ID: 1101775462

View in Genome Browser
Species Human (GRCh38)
Location 12:107789309-107789331
Sequence AAACAAGTAAAAGGCCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101775462_1101775469 -6 Left 1101775462 12:107789309-107789331 CCCCCAAGGCCTTTTACTTGTTT No data
Right 1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG No data
1101775462_1101775468 -9 Left 1101775462 12:107789309-107789331 CCCCCAAGGCCTTTTACTTGTTT No data
Right 1101775468 12:107789323-107789345 TACTTGTTTGCACAGAGAGAGGG No data
1101775462_1101775467 -10 Left 1101775462 12:107789309-107789331 CCCCCAAGGCCTTTTACTTGTTT No data
Right 1101775467 12:107789322-107789344 TTACTTGTTTGCACAGAGAGAGG No data
1101775462_1101775470 10 Left 1101775462 12:107789309-107789331 CCCCCAAGGCCTTTTACTTGTTT No data
Right 1101775470 12:107789342-107789364 AGGGAGGCCAAAAGTCCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101775462 Original CRISPR AAACAAGTAAAAGGCCTTGG GGG (reversed) Intergenic
No off target data available for this crispr