ID: 1101774165

View in Genome Browser
Species Human (GRCh38)
Location 12:107778567-107778589
Sequence GTGCAAAGCAGGAGCTGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101774152_1101774165 3 Left 1101774152 12:107778541-107778563 CCATCCCACCCCACCCCACCCCG 0: 1
1: 31
2: 321
3: 1133
4: 12978
Right 1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164
1101774151_1101774165 4 Left 1101774151 12:107778540-107778562 CCCATCCCACCCCACCCCACCCC 0: 8
1: 180
2: 351
3: 1326
4: 5169
Right 1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164
1101774153_1101774165 -1 Left 1101774153 12:107778545-107778567 CCCACCCCACCCCACCCCGAGCG 0: 1
1: 2
2: 21
3: 241
4: 1446
Right 1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164
1101774158_1101774165 -10 Left 1101774158 12:107778554-107778576 CCCCACCCCGAGCGTGCAAAGCA 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164
1101774150_1101774165 5 Left 1101774150 12:107778539-107778561 CCCCATCCCACCCCACCCCACCC 0: 5
1: 166
2: 292
3: 1085
4: 4577
Right 1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164
1101774155_1101774165 -5 Left 1101774155 12:107778549-107778571 CCCCACCCCACCCCGAGCGTGCA 0: 1
1: 0
2: 1
3: 32
4: 327
Right 1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164
1101774154_1101774165 -2 Left 1101774154 12:107778546-107778568 CCACCCCACCCCACCCCGAGCGT 0: 1
1: 1
2: 14
3: 141
4: 1069
Right 1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164
1101774156_1101774165 -6 Left 1101774156 12:107778550-107778572 CCCACCCCACCCCGAGCGTGCAA 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164
1101774157_1101774165 -7 Left 1101774157 12:107778551-107778573 CCACCCCACCCCGAGCGTGCAAA 0: 1
1: 0
2: 2
3: 13
4: 145
Right 1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164
1101774149_1101774165 25 Left 1101774149 12:107778519-107778541 CCTGAGTAATTGCTGCGACACCC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101774165 Original CRISPR GTGCAAAGCAGGAGCTGCGT TGG Intergenic
900390065 1:2429895-2429917 TTGCAAAGCAAGAGGTGCCTGGG - Intronic
902397059 1:16138121-16138143 GTGCCAAGGTGGAGCTGCGCTGG - Exonic
904333545 1:29783052-29783074 GTGCACAGCAGGAGCTTAATAGG + Intergenic
904756593 1:32771635-32771657 CTGCAAAGCAGTAGCTGAGGAGG - Exonic
907126606 1:52056181-52056203 GCGCAAAGCAGGCGGGGCGTTGG + Exonic
907518832 1:55010192-55010214 GTGCAGAGCAGAAGCTGAGGTGG + Exonic
912414209 1:109497211-109497233 GGGCAAAGCATGAGATGCCTGGG - Intronic
912625704 1:111203699-111203721 CTGGAAAGCAGCAGCTGCGCAGG + Intronic
912954906 1:114148485-114148507 GGGGAGAGCAGGAGCTGCCTCGG + Intronic
913645449 1:120850148-120850170 GTGAAAAGCAGGAGCTGCCAGGG + Intergenic
914081280 1:144413390-144413412 GTGAAAAGCAGGAGCTGCCAGGG - Intergenic
914176188 1:145281929-145281951 GTGAAAAGCAGGAGCTGCCAGGG - Intergenic
914517282 1:148384647-148384669 GTGAAAAGCAGGGGCTGGCTAGG + Intergenic
