + Intronic
1185803462 X:3034573-3034595 CAGTTTATGCAGAAATTTCTAGG + Intergenic
1186006002 X:5072550-5072572 GTGTCTTTACAGAAATATCTTGG + Intergenic
1186160645 X:6773800-6773822 CAGTTTGTGCAGAAATTTCTAGG - Intergenic
1186870209 X:13764169-13764191 CAGTTTTTGCAGAAGAGTCTTGG - Intronic
1187028221 X:15457841-15457863 CTGTTTTTGTAAAAGTTTATTGG + Intronic
1187045129 X:15640273-15640295 CAGTTTATGCAGAAATTTCTAGG - Intronic
1187546361 X:20256462-20256484 CTCTCTTTACAGAAGCCTCTAGG - Intronic
1188257212 X:27977594-27977616 CATTCTTTGCAGAATTTTCTTGG - Intergenic
1188800578 X:34524847-34524869 CTGTCTTTTCAGATTCTTCTTGG - Intergenic
1189679639 X:43502164-43502186 CTGTATTTGCTGAACTTTCTGGG + Intergenic
1189728361 X:43992265-43992287 TTGTCTTTTTAGAATTTTCTTGG - Intergenic
1190824744 X:54007168-54007190 CAGTCTTTTCAAAAGGTTCTGGG + Intronic
1192111437 X:68368853-68368875 TAGTCTTTGCAGAAGTAGCTTGG + Intronic
1194571828 X:95561909-95561931 CAGCCTATGCAGAAATTTCTAGG + Intergenic
1196783765 X:119404672-119404694 CTGTCTGTTCAGACTTTTCTTGG + Intronic
1196802079 X:119552709-119552731 CTGTCTGTTCAGACTTTTCTTGG + Intronic
1198175281 X:134148607-134148629 CGGTTTATGCAGAAATTTCTAGG - Intergenic
1198332173 X:135632019-135632041 CTGTCATTGCAGGATTCTCTTGG - Intergenic
1198339246 X:135698278-135698300 CTGTCATTGCAGGATTCTCTTGG + Intergenic
1200073554 X:153540501-153540523 CTTACTTTCCAGAAGTTTCTCGG - Intronic
1201766163 Y:17575357-17575379 TTGTCTTTCCAGGAGTTTCATGG - Intergenic
1201835389 Y:18330632-18330654 TTGTCTTTCCAGGAGTTTCATGG + Intergenic
1202112927 Y:21443390-21443412 CTGTCTTTTCTATAGTTTCTTGG - Intergenic