ID: 1101775468

View in Genome Browser
Species Human (GRCh38)
Location 12:107789323-107789345
Sequence TACTTGTTTGCACAGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101775463_1101775468 -10 Left 1101775463 12:107789310-107789332 CCCCAAGGCCTTTTACTTGTTTG No data
Right 1101775468 12:107789323-107789345 TACTTGTTTGCACAGAGAGAGGG No data
1101775462_1101775468 -9 Left 1101775462 12:107789309-107789331 CCCCCAAGGCCTTTTACTTGTTT No data
Right 1101775468 12:107789323-107789345 TACTTGTTTGCACAGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101775468 Original CRISPR TACTTGTTTGCACAGAGAGA GGG Intergenic
No off target data available for this crispr