914530915 1:148523415-148523437 GTGAAAAGCAGGAGCTGCCAGGG - Intergenic
919785264 1:201254627-201254649 GAGCAAAGCAGGGGTTGAGTGGG + Intergenic
921536018 1:216350080-216350102 GTGGAAAGCAGGAGCAAAGTGGG + Intronic
922030034 1:221789031-221789053 GTGCAAGGCAGGAGCTGGAGAGG - Intergenic
923986464 1:239387361-239387383 GTCCAAAGAAGGGGCTGGGTAGG + Intronic
1063414379 10:5861545-5861567 GTGCAAAGCAGGAACAGGGGCGG + Intergenic
1064954567 10:20893488-20893510 GTGCAAAGCAGAAACTAGGTGGG + Intronic
1065495332 10:26321685-26321707 GAATAAAGCAGGAGTTGCGTTGG + Intergenic
1067945685 10:50686722-50686744 GGGCAGAGCAGGGGCTGCCTGGG + Intergenic
1069661625 10:70127086-70127108 GTGCACACCAGGAGCTGCGCAGG + Intronic
1070867198 10:79713595-79713617 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1070880990 10:79851719-79851741 GGGCAGAGCAGGGGCTGCCTGGG + Intergenic
1071634113 10:87235819-87235841 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1071647561 10:87368036-87368058 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1072082022 10:92042211-92042233 GTGCAAAGGAGTAACTGCGAGGG - Intergenic
1076294672 10:129375320-129375342 GTGCAGAGCAGGGGCTGACTTGG + Intergenic
1076817121 10:132920525-132920547 GTGCTACGCAGGGGCTGGGTGGG - Intronic
1077308936 11:1880029-1880051 GTGCAAAACAGCACCTGTGTCGG + Intronic
1078106749 11:8362718-8362740 GTGCAGGGCAGGAGCTGCTCAGG - Intergenic
1081208885 11:40307434-40307456 TTGCAAGGCAGAAGCTGGGTGGG - Intronic
1085304342 11:75476697-75476719 GTGAAAAGCAGGAACTGCCAGGG - Intronic
1085347834 11:75779654-75779676 GTGTAAAGCAAGTGCTGCCTGGG + Intronic
1088194345 11:107258583-107258605 GTTCAAAGAAGGAGTTGGGTTGG - Intergenic
1088266513 11:107992724-107992746 CTGCACAGCAGGAGGTGAGTGGG + Intergenic
1088578933 11:111298558-111298580 GTGGTCAGCAGGAGCTGGGTCGG - Intronic
1089016335 11:115168304-115168326 GTGCATAGAGGCAGCTGCGTAGG + Intergenic
1089678118 11:120104171-120104193 AGGCAAAGCAGGGGCTGGGTGGG - Intergenic
1090042342 11:123301937-123301959 GCGGAGAGCAGGAGCGGCGTGGG + Intergenic
1091113461 11:132993066-132993088 GTGGGAAGCAGGAGCTGGGGAGG - Intronic
1094843154 12:34350310-34350332 ATGCAAGGCAGGGGCGGCGTAGG + Intergenic
1095436611 12:42195894-42195916 GTGGAAGGCAGGAGTTGCGGGGG + Intronic
1096769913 12:53928429-53928451 GGGAATGGCAGGAGCTGCGTGGG - Intergenic
1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG + Intergenic
1102184221 12:110935075-110935097 GTTCAAAGCAGAAGCTGGGGCGG + Intergenic
1104373272 12:128243030-128243052 GTGCAAAAAAGGAACTGGGTAGG - Intergenic
1107483137 13:40801893-40801915 GTGCACAGAAGGAGGTGCATGGG - Intronic
1108598048 13:51966698-51966720 GTGCAGAGCAGGGTCTACGTCGG - Intronic
1112840680 13:103573606-103573628 GGGCAAGGCAGGAGCAGCCTGGG + Intergenic
1117262530 14:54050945-54050967 GGGCAAAGAAGGAGCTTTGTGGG - Intergenic
1119648554 14:76366838-76366860 GTGCAGGGCAGGACCTGTGTGGG + Intronic
1119741080 14:77014113-77014135 GTCCAAAGGAGGAGCTGCTGCGG - Intergenic
