ID: 1101775464

View in Genome Browser
Species Human (GRCh38)
Location 12:107789311-107789333
Sequence GCAAACAAGTAAAAGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101775464_1101775470 8 Left 1101775464 12:107789311-107789333 CCCAAGGCCTTTTACTTGTTTGC No data
Right 1101775470 12:107789342-107789364 AGGGAGGCCAAAAGTCCGACTGG No data
1101775464_1101775469 -8 Left 1101775464 12:107789311-107789333 CCCAAGGCCTTTTACTTGTTTGC No data
Right 1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101775464 Original CRISPR GCAAACAAGTAAAAGGCCTT GGG (reversed) Intergenic
No off target data available for this crispr