1120464453 14:84838909-84838931 GTGCAAAGCAGAAAATGCGCTGG + Intergenic
1121006968 14:90496589-90496611 GTGCGCAGCAGGAGCAGGGTGGG - Intergenic
1123051727 14:105547285-105547307 TTGGACTGCAGGAGCTGCGTTGG + Intergenic
1123077141 14:105672988-105673010 TTGGACTGCAGGAGCTGCGTTGG + Intergenic
1124868897 15:33521219-33521241 GTGCAAAGCAGAATCTAAGTTGG + Intronic
1125346554 15:38724409-38724431 GTTCAGAACAGGAGCTGCTTTGG + Intergenic
1126146760 15:45481612-45481634 GTGAAAAGCAGTGGCTGAGTTGG - Exonic
1126321000 15:47423222-47423244 GTGCAAAGCAGGTAGTGCTTGGG - Intronic
1128326121 15:66725348-66725370 CTGCAAAGCAGGAGCTGCTCTGG + Intronic
1128740504 15:70080384-70080406 GTTCAAAGCAGGCGCTTTGTTGG + Intronic
1130616599 15:85415183-85415205 GTGCAGAGCGGGGTCTGCGTCGG - Intronic
1131148687 15:90033397-90033419 GTGGAAAGCAGGAGAAGAGTTGG + Intronic
1131394929 15:92078590-92078612 GGGCAAAGCAGGAACAGCCTGGG - Intronic
1132574444 16:658058-658080 GTGCAGGGCAGGTGCTGCCTGGG + Intronic
1132804019 16:1767437-1767459 GCGCAAAGCAGGCGCTGGCTGGG + Intronic
1135969488 16:27062010-27062032 GTGCAAAGCAGGTGTTGCTGTGG + Intergenic
1137359268 16:47798015-47798037 GTGCAGAGCAGTAGCCACGTGGG + Intergenic
1139675621 16:68521105-68521127 GTACAATGCAGGAGCTGTTTTGG - Intergenic
1140418654 16:74797522-74797544 CTGCACAGCAGGAGGTGAGTGGG - Intergenic
1141291708 16:82723843-82723865 GAGCAAAGCAGGTGCTGCTCTGG + Intronic
1141361903 16:83403224-83403246 TAGCAAAGCAGGAGTTGTGTGGG + Intronic
1141981094 16:87550907-87550929 GTGCACAGCAATGGCTGCGTAGG - Intergenic
1142309659 16:89305109-89305131 GTGCAAAGCCGGAGGTGCGGGGG + Intronic
1142376384 16:89709030-89709052 GTGCACATCAGGAGGTGGGTGGG - Intronic
1142490851 17:278503-278525 GTGCAAAGCAGCAGGTGCAAAGG - Intronic
1146465615 17:33083965-33083987 GTGAGAAGCAGGAGCTGGGGTGG - Intronic
1146632870 17:34483415-34483437 ATGGAAAGCATGAGCTGGGTTGG + Intergenic
1148095056 17:45046783-45046805 GTGTGAAGGAGGAGCTGGGTAGG - Intronic
1150199098 17:63334942-63334964 GAGCAGAGCAGGAGGTGGGTTGG + Intronic
1151441248 17:74130584-74130606 GTGCAGAGCAGGAGCTGGACGGG + Intergenic
1151534221 17:74729643-74729665 CTGCCTGGCAGGAGCTGCGTGGG + Intronic
1151832792 17:76565186-76565208 GTGCAAGGCAGCAGCTGGGGGGG - Intronic
1152492905 17:80649888-80649910 GGGCAAGGCAGGAAGTGCGTGGG - Intronic
1160879365 19:1312583-1312605 GTGCAAAGCTGCAGCAGGGTGGG + Intergenic
1161396961 19:4049765-4049787 GTGCAAAGCACAAGCTACGCTGG + Intronic
1165665158 19:37621847-37621869 GTGCCATGCAGCAGCTGCTTAGG - Intronic
1165772067 19:38385807-38385829 GGGCAGAGCAGGGGCTGCGGTGG + Exonic
1166337716 19:42118424-42118446 GTGGCCAGCAGGAGCTGAGTAGG - Intronic
925616817 2:5751583-5751605 GTGCACAGCAGGGGCTGCGTGGG + Intergenic
927452553 2:23221647-23221669 GTGAAAAGCAGGAGCTACTTAGG + Intergenic
928197304 2:29225097-29225119 GAGCCAAACAGGAGCTGCGCCGG + Intronic
928876173 2:36042443-36042465 GGCCAAAGCTGGAGCTGCTTGGG + Intergenic
929889983 2:45910852-45910874 CTGCACAGCAGGACCAGCGTGGG - Intronic
930345818 2:50179793-50179815 TTGAAAAGCAGCAGCTGCTTAGG + Intronic
931426997 2:62180286-62180308 GTGCAAAGCAGCAATTGCATAGG - Intergenic
937251907 2:120529229-120529251 CAGCAAAGCAGGAGCTGCAGGGG + Intergenic
937315968 2:120932326-120932348 GTGGAAAGCAGGAGGTGCAAGGG - Intronic
937447907 2:121974453-121974475 GGGCAAACCAGGAGTTGGGTGGG + Intergenic
939116509 2:138067745-138067767 GAGCAAAGCAGGAGTTAGGTTGG - Intergenic
942254713 2:174085295-174085317 CTGCACAGCAGGAGGTGAGTGGG + Intronic
942460518 2:176165116-176165138 GTGGAAAGCAGGCTCCGCGTAGG - Intronic
943743408 2:191436004-191436026 GTCCAAAGCACCAGCTGCGTAGG - Intergenic
944556410 2:200891616-200891638 GTGCAAGGCAGGAGATGGGATGG + Intronic
944753627 2:202736943-202736965 GTGATAAGCAGTAGCTGAGTAGG - Intronic
948746052 2:240095276-240095298 TATAAAAGCAGGAGCTGCGTTGG + Intergenic
1173336774 20:42118538-42118560 GTGCAAAGCAGCAGCTGAGAAGG + Intronic
1174589548 20:51634452-51634474 GGGAAAAGCAGCAGCTGTGTGGG + Intronic
1175272331 20:57743187-57743209 CTGCAAAGCAGCAGCTGGGAGGG - Intergenic
1175497020 20:59422361-59422383 ATGCAAGGCAGGTGCTGGGTGGG + Intergenic
1177756639 21:25356577-25356599 CTGCATAGCAGGAGCTGCAAAGG - Intergenic
1179589821 21:42399479-42399501 GTGCAAAGCTGCAGATGTGTAGG + Intergenic
1180558344 22:16595510-16595532 GTGCAGAGCAGGGTCTGCGTCGG + Intergenic
1181003049 22:19997014-19997036 GTGCAGGGCAGGAGCAGCGTGGG - Intronic
1183537995 22:38414189-38414211 GTGGAAAGCTGGAGGTGCTTTGG - Intergenic
1184173001 22:42770311-42770333 GAGCCAAGCAGCAGCTGCGTGGG + Intergenic
1184769609 22:46589581-46589603 CTGCAAAGCAGGGGCAGCATGGG - Intronic
1185109663 22:48893983-48894005 CTGGCAAGCAGGAGCTGCGATGG + Intergenic
1185121403 22:48973809-48973831 GTGCCCAGCAGGAGCAGAGTGGG + Intergenic
1185284774 22:49995327-49995349 GGGAACAGCAGGAGCTGGGTGGG - Exonic
1185317617 22:50185813-50185835 GGGCCAAGCAGGAGGCGCGTGGG + Intergenic
956924747 3:73971870-73971892 GTGAAAAGAAGGCGCTGCTTTGG + Intergenic
957415986 3:79905469-79905491 GTGCAAAGCAGGAGGTATCTAGG - Intergenic
962481597 3:135802883-135802905 GTTCAGAGCATGAGCTGTGTTGG - Intergenic
967345102 3:188446691-188446713 GAAGAAAGCAGGAGCTGAGTGGG - Intronic
968420564 4:480867-480889 ATGCAAAGCAGGAGCTGGAATGG - Intronic
969243533 4:5917815-5917837 GTGCAAACCAGGACCGGGGTGGG - Intronic
970454625 4:16210364-16210386 GTGCACAGCAGGAGGTGATTGGG - Intronic
974436654 4:61865519-61865541 GTGCAAAGGAGGAGCTATATGGG - Intronic
980270594 4:130579072-130579094 TTGCACAGCAGGAGGTGAGTCGG + Intergenic
982061805 4:151612342-151612364 GTGCAATGCATGGGCTGCTTGGG + Intronic
991996114 5:72388826-72388848 GAGCAAGGCAGAGGCTGCGTAGG + Intergenic
994352907 5:98767893-98767915 TTGTAAACCAGGAGCTGAGTTGG + Intergenic
996389713 5:122946874-122946896 GTGCAGGGCAGGAGCTGGGGTGG + Intronic
997605460 5:135172878-135172900 GTGCAGAGCAGCAGCTGTGAGGG + Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1002904578 6:1438328-1438350 TTGAAAGGCAGGAGCTGGGTGGG - Intergenic
1006744194 6:36330115-36330137 GCGCAAGGCAGCAGCTGCCTTGG + Exonic
1010021964 6:71170808-71170830 GAGGAAAGCAGGAGCGGGGTTGG + Intergenic
1012615717 6:101277407-101277429 TTGCAAAGCAAGAGGTGAGTGGG + Intergenic
1014620840 6:123665165-123665187 TTGCAAAGCAGAAGCAGGGTTGG - Intergenic
1014963621 6:127718398-127718420 GTTCAAAGCAGGTGCTGCTCTGG + Intronic
1015985656 6:138881848-138881870 CTGCATAGCAGGAGGTGAGTGGG - Intronic
1018891323 6:167985389-167985411 GTGCACAGCAGGAGGTGAGCAGG + Intergenic
1019522359 7:1466644-1466666 GTGCAGGGCAGGAGCTGCTTGGG - Intergenic
1024061643 7:45703005-45703027 GGGCACATCAGGAGCTGCCTGGG + Intronic
1024945324 7:54802301-54802323 GTGCCAGCCAGGAGCTGCTTGGG - Intergenic
1029582714 7:101447988-101448010 GTGCAAACTAGGACCTGCCTCGG - Intronic
1035791713 8:2312174-2312196 CTGCAGAGCAGGAGGTGAGTGGG - Intergenic
1035801092 8:2409531-2409553 CTGCAGAGCAGGAGGTGAGTGGG + Intergenic
1036974822 8:13398749-13398771 GAGCAAAGCAGGAGGTGGGAAGG + Intronic
1038253155 8:25925303-25925325 GTGCACAGAAGGAGCTGAGAGGG + Intronic
1038310257 8:26440970-26440992 GTGCGAAGGAGGAGCTGTGCCGG - Intronic
1041234107 8:55781587-55781609 GTGGGAAGCAGGAGCTGCACAGG - Intronic
1044417521 8:91953145-91953167 GTGGAAAGCAGGAACTCCCTAGG + Intergenic
1045516585 8:102864925-102864947 GTCCCAAGCAGGACCCGCGTTGG + Intronic
1047153419 8:122290953-122290975 GTGCCAATCAGAAGCTGAGTCGG - Intergenic
1047498767 8:125427066-125427088 GTGCATATCAGGAGCTGTTTTGG - Intergenic
1049278117 8:141730095-141730117 GGGCAAGGCAGGAGCTGGGGAGG - Intergenic
1049844358 8:144792797-144792819 GTGCAGAGCAGGAGATGGGCAGG + Intergenic
1051814077 9:21084399-21084421 GAGCAAAGCATGAGATGTGTGGG + Intergenic
1057353248 9:94317342-94317364 GGGCAGAGCAGGGGCTGCCTGGG - Intergenic
1057654503 9:96940250-96940272 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1058288230 9:103206389-103206411 GTGCAAGGCAGCAGCTGGGGGGG - Intergenic
1059769243 9:117412136-117412158 GGGTATAGCAGGAGCTGTGTAGG - Intronic
1059955326 9:119509679-119509701 GTGATAAGCAGGAGCTGAGCTGG - Intronic
1060525042 9:124315712-124315734 CTGCAAGGCAGGGGCTGCGGTGG - Intronic
1062288748 9:135785349-135785371 GTGCTCCGCAGAAGCTGCGTGGG - Intronic
1186273099 X:7911351-7911373 ATGCAATGGAGGAGCTGCCTTGG + Intronic
1186924193 X:14314091-14314113 GGGCAAAACAGGACCAGCGTGGG + Intergenic
1188285744 X:28323688-28323710 GTGAAAAGCAGGAGAAGCGAGGG - Intergenic
1193398684 X:81015957-81015979 GTGCAAAGCAGGTACTCAGTGGG + Intergenic
1199142319 X:144327653-144327675 GTGCAAAAAAGAAACTGCGTAGG + Intergenic
1200165664 X:154033479-154033501 GTGTAGAGAAGGAGCTGCTTCGG - Intronic
1202014910 Y:20393241-20393263 GTGCAAAGCAGGACCTGGAAGGG - Intergenic
1202042006 Y:20695612-20695634 CTGCAAAGCAGCAGCTGGGCAGG - Intergenic
1202046777 Y:20743510-20743532 CTGCACAGCAGGAGGTGCATAGG + Intergenic